The authors gratefully acknowledge the patients and their families who contributed biomaterial for this study. Cells lines used in the study were from NINDS collection with Rutgers (ND41865 as iPS#1) and the lab of Dr. Tilo Kunath (iPS#2). This work is supported in part by the NOMIS Foundation (PH), RiMod-FTD, an EU Joint Programme - Neurodegenerative Disease Research (JPND) (PH); The DZNE I2A initiative (AD); PD-Strat, an ERA-Net ERACoSysMed funded project (PH) and the Foundational Data Initiative for Parkinson&#39;s Disease (FOUNDIN-PD) (PH, EB). FOUNDIN-PD is part of The Michael J. Fox Foundation&#8217;s PATH to PD program. The authors thank Steven Finkbeiner and Melanie Cobb (Gladstone Institutes) for contributing to the establishment of the manual mDA neuron differentiation protocol and Mahomi Suzuki (Yokogawa Electric Corporation) for assistance in neurite outgrowth analysis setup.

<ol>
	<li>Takahashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+adult+human+fibroblasts+by+defined+factors.">Induction of pluripotent stem cells from adult human fibroblasts by defined factors.</a> Cell. 131 (5), 861-872 (2007).</li><li>Payne, N. L., Sylvain, A., O'Brien, C., Herszfeld, D., Sun, G., Bernard, C. C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+human+induced+pluripotent+stem+cells+for+modeling+and+treating+neurodegenerative+diseases.">Application of human induced pluripotent stem cells for modeling and treating neurodegenerative diseases.</a> New biotechnology. 32 (1), 212-228 (2015).</li><li>Wu, Y. Y., Chiu, F. L., Yeh, C. S., Kuo, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Opportunities+and+challenges+for+the+use+of+induced+pluripotent+stem+cells+in+modelling+neurodegenerative+disease.">Opportunities and challenges for the use of induced pluripotent stem cells in modelling neurodegenerative disease.</a> Open Biology. 9 (1), 180177 (2019).</li><li>Avior, Y., Sagi, I., Benvenisty, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pluripotent+stem+cells+in+disease+modelling+and+drug+discovery.">Pluripotent stem cells in disease modelling and drug discovery.</a> Nature Reviews Molecular cell biology. 17 (3), 170-182 (2016).</li><li>Jain, S., Heutink, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+single+genes+to+gene+networks:+high-throughput-high-content+screening+for+neurological+disease.">From single genes to gene networks: high-throughput-high-content screening for neurological disease.</a> Neuron. 68 (2), 207-217 (2010).</li><li>Soares, F. A. C., Chandra, A., Thomas, R. J., Pedersen, R. A., Vallier, L., Williams, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+the+feasibility+of+scale+up+and+automation+of+human+induced+pluripotent+stem+cells+cultured+in+aggregates+in+feeder+free+conditions.">Investigating the feasibility of scale up and automation of human induced pluripotent stem cells cultured in aggregates in feeder free conditions.</a> Journal of biotechnology. 173, 53-58 (2014).</li><li>Konagaya, S., Ando, T., Yamauchi, T., Suemori, H., Iwata, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+maintenance+of+human+induced+pluripotent+stem+cells+by+automated+cell+culture+system.">Long-term maintenance of human induced pluripotent stem cells by automated cell culture system.</a> Scientific reports. 5, 16647 (2015).</li><li>Conway, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Scalable+96-well+Plate+Based+iPSC+Culture+and+Production+Using+a+Robotic+Liquid+Handling+System.">Scalable 96-well Plate Based iPSC Culture and Production Using a Robotic Liquid Handling System.</a> Journal of visualized experiments: JoVE. (99), e52755 (2015).</li><li>Paull, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=high-throughput+derivation,+characterization+and+differentiation+of+induced+pluripotent+stem+cells.">high-throughput derivation, characterization and differentiation of induced pluripotent stem cells.</a> Nature methods. 12 (9), 885-892 (2015).</li><li>Busskamp, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+neurogenesis+through+transcriptional+activation+in+human+stem+cells.">Rapid neurogenesis through transcriptional activation in human stem cells.</a> Molecular systems biology. 10, 760 (2014).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78 (5), 785-798 (2013).</li><li>Reinhardt, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+and+expansion+using+only+small+molecules+of+human+neural+progenitors+for+neurodegenerative+disease+modeling.">Derivation and expansion using only small molecules of human neural progenitors for neurodegenerative disease modeling.</a> PloS one. 8 (3), 59252 (2013).