Funding for this research was provided by National Institutes of Health NIH-AR047410 (KEM)

This protocol follows the animal care guidelines of Oklahoma State University Center for Health Sciences IACUC (#2016-03).
1. Carrageenan-induced inflammation (C-II)
<ol>
	<li>Anesthetize male and/or female Sprague Dawley rats (200&#8211;250 g; 8&#8211;9 weeks old) with isoflurane (or injectable anesthetic).</li>
	<li>Check the depth of anesthesia by touching the cornea and lightly pinching the left hind paw. When the animal is appropriately anesthetized, no corneal or paw response will be observed.</li>
	<li>Subcutaneously inject the right glabrous, hind paw with 100 &#181;L of 1% (w/v) &#955;-carrageenan diluted in phosphate-buffered saline (PBS) and allow the rat to fully recover from anesthesia20.
	<ol>
		<li>Make sure that appropriate controls are used, such as na&#239;ve rats without isoflurane in this report. Preliminary studies indicate that na&#239;ve rats with or without isoflurane have the same basal expression of epidermal IL-6 and NGF. 
		NOTE: Na&#239;ve rats are preferred controls for inflammation studies since subcutaneous saline or PBS cause a local inflammation23,37.</li>
	</ol>
	</li>
	<li>At the 6-12 h time points, euthanize the rats with CO2 and measure hind paw metatarsal thickness with calipers. Cut 1 mm x 2 mm pieces of glabrous hind paw skin with a sharp scalpel. If there is hair&#160;on the skin, shave the area before cutting 1 mm x 2 mm pieces of skin. 
	NOTE: Make sure that the appropriate timepoints are chosen according to the specific studies.</li>
	<li>Using microdissection forceps, transfer the skin into 1 mL of cold Dulbecco&#39;s Modified Eagle Medium (DMEM) in a microcentrifuge tube on ice and keep cold for 15&#8211;60 min.</li>
</ol>
2. Thermolysin separation of epidermis and dermis
<ol>
	<li>Prepare and activate thermolysin.
	<ol>
		<li>Prepare a solution of thermolysin, by adding 5 mg of Geobacillus stearothermophilus to 10 mL of PBS, at pH = 8 (concentration 500 &#181;g/mL).</li>
		<li>Prepare a 1 M solution of calcium chloride (CaCl2 anhydrous) by adding 1.11 g into 10 mL of distilled H2O.</li>
		<li>To prevent autolysis of thermolysin, add 10 &#181;L of calcium chloride to 10 mL of thermolysin solution. The calcium chloride final concentration will be 1 mM.</li>
		<li>Aliquot 1 mL of activated thermolysin into 10 wells of a 24 well cell culture plate on ice.</li>
	</ol>
	</li>
	<li>Use thermolysin enzyme digestion to separate the epidermis from dermis.
	<ol>
		<li>Using microdissection forceps, transfer one skin sample into each well of activated thermolysin. Make sure not to immerse the skin in the thermolysin solution.</li>
		<li>Gently tap the skin on the side of the well to assist in releasing the skin sample from the forceps to float on the thermolysin solution.</li>
		<li>Float the skin into the thermolysin solution with the stratum corneum (outer epidermis) side up and dermis facing down. It is critical that the dermis faces down, or the effective separation will not take place. 
		NOTE: The amount of time for thermolysin incubation must be determined empirically by the end-user. Glabrous, hind paw skin from Sprague Dawley rats (200&#8211;250 g; 8&#8211;9 weeks old) often requires 2.0&#8211;2.5 h for separation. Incubation time is expected to vary with species and age.</li>
		<li>After the appropriate incubation time in thermolysin, use microdissection forceps to transfer one skin sample into a well of a 6 well cell culture plate with 7&#8211;8 mL of cold (4 &#176;C) DMEM. This allows more room for separation of the epidermis from the dermis.</li>
		<li>Immerse the skin into the DMEM.</li>
		<li>Gently brush the epidermis with the forceps around the perimeter of the skin until the near-translucent epidermis is observed at the borders. If this cannot be achieved, return the skin sample to the thermolysin solution for another 15&#8211;30 min.</li>
		<li>Once the epidermis noticeably separates from the dermis, then carefully hold both the epidermis and dermis with microdissection forceps and very slowly pull the epidermis from the dermis.</li>
		<li>Evaluate the translucence of the isolated epidermis and make sure it is optically consistent. See Figure 2 for an example of a 1 mm x 2 mm sample of rat epidermis. If there is a variation in the translucence, then proper separation has not occurred.</li>
	</ol>
	</li>
	<li>Inactivate thermolysin using ethylenediaminetetraacetic acid (EDTA) in the separated pieces of epidermis and dermis. 
	CAUTION: The thermolysin that remains in the epidermis and dermis is still active and can damage the layers if not inactivated.
	<ol>
		<li>Prepare a 0.5 M EDTA stock solution. To do so, slowly add 0.93 g EDTA into 5 mL of double-distilled water. Add sodium hydroxide to the solution until it clears. Ensure that the pH of the solution is ~8.0.</li>
		<li>Make a 5 mM EDTA solution in DMEM. Add 0.25 mL of 0.5 M EDTA stock solution to 25 mL of DMEM.</li>
		<li>Place the separated epidermis and dermis into the 5 mM EDTA/DMEM solution at 4 &#176;C for 30 min to deactivate thermolysin&#8217;s activity.</li>
	</ol>
	</li>
	<li>Evaluate the epidermis with tinctorial histology8,9,10.
	<ol>
		<li>Fix a portion of the epidermis in a 10% neutral formalin, 4% paraformaldehyde, or 0.25% paraformaldehyde with 0.8% picric acid solution for 1 h at room temperature (RT) with agitation.</li>
		<li>Place the fixed epidermis in 10% sucrose in PBS for 1 h at RT with agitation.</li>
		<li>Freeze the epidermis in a tissue embedding matrix for sectioning. Cut 14 &#181;m cross-sections using a cryostat and thaw-mount sections onto gelatin-coated glass microscope slides.</li>
		<li>Dry sections on a slide warmer and stain with a working solution of toluidine blue (TB; 10% TB in 1% sodium chloride) for 90 s. Appose coverslips with an aqueous mounting medium.</li>
		<li>Observe the epidermis with brightfield microscopy at 50x&#8211;250x. 
		NOTE: If proper separation has occurred, the epidermis will be divided cleanly from the dermis and the five layers will be detected: stratum basale, stratum spinosum, stratum granulosum, stratum lucidum, and stratum corneum. An example of separated rat skin epidermis can be seen in Figure 3.</li>
	</ol>
	</li>
</ol>
3. Protein extraction and western blot analysis
<ol>
	<li>Perform western blotting on the separated tissue samples using previously published protocol21.</li>
	<li>Homogenize the epidermis in 50 &#956;L of lysis buffer (25mM Tris HCl, pH = 7.4, 150 mM NaCl, 1 mM EDTA, 5% glycerol, and 1% Triton X-100) containing a phosphatase and protease inhibitor cocktail.</li>
	<li>Centrifuge samples at a max speed for 15 min at 4 &#176;C and evaluate the supernatant for protein concentration using a protein assay kit.</li>
	<li>Load equal concentrations of protein (30 &#181;g) onto SDS gels, perform electrophoresis, and then transfer proteins to nitrocellulose or PVDF membranes.</li>
	<li>Block membranes with 5% milk for 2 h and incubate overnight in primary antibody (mouse anti-NGF, E12, 1:1000).</li>
	<li>Wash 3x with PBS with 0.3% tween for 10 min each and incubate with a labeled secondary antibody (e.g., alkaline phosphatase labeled rabbit anti-mouse IgG).</li>
	<li>Use a scanning system to evaluate western blot signal (e.g., ECF substrate and an imaging platform).</li>
</ol>
4. Immunohistochemistry
<ol>
	<li>Place tissue samples in a fixative for optimal immunoreactivity: 0.96% (w/v) picric acid and 0.2% (w/v) formaldehyde in 0.1 M sodium phosphate buffer, pH = 7.321,22,23 for 4 h at RT. Transfer to 10% sucrose in PBS overnight at 4 &#176;C.</li>
	<li>Perform standard immunohistochemistry on the tissue sections21,22,23.</li>
	<li>Embed the epidermis from animals into a single frozen block in embedding matrix and cut 10&#8211;30 &#181;m sections on a cryostat. Mount the sections on gelatin-coated, glass microscope slides and dry at 37 &#176;C for 2 h.</li>
	<li>Wash sections for three, 10 min rinses in PBS and incubate for 24&#8211;96 h in primary antisera, [e.g., mouse anti-NGF (E12, 1:2000)] and rabbit anti-protein gene product 9.9 (PGP 9.5, 1:2000) diluted in PBS containing 0.3% (w/v) Triton X-100 (PBS-T) PBS-T with 0.5% bovine serum albumin (BSA) and 0.5% polyvinylpyrrolidone (PVP).</li>
	<li>After primary antiserum incubation, rinse sections three times for 10 min in PBS and incubate 1 h at RT in Alexa Fluor 488 donkey anti-rabbit IgG (1:1000) and Alexa Fluor 555 donkey anti-mouse IgG (1:1000) diluted in PBS-T.</li>
	<li>Rinse sections three times in PBS for 10 min and affix coverslips with non-fading mounting medium to retard fading of immunofluorescence.</li>
</ol>
5. RNA isolation and cDNA synthesis
<ol>
	<li>Perform standard reverse transcriptase polymerase chain reaction (RT-PCR) on the skin samples21. Isolate total RNA using a phenol, guanidine isothiocyanate solution.</li>
	<li>Carry out complementary DNA synthesis by Moloney murine leukemia virus reverse transcriptase.</li>
	<li>Use the following primer sequences for NGF and IL-6 amplification: 
	NGF (Sense) - GTGGACCCCAAACTGTTTAAGAAACGG 
	NGF (Antisense) &#8211; GTGAGTCCTGTTGAAGGAGATTGTACCATG 
	IL-6 (Sense) - GCAATTCTGATTGTATGAACAGCGATGATGC; 
	IL-6 (Antisense) &#8211; GTAGAAACGGAACTCCAGAAGACCAGAG</li>
	<li>Compare the levels of NGF and IL-6 mRNA to &#946;-actin housekeeping gene: 
	&#946;-ACTIN (Sense) - TGCGTGACATTAAAGAGAAGCTGTGCTATG 
	&#946;-ACTIN (Antisense) &#8211; GAACCGCTCATTGCCGATAGTGATGA</li>
	<li>Evaluate with qualitative RT-PCR using thermal cycler and quantitative real-time PCR (qRT-PCR) using a qRT-PCR system.</li>
</ol>

<ol>
	<li>Choi, J. E., Di Nardo, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Skin+neurogenic+inflammation.">Skin neurogenic inflammation.</a> Seminars in Immunopathology. 40 (3), 249-259 (2018).</li><li>Manti, S., Brown, P., Perez, M. K., Piedimonte, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+neurotrophins+in+inflammation+and+allergy.">The role of neurotrophins in inflammation and allergy.</a> Vitamins and Hormones. 104, 313-341 (2017).</li><li>Sch&#228;kel, K., Sch&#246;n, M. P., Ghoreschi, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogenesis+of+psoriasis.">Pathogenesis of psoriasis.</a> Zeitschrift f&#252;r Dermatologie, Venerologie, und verwandte Gebiete. 67 (6), 422-431 (2016).</li><li>Zou, Y., Maibach, H. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dermal-epidermal+separation+methods:+research+implications.">Dermal-epidermal separation methods: research implications.</a> Archives of Dermatological Research. 310 (1), 1-9 (2018).</li><li>Baumberger, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+the+separation+of+epidermis+from+dermis+and+some+physiologic+and+chemical+properties+of+isolated+epidermis.">Methods for the separation of epidermis from dermis and some physiologic and chemical properties of isolated epidermis.</a> Journal of the National Cancer Institute. 2, 413-423 (1942).</li><li>Felsher, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+the+adherence+of+the+epidermis+to+the+corium.">Studies on the adherence of the epidermis to the corium.</a> Journal of Investigative Dermatology. 8, 35-47 (1947).</li><li>Einbinder, J. M., Walzer, R. A., Mandl, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidermal-dermal+separation+with+proteolytic+enzymes.">Epidermal-dermal separation with proteolytic enzymes.</a> Journal of Investigative Dermatology. 46, 492-504 (1966).</li><li>Rakhorst, H. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+keratinocyte+isolation:+a+short+comparative+study+on+thermolysin+and+dispase.">Mucosal keratinocyte isolation: a short comparative study on thermolysin and dispase.</a> International Association of Oral and Maxillofacial Surgeons. 35 (10), 935-940 (2006).</li><li>Tschachler, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sheet+preparations+expose+the+dermal+nerve+plexus+of+human+skin+and+render+the+dermal+nerve+end+organ+accessible+to+extensive+analysis.">Sheet preparations expose the dermal nerve plexus of human skin and render the dermal nerve end organ accessible to extensive analysis.</a> Journal of Investigative Dermatology. 122 (1), 177-182 (2004).</li><li>Walzer, C., Benathan, M., Frenk, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thermolysin+treatment-a+new+method+for+dermo-epidermal+separation.">Thermolysin treatment-a new method for dermo-epidermal separation.</a> Journal of Investigative Dermatology. 92, 78-81 (1989).</li><li>Anderson, M. B., Miller, K. E., Schechter, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluation+of+rat+epidermis+and+dermis+following+thermolysin+separation:+PGP+9.5+and+Nav+1.8+localization.">Evaluation of rat epidermis and dermis following thermolysin separation: PGP 9.5 and Nav 1.8 localization.</a> Society for Neuroscience Abstract. 584 (9), (2010).</li><li>Ibitokun, B. O., Anderson, M. B., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+corneal+epithelium+from+the+stroma+using+thermolysin:+evaluation+of+corneal+afferents.">Separation of corneal epithelium from the stroma using thermolysin: evaluation of corneal afferents.</a> Society for Neuroscience Abstract. , 584 (2010).</li><li>Nawani, P., Anderson, M., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure-property+relationship+of+skin.">Structure-property relationship of skin.</a> Oklahoma Center for Neuroscience Symposium Abstract. , (2011).</li><li>Anderson, M. B., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intra-epidermal+nerve+fiber+reconstruction+and+quantification+in+three-dimensions.">Intra-epidermal nerve fiber reconstruction and quantification in three-dimensions.</a> Society for Neuroscience Abstract. 220, 23 (2017).</li><li>Gujar, V. K. E., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+nerve+growth+factor+in+adjuvant-induced+arthritis+(AIA):+A+temporal+study.">Expression of nerve growth factor in adjuvant-induced arthritis (AIA): A temporal study.</a> Society for Neuroscience Abstract. 220, 23 (2017).</li><li>Vinegar, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=to+carrageenan-induced+inflammation+in+the+hind+limb+of+the+rat.">to carrageenan-induced inflammation in the hind limb of the rat.</a> Federation Proceedings. 46 (1), 118-126 (1987).</li><li>Fehrenbacher, J. C., Vasko, M. R., Duarte, D. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Models+of+inflammation:+Carrageenan-+or+complete+Freund's+Adjuvant+(CFA)-induced+edema+and+hypersensitivity+in+the+rat.">Models of inflammation: Carrageenan- or complete Freund's Adjuvant (CFA)-induced edema and hypersensitivity in the rat.</a> Current Protocols in Pharmacology. , (2012).</li><li>Li, K. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=exerts+its+anti-inflammatory+effects+associated+with+suppressing+ERK/p38+MAPK+and+Heme+Oxygenase-1+activation+in+lipopolysaccharide-stimulated+RAW+264.7+macrophages+and+carrageenan-induced+mice+paw+edema.">exerts its anti-inflammatory effects associated with suppressing ERK/p38 MAPK and Heme Oxygenase-1 activation in lipopolysaccharide-stimulated RAW 264.7 macrophages and carrageenan-induced mice paw edema.</a> International Immunopharmacology. 54, 366-374 (2018).</li><li>Sammons, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Carrageenan-induced+thermal+hyperalgesia+in+the+mouse:+role+of+nerve+growth+factor+and+the+mitogen-activated+protein+kinase+pathway.">Carrageenan-induced thermal hyperalgesia in the mouse: role of nerve growth factor and the mitogen-activated protein kinase pathway.</a> Brain Research. 876 (1-2), 48-54 (2000).