</li><li>Kriks, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dopamine+neurons+derived+from+human+ES+cells+efficiently+engraft+in+animal+models+of+Parkinson's+disease.">Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson's disease.</a> Nature. 480 (7378), 547-551 (2011).</li><li>Koch, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-Synuclein+affects+neurite+morphology,+autophagy,+vesicle+transport+and+axonal+degeneration+in+CNS+neurons.">Alpha-Synuclein affects neurite morphology, autophagy, vesicle transport and axonal degeneration in CNS neurons.</a> Cell death &amp; disease. 6, 1811 (2015).</li><li>Korecka, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurite+Collapse+and+Altered+ER+Ca2++Control+in+Human+Parkinson+Disease+Patient+iPSC-Derived+Neurons+with+LRRK2+G2019S+Mutation.">Neurite Collapse and Altered ER Ca2+ Control in Human Parkinson Disease Patient iPSC-Derived Neurons with LRRK2 G2019S Mutation.</a> Stem cell reports. 12 (1), 29-41 (2019).</li><li>Mehta, S. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Huntington's+Disease+iPSC-Derived+Cortical+Neurons+Display+Altered+Transcriptomics,+Morphology,+and+Maturation.">Human Huntington's Disease iPSC-Derived Cortical Neurons Display Altered Transcriptomics, Morphology, and Maturation.</a> Cell reports. 25 (4), 1081-1096 (2018).</li><li>Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-BLAST:+a+tool+to+design+target-specific+primers+for+polymerase+chain+reaction.">Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction.</a> BMC bioinformatics. 13, 134 (2012).</li><li>Spandidos, A., Wang, X., Wang, H., Seed, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PrimerBank:+a+resource+of+human+and+mouse+PCR+primer+pairs+for+gene+expression+detection+and+quantification.">PrimerBank: a resource of human and mouse PCR primer pairs for gene expression detection and quantification.</a> Nucleic acids research. 38, 792 (2010).</li></ol>

We have nothing to disclose.

We introduce an automated cell culture system with integrated imaging capabilities for the standardization of hiPSC culture and neuronal differentiation. Due to minimal user intervention, experimental variation is low ensuring reproducibility of cellular phenotypes during differentiation. The calendar-based scheduler supports the organization and parallelization of experiments and allows a high degree of flexibility at which time the experiments are carried out. Existing methods can be easily adapted and the spectrum of available methods can be increased. Additionally, a large number of assay plate formats can be used adding to the flexibility of this system. The minimal system consisting of a CO2 incubator, a robotic arm, a brightfield cell cytometer, and a liquid handling station forms the basic unit needed for hiPSC culture and differentiation, with affordable costs to academic research laboratories. The combination of the automated cell culture system with an automated -20 &#176;C storage system for storage of compounds, RNAi libraries or CRISPR/Cas9 libraries, and the integration of a high-content/high-throughput microscope enable&#160;the execution of phenotypic screenings.
In the current study, the automated cell culture system used disposable tips and the culture media was refilled manually into the reservoir, thus limiting the use of the liquid handling station for media changes and other culture processes especially overnight. To circumvent this limitation, the methods can be adjusted to needle usage instead of disposable tips and, after installing tube connections between media lines and media bags stored in a fridge, media reservoirs can be automatically refilled with fresh media pre-warmed by heater elements. This would reduce user interferences caused by manual refilling of tips, culture media and reservoir exchanges.
Our automated cell culture system offers several advantages. One is the barcode tracking system. The plates loaded in the system are identified by a unique barcode which is read and saved by the system allowing tracking of samples during and after method execution. Another advantage is the possibility to create user specific projects. Here, culture plates loaded in the system can be assigned to a specific project and grouped in batches. The structuring in batches simplifies the execution of the same procedure to all plates of a certain batch since no individual plates need to be selected. Additionally, a liquid class editor allows to adjust the pipetting speed and height as well as the aspiration and dispensing parameters for each liquid transfer step. Every process is documented in log files allowing to retrace which tasks have been performed for a given culture or assay plate.