</li><li>Hoffman, E. M., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peripheral+inhibition+of+glutaminase+reduces+carrageenan+induced+Fos+expression+in+the+superficial+dorsal+horn+of+the+rat.">Peripheral inhibition of glutaminase reduces carrageenan induced Fos expression in the superficial dorsal horn of the rat.</a> Neuroscience Letters. 472 (3), 157-160 (2010).</li><li>Crosby, H. A., Ihnat, M., Spencer, D., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+glutaminase+and+vesicular+glutamate+transporter+type+2+immunoreactivity+in+rat+sacral+dorsal+root+ganglia+following+a+surgical+tail+incision.">Expression of glutaminase and vesicular glutamate transporter type 2 immunoreactivity in rat sacral dorsal root ganglia following a surgical tail incision.</a> Pharmacy and Pharmacology International Journal. 2 (3), 00023 (2015).</li><li>Hoffman, E. M., Schechter, R., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fixative+composition+alters+distributions+of+immunoreactivity+for+glutaminase+and+two+markers+of+nociceptive+neurons+Nav1.8+and+TRPV1,+in+the+rat+dorsal+ganglion.">Fixative composition alters distributions of immunoreactivity for glutaminase and two markers of nociceptive neurons Nav1.8 and TRPV1, in the rat dorsal ganglion.</a> Journal of Histochemistry and Cytochemistry. 58 (4), 329-344 (2010).</li><li>Hoffman, E. M., Zhang, Z., Schechter, R., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glutaminase+increases+in+rat+dorsal+root+ganglion+neurons+after+unilateral+adjuvant-induced+hind+paw+inflammation.">Glutaminase increases in rat dorsal root ganglion neurons after unilateral adjuvant-induced hind paw inflammation.</a> Biomolecules. 6 (1), 10 (2016).</li><li>van den Burg, B., Eijsink, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thermolysin+and+related+Bacillus+metallopeptidases.">Thermolysin and related Bacillus metallopeptidases.</a> Handbook of Proteolytic Enzymes. , 540-553 (2013).</li><li>Matthews, B. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thermolysin.">Thermolysin.</a> Encyclopedia of Inorganic and Bioinorganic Chemistry. , (2011).</li><li>Hybbinette, S., Bostr&#246;m, M., Lindberg, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+dissociation+of+keratinocytes+from+human+skin+biopsies+for+in+vitro+cell+propagation.">Enzymatic dissociation of keratinocytes from human skin biopsies for in vitro cell propagation.</a> Experimental Dermatology. 8 (1), 30-38 (1999).</li><li>Glade, C. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiparameter+flow+cytometric+characterization+of+epidermal+cell+suspensions+prepared+from+normal+and+hyperproliferative+human+skin+using+an+optimized+thermolysin-trypsin+protocol.">Multiparameter flow cytometric characterization of epidermal cell suspensions prepared from normal and hyperproliferative human skin using an optimized thermolysin-trypsin protocol.</a> Archives of Dermatological Research. 288 (4), 203-210 (1996).</li><li>Sato, J. D., Kan, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Media+for+culture+of+mammalian+cells.">Media for culture of mammalian cells.</a> Current Protocols in Cell Biology. , (2001).</li><li>Gragnani, A., Sobral, C. S., Ferreira, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thermolysin+in+human+cultured+keratinocyte+isolation.">Thermolysin in human cultured keratinocyte isolation.</a> Brazilian Journal of Biology. 67 (1), 105-109 (2007).</li><li>Germain, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improvement+of+human+keratinocyte+isolation+and+culture+using+thermolysin.">Improvement of human keratinocyte isolation and culture using thermolysin.</a> Burns. 19 (2), 99-104 (1993).</li><li>Michel, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+new+tissue-engineered+human+skin+equivalent+with+hair.">Characterization of a new tissue-engineered human skin equivalent with hair.</a> In Vitro Cellular &amp; Developmental Biology. Animal. 35 (6), 318-326 (1999).</li><li>Fassina, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autolysis+of+thermolysin.+Isolation+and+characterization+of+a+folded+three-fragment+complex.">Autolysis of thermolysin. Isolation and characterization of a folded three-fragment complex.</a> European Journal of Biochemistry. 156 (2), 221-228 (1986).</li><li>Petho, G., Reeh, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sensory+and+signaling+mechanisms+of+bradykinin,+eicosanoids,+platelet-activating+factor,+and+nitric+oxide+in+peripheral+nociceptors.">Sensory and signaling mechanisms of bradykinin, eicosanoids, platelet-activating factor, and nitric oxide in peripheral nociceptors.</a> Physiological Reviews. 92 (4), 1699-1775 (2012).</li><li>Djouhri, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Time+course+and+nerve+growth+factor+dependence+of+inflammation-induced+alterations+in+electrophysiological+membrane+properties+in+nociceptive+primary+afferent+neurons.">Time course and nerve growth factor dependence of inflammation-induced alterations in electrophysiological membrane properties in nociceptive primary afferent neurons.</a> Journal of Neuroscience. 21 (22), 8722-8733 (2001).</li><li>Denk, F., Bennett, D. L., McMahon, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nerve+growth+factor+and+pain+mechanisms.">Nerve growth factor and pain mechanisms.</a> Annual Review of Neuroscience. 40, 307-325 (2017).</li><li>Flint, M. S., Dearman, R. J., Kimber, I., Hotchkiss, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+and+in+situ+localization+of+cutaneous+tumour+necrosis+factor+alpha+(TNF-alpha)+and+interleukin+6+(IL-6)+following+skin+sensitization.">Production and in situ localization of cutaneous tumour necrosis factor alpha (TNF-alpha) and interleukin 6 (IL-6) following skin sensitization.</a> Cytokine. 10 (3), 213-219 (1998).</li><li>Crosby, H. A., Ihnat, M., Miller, K. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evaluating+the+toxicity+of+the+analgesic+glutaminase+inhibitor+6-diazo-5-oxo-L-norleucine+in+vitro+and+on+rat+dermal+skin+fibroblasts.">Evaluating the toxicity of the analgesic glutaminase inhibitor 6-diazo-5-oxo-L-norleucine in vitro and on rat dermal skin fibroblasts.</a> MOJ Toxicology. 1 (1), 00005 (2015).</li></ol>

The authors have no disclosures.

The study determined that the epidermis of rat hind paw glabrous skin was easily separated from dermis using thermolysin (0.5 mG/mL) in PBS with 1 mM calcium chloride at 4 &deg;C for 2.5 h. Histological evaluation indicated that the epidermis was separated from the dermis at the basement membrane and that the epidermal rete ridges were intact. Thermolysin is an extracellular metalloendopeptidase produced by Gram-positive (Geo)Bacillus thermoproteolyticus24. Its activity is stable...

Evaluation of inflammatory mediators and neurotrophic factors from the skin can be limited due to the heterogeneity of cell types found in the inflamed dermis and epidermis1,2,3. Several enzymes, chemical, thermal, or mechanical techniques involving separation of the two layers or for performing cell dissociation for evaluation have been reviewed recently4. Acid, alkali, neutral salt, and heat can divide the epidermis from dermis quickly, but cellular and extracellular swelling often occurs5,6. Trypsin, pancreatin, elastase, keratinase, collagenase, pronase, dispase, and thermolysin are enzymes that have been used for epidermal-dermal separation4,7. Trypsin and other broad scale proteolytic enzymes are active at 37&ndash;40 &deg;C but must be monitored carefully to prevent dissociation of epidermal layers. Dispase cleaves the epidermis at the lamina densa, but requires 24 h for separation in the cold4,8 or shorter timepoints at 37 &deg;C4,9. A limiting feature of all these techniques is the potential disruption of tissue morphology and loss of integrity of mRNA and protein.
To maintain the integrity of mRNA and protein, a skin separation method should be carried out in the cold for a short period of time. In evaluating skin separation techniques for inflammation studies, thermolysin is an effective enzyme to separate the epidermis from dermis at cold temperatures4. Thermolysin is active at 4 &deg;C, cleaves epidermal hemidesmosomes from the lamina lucida, and separates the epidermis from dermis within 1&ndash;3 h4,8,10. The goal of this report is to optimize the use of thermolysin for separation of inflamed rat epidermis from dermis to detect mRNA and protein levels for inflammatory mediators and neurotrophic factors. Several preliminary reports have been presented11,12,13,14,15. The objective of this manuscript is to describe an optimal skin separation technique using thermolysin and demonstrate the detection of 1) markers of inflammation, 2) interleukin-6 (IL-6) mRNA, and 3) nerve growth factor (NGF) mRNA and protein in the epidermis of rats with carrageenan-induced inflammation (C-II)16,17. A preliminary report using the complete Freund&rsquo;s adjuvant model indicates that NGF mRNA and protein levels increase early during inflammation15. In mice, skin sensitization with the topical application of oxazolone causes an early rise in the IL-6 mRNA using in situ hybridization36. Both IL-6 and NGF have been implicated in C-II18,19, but there have been no reports describing mRNA or protein levels for IL-6 or NGF specifically from the epidermis during the acute stages of C-II.
The thermolysin technique is inexpensive and straightforward to perform. Furthermore, thermolysin separation of the epidermis from dermis allows for mRNA, western blot, and immunohistochemical analysis of inflammatory mediators and neurotrophic factors during the process of inflammation15. Investigators should be able to easily use this technique in both preclinical and clinical studies of skin inflammation.