Neurons and other cell types derived from human induced pluripotent stem cells (hiPSC) are useful in vitro tools for studying the mechanisms of neurodegenerative diseases in specific patient populations (e.g. dopaminergic neurons for Parkinson&#8217;s disease) offering the possibility for personalized drug screenings. Culturing hiPSC is very time intensive and demands trained people to execute complex differentiation protocols, usually limited to low scale production. We adapted the feeder-free culture of hiPSC to an automated culture and implemented two neuronal differentiation protocols, a rapid cortical neuron differentiation protocol based on NGN2 over-expression under a tet-on promoter10,11, and a long-term small molecule-based protocol for generation of midbrain dopaminergic (mDA) neurons13. The straightforward transfer and reproducibility of manual culture and differentiation protocols makes the automated culture system very useful. Human iPSC cultured in the automated cell culture system showed consistent stem cell morphology and expressed important pluripotency markers, reproducible between independent experiments. In addition, the automation of the hiPSC culture protocol favored the culture and expansion of a larger number of cell lines in parallel. Automated confluency checks scheduled to be performed overnight saved time leaving the system free during the day for downstream process steps carried out when the user was in the laboratory (e.g., harvesting of cells or manual replating for differentiations). On reaching the user-defined confluence threshold, cells are passaged and replated into extracellular matrix-coated plates available on the stacker of the automated cell culture system. Each passage round takes about 70 min and generates four 1-well plates from one parent plate, which translates to a capacity of 20 passages in a day.
The automation of the NGN2 differentiation protocol was done successfully and allowed the generation of a homogeneous population of neuronal cells across different passages and comparable to manual differentiations. Moreover, the experimental costs for large-scale screening studies involving multiple cell lines or screening experiments with thousands of test conditions/compounds would be reduced due to rapid differentiations. Cost-effective and high-throughput readouts including live-cell neurite outgrowth measurements can be easily developed, implemented and used as phenotypic readouts for disease modeling, as shown previously14,15,16. Thus, we further adapted the NGN2 protocol using small molecule derived neural precursor (smNPC) cells that constitutively over-express GFP. The smNPC cells offer further advantages including reduced costs with culture media (one third of the cost with iPSC culture) and time required to scale up experiments. The cell yields from smNPC are 7 to 10 times higher than that obtained with iPSC. The differentiating neurons were successfully monitored and imaged for several days using a fully automated imaging process without the need of manual antibody stainings or chemical labeling, saving costs and time required for manual procedures including the imaging by itself. The current imaging of inner 60 wells of a 96-well plate takes around 16 min per plate when 25 fields per well are imaged, which means that the data for an imaging-based screening for 1000 compounds, could be acquired and analyzed in a day. In the future, this readout could be used in compound screening studies for the rescue of neurite outgrowth defects.
Further, we also demonstrate the transfer of a manual differentiation protocol for generating midbrain dopaminergic (mDA) neurons from iPSC. This small molecule-based differentiation protocol takes 65 days and is labor intensive because of the multiple replating steps and frequent media changes, mostly every 2 days, which limits the production of mDA neurons to few iPSC lines at the same time. The automated mDA differentiation protocol has the great advantage of scaling up the differentiation to dozens of iPSC lines. Up to 30 cell lines could be differentiated in parallel. Since the differentiation is mostly based on media changes, almost the whole differentiation process can&#160;be conducted without human interference. Using the calendar-based scheduler of the automated system, we could plan the media changes according to the differentiation steps. One limitation of working with such a large number of cell lines and culture plates was the impossibility to perform overnight media changes. The main reason is the fact that our system is set up for using disposable tips and manual refilling of culture media requiring an user in the laboratory to execute this manual step. To facilitate the media change process, plates loaded in the system were assigned to a project and grouped in batches. The batch size was then adapted to the number of disposable tips and volume of culture media available. As discussed above, this limitation can be easily overcome by implementation of reusable/washable needles and automated refilling of media. Automated passaging/replating of cells, as shown for iPSC, is one of the conveniences offered by our automated cell culture system. We have tested the automated replating of mDA neurons on day 25 of differentiation. However, the dissociation of mDA neurons requires longer (40 min) incubation with the dissociation enzyme than iPSC (8 min) extending the automated replating process to more than 1 h per cell lines. As a consequence, the automated replating of 30 cell lines in the same day became impossible. Speeding up other steps during automated replating (transport of plates, pipetting) and adapting the system to the use of needles and media line that makes an overnight work possible would resolve this limitation. Despite the drawbacks, we could successfully transfer the manual protocol to an automated differentiation of mDA neurons producing cultures with substantial amounts of MAP2 (neuron) and TH (mDA neurons) positive cells.