<table>
	<tbody>
		<tr>
			<td>&#955;-carrageenan</td>
			<td>Millipore Sigma</td>
			<td>22049</td>
			<td>Subcutaneous injection of carrageenan induces inflammation</td>
		</tr>
		<tr>
			<td>7500 Fast Real-Time PCR System</td>
			<td>Thermo Fisher Scientific</td>
			<td>4351107</td>
			<td>For RT-PCR analysis</td>
		</tr>
		<tr>
			<td>Calcium chloride (CaCl2), anhydrous</td>
			<td>Millipore Sigma</td>
			<td>499609</td>
			<td>Prevents autolysis of thermolysin</td>
		</tr>
		<tr>
			<td>Crystal Mount Aqueous Mounting Medium</td>
			<td>Millipore Sigma</td>
			<td>C0612</td>
			<td>Aqueous mounting medium after toluidine blue staining</td>
		</tr>
		<tr>
			<td>Donkey anti-Mouse Alexa Fluor 555</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-31570</td>
			<td>Secondary antibody for immunohistochemistry</td>
		</tr>
		<tr>
			<td>Donkey anti-Rabbit IgG, Alexa Fluor 488</td>
			<td>Thermo Fisher Scientific</td>
			<td>A-21206</td>
			<td>Secondary antibody for immunohistochemistry</td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s Modified Eagle Medium</td>
			<td>Thermo Fisher Scientific</td>
			<td>11966-025</td>
			<td>To maintain tissue integrity</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid</td>
			<td>Millipore Sigma</td>
			<td>E6758</td>
			<td>Stops thermolysin reaction</td>
		</tr>
		<tr>
			<td>Moloney Murine Leukemia Virus (M-MLV) Reverse transcriptase</td>
			<td>Promega</td>
			<td>M1701</td>
			<td>For complementary DNA synthesis</td>
		</tr>
		<tr>
			<td>Mouse anti-NGF Antibody (E-12)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-365944</td>
			<td>For neurotrophin immunohistochemistry</td>
		</tr>
		<tr>
			<td>ProLong Gold Antifade Mountant</td>
			<td>Thermo Fisher Scientific</td>
			<td>P36930</td>
			<td>To retard immunofluorescence quenching</td>
		</tr>
		<tr>
			<td>Rabbit anti-PGP 9.5</td>
			<td>Cedarlane Labs</td>
			<td>CL7756AP</td>
			<td>For intraepidermal nerve staining</td>
		</tr>
		<tr>
			<td>SAS Sprague Dawley Rat</td>
			<td>Charles River</td>
			<td>Strain Code 400</td>
			<td>Animal used for inflammation studies</td>
		</tr>
		<tr>
			<td>Shandon M-1 Embedding Matrix</td>
			<td>Thermo Fisher Scientific</td>
			<td>1310TS</td>
			<td>Tissue embedding matrix for tinctorial- and immuno-histochemistry</td>
		</tr>
		<tr>
			<td>SimpliAmp Thermal Cycler</td>
			<td>Thermo Fisher Scientific</td>
			<td>A24811</td>
			<td>For RT-PCR analysis</td>
		</tr>
		<tr>
			<td>SYBR Select Master Mix</td>
			<td>Thermo Fisher Scientific</td>
			<td>4472908</td>
			<td>For RT-PCR analysis</td>
		</tr>
		<tr>
			<td>Thermolysin</td>
			<td>Millipore Sigma</td>
			<td>T7902</td>
			<td>From Geobacillus stearothermophilus</td>
		</tr>
		<tr>
			<td>Toluidine Blue</td>
			<td>Millipore Sigma</td>
			<td>89640</td>
			<td>For tinctorial staining for brightfield microscopy</td>
		</tr>
		<tr>
			<td>TRIzol Reagent</td>
			<td>Thermo Fisher Scientific</td>
			<td>15596026</td>
			<td>For total RNA extraction for RTPCR</td>
		</tr>
	</tbody>
</table>

separation of rat epidermis and dermis with thermolysin to detect site-specific inflammatory mrna and protein

Easy-to-use and inexpensive techniques are needed to determine the site-specific production of inflammatory mediators and neurotrophins during skin injury, inflammation, and/or sensitization. The goal of this study is to describe an epidermal-dermal separation protocol using thermolysin, a proteinase that is active at 4 &deg;C. To illustrate this procedure, Sprague Dawley rats are anesthetized, and right hind paws are injected with carrageenan. Six and twelve hours after injection, rats with inflammation and na&iuml;ve rats are euthanized, and a piece of hind paw, glabrous skin is placed in cold Dulbecco's Modified Eagle Medium. The epidermis is then separated at the basement membrane from the dermis by thermolysin in PBS with calcium chloride. Next, the dermis is secured by microdissection forceps, and the epidermis is gently teased away. Toluidine blue staining of tissue sections show that the epidermis is separated cleanly from the dermis at the basement membrane. All keratinocyte cell layers remain intact, and the epidermal rete ridges along with indentations from dermal papillae are clearly observed. Qualitative and real-time RT-PCR is used to determine nerve growth factor and interleukin-6 expression levels. Western blotting and immunohistochemistry are finally performed to detect amounts of nerve growth factor. This report illustrates that cold thermolysin digestion is an effective method to separate epidermis from dermis for evaluation of mRNA and protein alterations during inflammation.