Differentiating dozens of iPSC cell lines in parallel is of great interest in projects that investigate the molecular mechanisms of neurodegenerative diseases, including Parkinson&#8217;s disease. However, to complete tasks faster with fewer errors and at reduced costs is a big challenge. Due to the automation of the protocols presented here (iPSC, smNPC and mDA neuron), we could speed up, reduce the costs and increase reproducibility in our projects. The development of projects like FOUNDIN-PD (https://www.foundinpd.org/wp/) involving hundreds of patient cell lines shows need for automated culture and differentiation protocols. Our future perspectives include the transfer of manual 3 dimensional (3D) cell culture models to the automated system. Minor adaptations in the plate definition settings and the use of adaptors will allow the use of commercial or custom-made plates and microfluidic chambers required for the 3D cultures. Moreover, the implementation of an automated label-free imaging model will allow us to track the neuronal growth in real time and translate changes in neurite outgrowth, neuron organization and cell death into better understanding of the disease mechanisms.

Human induced pluripotent stem cells (hiPSC) are self-renewing and can differentiate in almost any adult cell type. These characteristics make hiPSC a useful tool for disease modeling in basic research and drug discovery1. Human iPSC retains the donor genetic background which allows deriving disease-relevant cell types that are most affected/involved in the disease course, for example, different neuronal subtypes for neurodegenerative diseases2,3. Also, hiPSC overcomes some of the limitations of animal and cellular over-expression models by modeling diseases in a human context and physiological protein expression levels, and have proven to be a valuable asset in modeling diseases ranging from monogenic, complex and epigenetic disorders as well as late-onset diseases4.
Despite these benefits and opportunities, several limitations of hiPSC still need to be addressed. Current hiPSC culture and differentiation protocols are not cost-effective, difficult to standardize and are labor-intensive. Manual culture steps can result in high variability in the yields and phenotypes due to differences in growth and spontaneous differentiation of hiPSC. Therefore, experimenter-dependent variation needs to be reduced by implementing more standardized handling techniques and simplifying protocols which can be achieved using automation5. The establishment of automated hiPSC culture and differentiation protocols will set common standards for both academic and industrial research projects, and allow the generation of biologically relevant disease models and more reproducible results.
Previous work has attempted automation of hiPSC cultures6,7,8 but their protocols have been restricted to specific cell culture plate formats dependent on the system and lacking adaptability to different assay formats. Such systems are useful in the bulking of cells but may not be suitable for automated differentiation into desired cell types, disease phenotyping, and screening purposes. Additionally, a large-scale automated platform for fibroblast derivation, hiPSC generation and differentiation has been described9 but on a scale that can only be achieved by high-throughput laboratories dedicated to the production of lines which seems attractive but can be unaffordable for many academic laboratories.
We developed a fully automated cell culture system based on a liquid handling station in a High-Efficiency Particulate Air (HEPA)-filtered environment in conjunction with a large-capacity CO2 incubator, a brightfield imaging cytometer and a robotic arm for plate transport. These components provide the basis for stable and reproducible hiPSC culture and differentiation. We complemented the system with an automated -20 &#176;C storage system for compound or virus storage and a high-speed spinning disk confocal live-cell imager. Custom-made protocols were generated allowing automated cell seeding, media changes, confluency checks, cell expansion and assay plate generation with sample treatment and plate imaging, making the system compatible with high-content/high-throughput screenings. The automated cell culture and imaging system are operated using the controlling software and the custom-made graphical user interface (GUI). The GUI allows users to import CSV files containing cell line-specific parameters needed for method execution. Additionally, the GUI enables to schedule numerous experiments in any sequence using the built-in calendar view thus allowing full control of the time when each method starts.
Our automated cell culture system uses standardized pipetting speeds, passaging times, confluency thresholds, seeding densities, and medium volumes with the flexibility to culture cells in a variety of plate formats (96-, 48-, 24-, 12-, 6- or 1-well plate format). We adapted a recently published short-term differentiation protocol for converting hiPSC into neurons that can yield TUBB3 positive neurons in 6 days10,11. We also established the automated differentiation and imaging of small molecule neural precursor cells (smNPC) into neurons constitutively expressing GFP under EF1a promoter12 and iPSC into midbrain dopaminergic (mDA) neurons, adapting a previously published dual-SMAD inhibition protocol13 that yields mDA neurons within 65 days.

<table><tbody><tr><td>&lt;strong&gt;Antibodies&lt;/strong&gt;</td><td>&lt;strong&gt;Distributor&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Dilution&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;iPSC pluripotency marker&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Mouse anti-SSEA4</td><td>Abcam</td><td>ab16287</td><td>1 to 33</td></tr><tr><td>Rabbit anti-Oct3/4</td><td>Abcam</td><td>ab19857</td><td>1 to 200</td></tr><tr><td>&lt;strong&gt;NGN2 neuron markers&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Mouse anti- TUBB3</td><td>R &amp;amp; D</td><td>MAB1195</td><td>1 to 500</td></tr><tr><td>Rabbit anti-BRN2</td><td>NEB</td><td>12137</td><td>1 to 1,000</td></tr><tr><td>&lt;strong&gt;mDA neuron markers&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Chicken anti-TH</td><td>Pel-Freez Biologicals</td><td>12137</td><td>1 to 750</td></tr><tr><td>Mouse anti-MAP2</td><td>Santa Cruz</td><td>sc-74421</td><td>1 to 750</td></tr><tr><td>&lt;strong&gt;Secondary antibodies&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Goat anti-chicken IgY, Alexa Fluor 488</td><td>Invitrogen</td><td>A11039</td><td>1 to 2,000</td></tr><tr><td>Goat anti-mouse IgG, Alexa Fluor 488</td><td>Invitrogen</td><td>A11029</td><td>1 to 2,000</td></tr><tr><td>Goat anti-mouse IgG, Alexa Fluor 594</td><td>Invitrogen</td><td>A11032</td><td>1 to 2,000</td></tr><tr><td>Goat anti-rabbit IgG, Alexa Fluor 488</td><td>Invitrogen</td><td>A11008</td><td>1 to 2,000</td></tr><tr><td>Goat anti-rabbit IgG, Alexa Fluor 488</td><td>Invitrogen</td><td>A11008</td><td>1 to 2,000</td></tr><tr><td>Goat anti-rabbit IgG, Alexa Fluor 594</td><td>Invitrogen</td><td>A11012</td><td>1 to 2,000</td></tr><tr><td>&lt;strong&gt;Nuclei counterstaining&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Hoechest 33342</td><td>Invitrogen</td><td>H3570</td><td>1 to 8,000</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Instruments&lt;/strong&gt;</td><td>&lt;strong&gt;Distributor&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Description/Application&lt;/strong&gt;</td></tr><tr><td>Agilent TapeStation system</td><td>Agilent technologies</td><td>4200</td><td>Automated electrophoresis&lt;br/&gt; for DNA and RNA samples</td></tr><tr><td>Automated -20 &amp;deg;C storage system</td><td>Hamilton Storage&lt;br/&gt; Technologies</td><td>Sample Access Manager&lt;br/&gt; (SAM -20C, 3200 series)</td><td>Storage of reagents</td></tr><tr><td>Barcode reader</td><td>Honeywell</td><td>Barcode Reader Orbit</td><td>Barcode scanner</td></tr><tr><td>Brightfield cell cytomat</td><td>Nexcelom</td><td>Celigo</td><td>Confluence check and&lt;br/&gt; cell counting</td></tr><tr><td>CellVoyager 7000</td><td>Yokogawa</td><td>CellVoyager 7000</td><td>Automated confocal&lt;br/&gt; microscope</td></tr><tr><td>Cytomat for cell cultures</td><td>Thermo Fisher Scientific</td><td>Cytomat 24 C, CU</td><td>12 stackers pitch 28 mm,&lt;br/&gt; 12 stackers pitch 23 mm&lt;br/&gt; (total of 456 plates)</td></tr><tr><td>Cytomat for thawing samples</td><td>Thermo Fisher Scientific</td><td>Cytomat 2-LIN, 60 DU&lt;br/&gt; (Drying Unit)</td><td>2 stackers pitch 28 mm&lt;br/&gt; (total of 42 plates)</td></tr><tr><td>HEPA filters</td><td>Hamilton Robotics</td><td>Hood Flow Star UV</td><td>Modified by Hamilton&lt;br/&gt; Robotics</td></tr><tr><td>Liquid