Carrageenan injection into the rat hind paw caused classic symptoms of inflammation such as redness and edema16,17. The swelling of the hind paw was measured with mechanical calipers20. A baseline value of the thickness of the paw was obtained for each rat before carrageenan treatment and measured again at 6 h and 12 h. Paw thickness was increased significantly compared to the baseline values (Figure 1).
<...

Watch this Scientific Journal Video about Separation of Rat Epidermis and Dermis with Thermolysin to Detect Site-Specific Inflammatory mRNA and Protein at JoVE.com

Separation of Rat Epidermis and Dermis with Thermolysin to Detect Site-Specific Inflammatory mRNA and Protein

Presented here is a protocol for the separation of epidermis from dermis to evaluate inflammatory mediator production. Following inflammation, rat hind paw epidermis is separated from the dermis by thermolysin at 4 &#176;C. The epidermis is then used for mRNA analysis by RT-PCR and protein evaluation by western blot and immunohistochemistry.

Easy-to-use and inexpensive techniques are needed to determine the site-specific production of inflammatory mediators and neurotrophins during skin ...

separation-rat-epidermis-dermis-with-thermolysin-to-detect-site

Research

JoVE Journal

Immunology and Infection

5.1K Views.  Oklahoma State University Center for Health Sciences. Presented here is a protocol for the separation of epidermis from dermis to evaluate inflammatory mediator production. Following inflammation, rat hind paw epidermis is separated from the dermis by thermolysin at 4 °C. The epidermis is then used for mRNA analysis by RT-PCR and protein evaluation by western blot and immunohistochemistry.

Video: Separation of Rat Epidermis and Dermis with Thermolysin to Detect Site-Specific Inflammatory mRNA and Protein

Peptide:MHC Tetramer-based Enrichment of Epitope-specific T cells

A basic necessity for researchers studying adaptive immunity with in vivo experimental models is an ability to identify T cells based on their T cell antigen receptor (TCR) specificity. Many indirect methods are available in which a bulk population of T cells is stimulated in vitro with a specific antigen and epitope-specific T cells are identified through the measurement of a functional response such as proliferation, cytokine production, or expression of activation markers1. However, these methods only identify epitope-specific T cells exhibiting one of many possible functions, and they are not sensitive enough to detect epitope-specific T cells at naive precursor frequencies. A popular alternative is the TCR transgenic adoptive transfer model, in which monoclonal T cells from a TCR transgenic mouse are seeded into histocompatible hosts to create a large precursor population of epitope-specific T cells that can be easily tracked with the use of a congenic marker antibody2,3. While powerful, this method suffers from experimental artifacts associated with the unphysiological frequency of T cells with specificity for a single epitope4,5. Moreover, this system cannot be used to investigate the functional heterogeneity of epitope-specific T cell clones within a polyclonal population.
	The ideal way to study adaptive immunity should involve the direct detection of epitope-specific T cells from the endogenous T cell repertoire using a method that distinguishes TCR specificity solely by its binding to cognate peptide:MHC (pMHC) complexes. The use of pMHC tetramers and flow cytometry accomplishes this6, but is limited to the detection of high frequency populations of epitope-specific T cells only found following antigen-induced clonal expansion. In this protocol, we describe a method that coordinates the use of pMHC tetramers and magnetic cell enrichment technology to enable detection of extremely low frequency epitope-specific T cells from mouse lymphoid tissues3,7. With this technique, one can comprehensively track entire epitope-specific populations of endogenous T cells in mice at all stages of the immune response.

This protocol describes the use of peptide:MHC tetramers and magnetic microbeads to isolate low frequency populations of epitope-specific T cells and analyze them by flow cytometry. This method enables the direct study of endogenous T cell populations of interest from in vivo experimental systems.

A  basic necessity for researchers studying adaptive immunity with in vivo experimental models is an  ability to identify T cells based on their T cell ...

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing the mucosal surface of the nasopharynx, where it can reside, multiply and eventually overcome host defences to invade to other tissues of the host. Establishment of an infection in the normally lower respiratory tract results in pneumonia. Alternatively, the bacteria can disseminate into the bloodstream causing bacteraemia, which is associated with high mortality rates2, or else lead directly to the development of pneumococcal meningitis. Understanding the kinetics of, and immune responses to, nasopharyngeal colonization is an important aspect of S. pneumoniae infection models.
Our mouse model of intranasal colonization is adapted from human models3 and has been used by multiple research groups in the study of host-pathogen responses in the nasopharynx4-7. In the first part of the model, we use a clinical isolate of S. pneumoniae to establish a self-limiting bacterial colonization that is similar to carriage events in human adults. The procedure detailed herein involves preparation of a bacterial inoculum, followed by the establishment of a colonization event through delivery of the inoculum via an intranasal route of administration. Resident macrophages are the predominant cell type in the nasopharynx during the steady state. Typically, there are few lymphocytes present in uninfected mice8, however mucosal colonization will lead to low- to high-grade inflammation (depending on the virulence of the bacterial species and strain) that will result in an immune response and the subsequent recruitment of host immune cells. These cells can be isolated by a lavage of the tracheal contents through the nares, and correlated to the density of colonization bacteria to better understand the kinetics of the infection.

Characterization of Inflammatory Responses During Intranasal Colonization with Streptococcus pneumoniae

Colonization of the murine nasopharynx with Streptococcus pneumoniae and the subsequent extraction of adherent or recruited cells is described. This technique involves flushing the nasopharynx and collection of the fluid through the nares and is adaptable for various readouts, including differential cell quantification and analysis of mRNA expression in situ.

Nasopharyngeal colonization by Streptococcus pneumoniae is a prerequisite to invasion to the lungs or bloodstream1. This organism is capable of colonizing ...

Monitoring the Assembly of a Secreted Bacterial Virulence Factor Using Site-specific Crosslinking

This article describes a method to detect and analyze dynamic interactions between a protein of interest and other factors in vivo. Our method is based on the amber suppression technology that was originally developed by Peter Schultz and colleagues1. An amber mutation is first introduced at a specific codon of the gene encoding the protein of interest. The amber mutant is then expressed in E. coli together with genes encoding an amber suppressor tRNA and an amino acyl-tRNA synthetase derived from Methanococcus jannaschii. Using this system, the photo activatable amino acid analog p-benzoylphenylalanine (Bpa) is incorporated at the amber codon. Cells are then irradiated with ultraviolet light to covalently link the Bpa residue to proteins that are located within 3-8 &#197;. Photocrosslinking is performed in combination with pulse-chase labeling and immunoprecipitation of the protein of interest in order to monitor changes in protein-protein interactions that occur over a time scale of seconds to minutes. We optimized the procedure to study the assembly of a bacterial virulence factor that consists of two independent domains, a domain that is integrated into the outer membrane and a domain that is translocated into the extracellular space, but the method can be used to study many different assembly processes and biological pathways in both prokaryotic and eukaryotic cells. In principle interacting factors and even specific residues of interacting factors that bind to a protein of interest can be identified by mass spectrometry.