handling station</td><td>Hamilton Robotics</td><td>Microlab Star</td><td>Channels: 8x 1-ml, 4x 5 ml&lt;br/&gt; and 96 Channel MPH</td></tr><tr><td>Media reservoir</td><td>Hamilton Robotics</td><td>188211APE</td><td>Media/reagents reservoir</td></tr><tr><td>Pure water system</td><td>Veolia Water</td><td>ELGA PURELAB Classic</td><td>Provides pure water for&lt;br/&gt; needle wash station</td></tr><tr><td>QuantStudio 12K Flex Real-Time&lt;br/&gt; PCR System</td><td>Thermo Fisher Scientific</td><td>QSTUDIO12KOA</td><td>Real-time PCR machine</td></tr><tr><td>Robotic arm</td><td>Hamilton Robotics</td><td>Rackrunner</td><td>Transport of plates</td></tr><tr><td>Turn table</td><td>Hamilton Robotics</td><td>Turn Table</td><td>Adjust plate orientiation</td></tr><tr><td>Uninterruptible power supply</td><td>APC</td><td>Smart UPS RT Unit,&lt;br/&gt; 10000 VA Power supply</td><td>Backup power supply</td></tr><tr><td>VIAFLO-pipettes</td><td>Integra</td><td>4500</td><td>Electronic pipette</td></tr><tr><td>ViiA 7 Real-Time PCR System</td><td>Applied Biosystems</td><td>4453545</td><td>Real-time PCR machine</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Materials&lt;/strong&gt;</td><td>&lt;strong&gt;Distributor&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Notes&lt;/strong&gt;</td></tr><tr><td>1-well culture plate (84 cm&lt;sup&gt;2&lt;/sup&gt;)</td><td>Thermo Fischer Scientific</td><td>165218</td><td>Nunc OmniTray</td></tr><tr><td>6-well culture plates (9.6 cm&lt;sup&gt;2&lt;/sup&gt;)</td><td>Greiner Bio-One</td><td>657160</td><td>TC treated with lid</td></tr><tr><td>12-well culture plate (3.9 cm&lt;sup&gt;2&lt;/sup&gt;)</td><td>Greiner Bio-One</td><td>665180</td><td>TC treated with lid</td></tr><tr><td>96-well culture plate (0.32 cm&lt;sup&gt;2&lt;/sup&gt;)</td><td>Perkin Elmer</td><td>6005558</td><td>CellCarrier-96 Black plate</td></tr><tr><td>Tips, 50-&amp;micro;L</td><td>Hamilton Robotics</td><td>235987</td><td>50-uL tips</td></tr><tr><td>Tips, 300-&amp;micro;L</td><td>Hamilton Robotics</td><td>235985</td><td>300-&amp;micro;L tips</td></tr><tr><td>Tips, 1000-&amp;micro;L</td><td>Hamilton Robotics</td><td>235939</td><td>1000-&amp;micro;L tips</td></tr><tr><td>Tips, 5-mL</td><td>Hamilton Robotics</td><td>184022</td><td>5-mL tips</td></tr><tr><td>Tubes, 15-mL</td><td>Greiner Bio-One</td><td>188271</td><td>15-mL tubes</td></tr><tr><td>Tubes, 50-mL</td><td>Greiner Bio-One</td><td>227261</td><td>50-mL tubes</td></tr><tr><td>Nalgene cryogenic 2.0 mL vials</td><td>Sigma Aldrich</td><td>V5007</td><td>Cryovials</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Plasmids&lt;/strong&gt;</td><td>&lt;strong&gt;Distributor&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Notes&lt;/strong&gt;</td></tr><tr><td>pLV_hEF1a_rtTA3</td><td>Addgene</td><td>61472</td><td>Kind gift from Ron Weiss</td></tr><tr><td>pLV_TRET_hNgn2_UBC_Puro</td><td>Addgene</td><td>61474</td><td>Kind gift from Ron Weiss</td></tr><tr><td>pLVX-EF1a-AcGFP1-N1 lentivirus</td><td>Takara Bio</td><td>631983</td><td></td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primers&lt;/strong&gt;</td><td>&lt;strong&gt;Sequence (forward)&lt;/strong&gt;</td><td>&lt;strong&gt;Sequence (reverse)&lt;/strong&gt;</td><td>&lt;strong&gt;Source&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;iPSC pluripotency&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>OCT4 (ID 4505967a1)</td><td>CTTGAATCCCGAATGGAAAGGG</td><td>GTGTATATCCCAGGGTGATCCTC</td><td>PrimerBank</td></tr><tr><td>NANOG (ID 153945815c3)</td><td>CCCCAGCCTTTACTCTTCCTA</td><td>CCAGGTTGAATTGTTCCAGGTC</td><td>PrimerBank</td></tr><tr><td>REX1 (ID 89179322c1)</td><td>AGAAACGGGCAAAGACAAGAC</td><td>GCTGACAGGTTCTATTTCCGC</td><td>PrimerBank</td></tr><tr><td>&lt;strong&gt;NGN2 neurons&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>MAP2 (ID 87578393c1)</td><td>CTCAGCACCGCTAACAGAGG</td><td>CATTGGCGCTTCGGACAAG</td><td>PrimerBank</td></tr><tr><td>BRN2 (ID 380254475c1)</td><td>CGGCGGATCAAACTGGGATTT</td><td>TTGCGCTGCGATCTTGTCTAT</td><td>PrimerBank</td></tr><tr><td>CUX2 (ID 291045458c2)</td><td>CGAGACCTCCACACTTCGTG</td><td>TGTTTTTCCGCCTCATTTCTCTG</td><td>PrimerBank</td></tr><tr><td>NCAM1 (ID 336285437c3)</td><td>TGTCCGATTCATAGTCCTGTCC</td><td>CTCACAGCGATAAGTGCCCTC</td><td>PrimerBank</td></tr><tr><td>SYNAPSIN1 (ID 91984783c3)</td><td>TGCTCAGCAGTACAACGTACC</td><td>GACACTTGCGATGTCCTGGAA</td><td>PrimerBank</td></tr><tr><td>&lt;strong&gt;mDA neurons&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>TH</td><td>CGGGCTTCTCGGACCAGGTGTA</td><td>CTCCTCGGCGGTGTACTCCACA</td><td>NCBI primer-BLAST</td></tr><tr><td>MAP2</td><td>GGATCAACGGAGAGCTGAC</td><td>TCAGGACTGCTACAGCCTCA</td><td>NCBI primer-BLAST</td></tr><tr><td>&lt;strong&gt;Housekeeping genes&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>GAPDH</td><td>GAAATCCCATCACCATCTTCCAGG</td><td>GAGCCCCAGCCTTCTCCATG</td><td>NCBI primer-BLAST</td></tr><tr><td>OAZ1</td><td>AGCAAGGACAGCTTTGCAGTT</td><td>ATGAAGACATGGTCGGCTCG</td><td>NCBI primer-BLAST</td></tr><tr><td>RPLPO</td><td>CCTCATATCCGGGGGAATGTG</td><td>GCAGCAGCTGGCACCTTATTG</td><td>NCBI primer-BLAST</td></tr><tr><td>RPL13A</td><td>GCCTACAAGAAAGTTTGCCTATC</td><td>TGGCTTTCTCTTTCCTCTTCTC</td><td>NCBI primer-BLAST</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Media and Reagents&lt;/strong&gt;</td><td>&lt;strong&gt;Distributor&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Use concentration&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Coating matrix&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Extracellular matrix (Matrigel)</td><td>Corning</td><td>354277</td><td>10 &amp;mu;g/mL</td></tr><tr><td>Fibronectin</td><td>Corning</td><td>356008</td><td>2 &amp;mu;g/mL</td></tr><tr><td>Laminin</td><td>Sigma</td><td>L2020</td><td>5 - 10 &amp;mu;g/mL</td></tr><tr><td>Poly-L-Ornithine (PLO)</td><td>Sigma</td><td>P3655</td><td>0.1 mg/mL</td></tr><tr><td>&lt;strong&gt;Culture media&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>iPSC culture medium&lt;br/&gt; (Essential 8 Flex medium)</td><td>Gibco</td><td>A2858501</td><td></td></tr><tr><td>&lt;strong&gt;NGN2 neurons - NGN2 medium&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>2-mercaptoethanol</td><td>Gibco</td><td>21985023</td><td>0.909 mL (50 &amp;micro;M)</td></tr><tr><td>B27 supplement</td><td>Gibco</td><td>12587010</td><td>10 mL (1%)</td></tr><tr><td>DMEM/F-12, GlutaMAX</td><td>Gibco</td><td>31331093</td><td>484.75 mL</td></tr><tr><td>GlutaMAX</td><td>Gibco</td><td>35050038</td><td>5 mL ( 2 mM)</td></tr><tr><td>Insulin</td><td>Sigma</td><td>I9278</td><td>0.25 mL (2.5 &amp;micro;g/mL)</td></tr><tr><td>MEM Non-Essential Amino Acids</td><td>Gibco</td><td>11140050</td><td>5 