This article illustrates the use of pulse-chase radio labeling in combination with site-specific photocrosslinking to monitor interactions between a protein of interest and other factors in E. coli. Unlike traditional chemical cross-linking methods, this approach generates high resolution &#8220;snapshots&#8221; of an ordered assembly pathway in a living cell.

This article describes a method to detect and analyze dynamic interactions between a protein of interest and other factors in vivo. Our method is based on ...

Ex Vivo Infection of Murine Epidermis with Herpes Simplex Virus Type 1

To enter its human host, herpes simplex virus type 1 (HSV-1) must overcome the barrier of mucosal surfaces, skin, or cornea. HSV-1 targets keratinocytes during initial entry and establishes a primary infection in the epithelium, which is followed by latent infection of neurons. After reactivation, viruses can become evident at mucocutaneous sites that appear as skin vesicles or mucosal ulcers. How HSV-1 invades skin or mucosa and reaches its receptors is poorly understood. To investigate the invasion route of HSV-1 into epidermal tissue at the cellular level, we established an ex vivo infection model of murine epidermis, which represents the site of primary and recurrent infection in skin. The assay includes the preparation of murine skin. The epidermis is separated from the dermis by dispase II treatment. After floating the epidermal sheets on virus-containing medium, the tissue is fixed and infection can be visualized at various times postinfection by staining infected cells with an antibody against the HSV-1 immediate early protein ICP0. ICP0-expressing cells can be observed in the basal keratinocyte layer already at 1.5 hr postinfection. With longer infection times, infected cells are detected in suprabasal layers, indicating that infection is not restricted to the basal keratinocytes, but the virus spreads to other layers in the tissue. Using epidermal sheets of various mouse models, the infection protocol allows determining the involvement of cellular components that contribute to HSV-1 invasion into tissue. In addition, the assay is suitable to test inhibitors in tissue that interfere with the initial entry steps, cell-to-cell spread and virus production. Here, we describe the ex vivo infection protocol in detail and present our results using nectin-1- or HVEM-deficient mice.

Ex Vivo Infection of Murine Epidermis with Herpes Simplex Virus Type 1

The skin is one target tissue of the human pathogen herpes simplex virus type 1 (HSV-1). To explore the invasion route of HSV-1 into tissue, we established an ex vivo infection model of murine epidermal sheets which represent the outermost layer of skin.

To enter its human host, herpes simplex virus type 1 (HSV-1) must overcome the barrier of mucosal surfaces, skin, or cornea. HSV-1 targets keratinocytes ...

Bioluminescence Imaging to Detect Late Stage Infection of African Trypanosomiasis

Human African trypanosomiasis (HAT) is a multi-stage disease that manifests in two stages; an early blood stage and a late stage when the parasite invades the central nervous system (CNS). In vivo study of the late stage has been limited as traditional methodologies require the removal of the brain to determine the presence of the parasites.
Bioluminescence imaging is a non-invasive, highly sensitive form of optical imaging that enables the visualization of a luciferase-transfected pathogen in real-time. By using a transfected trypanosome strain that has the ability to produce late stage disease in mice we are able to study the kinetics of a CNS infection in a single animal throughout the course of infection, as well as observe the movement and dissemination of a systemic infection.
Here we describe a robust protocol to study CNS infections using a bioluminescence model of African trypanosomiasis, providing real time non-invasive observations which can be further analyzed with optional downstream approaches.

This manuscript describes the use of a bioluminescent strain of African trypanosomes to enable the tracking of late stage infection and demonstrates how in vivo live imaging can be used to visualize infections within the central nervous system in real-time.

Human African trypanosomiasis (HAT) is a multi-stage disease that manifests in two stages; an early blood stage and a late stage when the parasite invades ...

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

Lymphocyte extravasation into the central nervous system (CNS) is critical for immune surveillance. Disease-related alterations of lymphocyte extravasation might result in pathophysiological changes in the CNS. Thus, investigation of lymphocyte migration into the CNS is important to understand inflammatory CNS diseases and to develop new therapy approaches. Here we present an in vitro model of the human blood-brain barrier to study lymphocyte extravasation. Human brain microvascular endothelial cells (HBMEC) are confluently grown on a porous polyethylene terephthalate transwell insert to mimic the endothelium of the blood-brain barrier. Barrier function is validated by zonula occludens immunohistochemistry, transendothelial electrical resistance (TEER) measurements as well as analysis of evans blue permeation. This model allows investigation of the diapedesis of rare lymphocyte subsets such as CD56brightCD16dim/- NK cells. Furthermore, the effects of other cells, cytokines and chemokines, disease-related alterations, and distinct treatment regimens on the migratory capacity of lymphocytes can be studied. Finally, the impact of inflammatory stimuli as well as different treatment regimens on the endothelial barrier can be analyzed.

Analysis of Lymphocyte Extravasation Using an In Vitro Model of the Human Blood-brain Barrier

Here, we describe a human blood-brain barrier model enabling to investigate lymphocyte transmigration into the central nervous system in vitro.

Lymphocyte extravasation into the central nervous system (CNS) is critical for immune surveillance. Disease-related alterations of lymphocyte ...

Bronchoalveolar Lavage of Murine Lungs to Analyze Inflammatory Cell Infiltration

Bronchoalveolar Lavage (BAL) is an experimental procedure that is used to examine the cellular and acellular content of the lung lumen ex vivo to gain insight into an ongoing disease state.
Here, a simple and efficient method is described to perform BAL on murine lungs without the need of special tools or equipment. BAL fluid is isolated by inserting a catheter in the trachea of terminally anesthetized mice, through which a saline solution is instilled into the bronchioles. The instilled fluid is gently retracted to maximize BAL fluid retrieval and to minimize shearing forces. This technique allows the viability, function, and structure of cells within the airways and BAL fluid to be preserved.
Numerous techniques may be applied to gain further understanding of the disease state of the lung. Here, a commonly used technique for the identification and enumeration of different types of immune cells is described, where&#160;flow cytometry is combined with a select panel of fluorescently labeled cell surface-specific markers. The BAL procedure presented here can also be used to analyze infectious agents, fluid constituents, or inhaled particles within murine lungs.

The health status of the lung is reflected by the type and number of immune cells that are present in the bronchioles of the lung. We describe a bronchoalveolar lavage technique that allows the isolation and study of nonadherent cells and soluble factors from the lower respiratory tract of mice.

Bronchoalveolar Lavage (BAL) is an experimental procedure that is used to examine the cellular and acellular content of the lung lumen ex vivo to gain ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory response by the endothelial layer is crucial to efficiently fight against harmful inputs and aid in the recovery of damaged areas. When the endothelial cells are exposed to an inflammatory environment, such as the outer component of gram-negative bacteria membrane, lipopolysaccharide (LPS), they express soluble pro-inflammatory cytokines, such as Ccl5, Cxcl1 and Cxcl10, and trigger the activation of circulating leukocytes. In addition, the expression of adhesion molecules E-selectin, VCAM-1 and ICAM-1 on the endothelial surface enables the interaction and adhesion of the activated leukocytes to the endothelial layer, and eventually the extravasation towards the inflamed tissue. In this scenario, the endothelial function must be tightly regulated because excessive or defective activation in the leukocyte recruitment could lead to inflammatory-related disorders. Since many of these disorders do not have an effective treatment, novel strategies with a focus on the vascular layer must be investigated. We propose comprehensive assays that are useful to the search of novel endothelial regulators that modify leukocyte function. We analyze endothelial activation by using specific expression targets involved in leukocyte recruitment (such as, cytokines, chemokines, and adhesion molecules) with several techniques, including: real-time quantitative polymerase chain reaction (RT-qPCR), western-blot, flow cytometry and adhesion assays. These approaches determine endothelial function in the inflammatory context and are very useful to perform screening assays to characterize novel endothelial inflammatory regulators that are potentially valuable for designing new therapeutic strategies.

Vascular endothelium tightly controls leukocyte recruitment. Inadequate leukocyte extravasation contributes to human inflammatory diseases. Therefore, searching for novel regulatory elements of endothelial activation is necessary to design improved therapies for inflammatory disorders. Here, we describe a comprehensive methodology to characterize novel endothelial regulators that can modify leukocyte trafficking during inflammation.

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory ...

Quantification of Monocyte Transmigration and Foam Cell Formation from Individuals with Chronic Inflammatory Conditions

Coronary artery disease (CAD) is a leading cause of morbidity and mortality worldwide. Atherosclerosis, a leading cause of CAD, is initiated by the transmigration of innate immune monocytes to inflammatory sites of deposited lipid called fatty streaks, which are present in arterial walls of medium to large arteries. The key pathogenic feature of lesions at this early stage of atherosclerosis is the maturation of monocytes which migrate into arteries to form foam cells or lipid-laden macrophages. Considerable evidence supports the hypothesis that risk of atherosclerosis is increased by chronic inflammatory conditions accompanying diseases such as rheumatoid arthritis and HIV, as well as general ageing, and that this risk is predicted by monocyte activation. While mouse models provide a good platform to investigate the role of monocytes in atherogenesis in vivo, they require genetic alteration of natural cholesterol metabolism and drastic alteration of normal mouse diets, and have limited suitability for the study of atherogenic influences of human comorbid diseases. This motivated us to develop a human in vitro model to measure the atherogenic potential of monocytes isolated from individuals with defined disease states. Currently, human in vitro models are limiting in that they evaluate monocyte transmigration and foam cell formation in isolation. Here we describe a protocol in which monocytes isolated from patient blood transmigrate across human endothelial cells into a type 1 collagen matrix, and their propensity to mature into foam cells in the presence or absence of exogenous lipid is measured. The protocol has been validated for the use of human monocytes purified from individuals with HIV infection and elderly HIV uninfected individuals. This model is versatile and allows monocyte transmigration and foam cell formation to be evaluated using either microscopy or flow cytometry as well as allowing the assessment of atherogenic factors present in serum or plasma.

We describe a protocol to measure transmigration by monocytes across human endothelial monolayers and their subsequent maturation into foam cells. This provides a versatile method to assess the atherogenic properties of monocytes isolated from people with different disease conditions and to evaluate factors in blood which may enhance this propensity.

Coronary artery disease (CAD) is a leading cause of morbidity and mortality worldwide. Atherosclerosis, a leading cause of CAD, is initiated by the ...

Targeting Cysteine Thiols for in Vitro Site-specific Glycosylation of Recombinant Proteins

Stromal interaction molecule-1 (STIM1) is a type-I transmembrane protein located on the endoplasmic reticulum (ER) and plasma membranes (PM). ER-resident STIM1 regulates the activity of PM Orai1 channels in a process known as store operated calcium (Ca2+) entry which is the principal Ca2+ signaling process that drives the immune response. STIM1 undergoes post-translational N-glycosylation at two luminal Asn sites within the Ca2+ sensing domain of the molecule. However, the biochemical, biophysical, and structure biological effects of N-glycosylated STIM1 were poorly understood until recently due to an inability to readily obtain high levels of homogeneous N-glycosylated protein. Here, we describe the implementation of an in vitro chemical approach which attaches glucose moieties to specific protein sites applicable to understanding the underlying effects of N-glycosylation on protein structure and mechanism. Using solution nuclear magnetic resonance spectroscopy we assess both efficiency of the modification as well as the structural consequences of the glucose attachment with a single sample. This approach can readily be adapted to study the myriad glycosylated proteins found in nature.

Targeting Cysteine Thiols for in Vitro Site-specific Glycosylation of Recombinant Proteins

Biochemical and structural analyses of glycosylated proteins require relatively large amounts of homogeneous samples. Here, we present an efficient chemical method for site-specific glycosylation of recombinant proteins purified from bacteria by targeting reactive Cys thiols.

Stromal interaction molecule-1 (STIM1) is a type-I transmembrane protein located on the endoplasmic reticulum (ER) and plasma membranes (PM). ER-resident ...