mL (0.5%)</td></tr><tr><td>N2 supplement</td><td>Gibco</td><td>17502048</td><td>5 mL (0.5%)</td></tr><tr><td>Neurobasal medium</td><td>Gibco</td><td>21103049</td><td>485 mL</td></tr><tr><td>&lt;strong&gt;mDA neurons - SRM medium&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>2-mercaptoethanol</td><td>Gibco</td><td>21985023</td><td>0.5 mL (55 &amp;micro;M)</td></tr><tr><td>GlutaMAX</td><td>Gibco</td><td>35050038</td><td>5 mL (2 mM)</td></tr><tr><td>Knockout DMEM/F-12</td><td>Gibco</td><td>12660012</td><td>409.5 mL</td></tr><tr><td>Knockout serum replacement&lt;br/&gt; (serum replacement)</td><td>Gibco</td><td>10828028</td><td>75 mL (15%)</td></tr><tr><td>MEM Non-Essential Amino Acids</td><td>Gibco</td><td>11140050</td><td>5 mL (1%)</td></tr><tr><td>Penicillin-Streptomycin</td><td>Gibco</td><td>15140122</td><td>5 mL (1%)</td></tr><tr><td>&lt;strong&gt;mDA neurons - N2 medium&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>B27 supplement</td><td>Gibco</td><td>12587010</td><td>10 mL (2%)</td></tr><tr><td>GlutaMAX</td><td>Gibco</td><td>35050038</td><td>5 mL (2 mM)</td></tr><tr><td>N2 supplement</td><td>Gibco</td><td>17502048</td><td>5 mL (1%)</td></tr><tr><td>Neurobasal medium</td><td>Gibco</td><td>21103049</td><td>475 mL</td></tr><tr><td>Penicillin-Streptomycin</td><td>Gibco</td><td>15140122</td><td>5 mL(1%)</td></tr><tr><td>&lt;strong&gt;mDA neurons - Differentiation medium&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>B27 supplement</td><td>Gibco</td><td>12587010</td><td>10 mL (2%)</td></tr><tr><td>Neurobasal medium</td><td>Gibco</td><td>21103049</td><td>485 mL</td></tr><tr><td>Penicillin-Streptomycin</td><td>Gibco</td><td>15140122</td><td>5 mL (1%)</td></tr><tr><td>&lt;strong&gt;NGN2 neurons - Supplements&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Brain-Derived Neurotrophic Factor&lt;br/&gt; (BDNF)</td><td>Peprotech</td><td>450-02</td><td>10 ng/mL</td></tr><tr><td>CHIR99021 (CHIR)</td><td>R&amp;amp;D</td><td>4423/10</td><td>2 &amp;mu;M</td></tr><tr><td>Doxycyline (dox)</td><td>Sigma</td><td>D9891</td><td>2.5 &amp;mu;g/mL</td></tr><tr><td>Glial-Derived Neurotrophic Factor&lt;br/&gt; (GDNF)</td><td>Peprotech</td><td>450-10</td><td>10 ng/mL</td></tr><tr><td>L-ascorbic acid 2-phosphate&lt;br/&gt; magnesium (AA2)</td><td>Sigma</td><td>A8960</td><td>64 mg/L</td></tr><tr><td>Neurotrophic factor-3 (NT-3)</td><td>Peprotech</td><td>450-10</td><td>10 ng/mL</td></tr><tr><td>Purmorphamine (PMA)</td><td>Cayman</td><td>10009634</td><td>0.5 &amp;mu;M</td></tr><tr><td>Puromycin</td><td>Sigma</td><td>P8833-10MG</td><td>0.5 &amp;mu;g/mL</td></tr><tr><td>Thiazovivin</td><td>Merk Millipore</td><td>420220-10MG</td><td>2 &amp;mu;M</td></tr><tr><td>&lt;strong&gt;mDA neurons - Supplements&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Brain-Derived Neurotrophic Factor&lt;br/&gt; (BDNF)</td><td>Peprotech</td><td>450-02</td><td>20 ng/mL</td></tr><tr><td>CHIR99021 (CHIR)</td><td>R&amp;amp;D</td><td>4423/10</td><td>3 &amp;mu;M</td></tr><tr><td>DAPT</td><td>Cayman</td><td>13197</td><td>10 &amp;micro;M</td></tr><tr><td>Dibutyryl-cAMP (db-cAMP)</td><td>Sigma</td><td>D0627</td><td>1 mM</td></tr><tr><td>Fibroblast Growth Factor 8B (FGF-8b)</td><td>Peprotech</td><td>100-25</td><td>100 ng/mL</td></tr><tr><td>Glial-Derived Neurotrophic Factor&lt;br/&gt; (GDNF)</td><td>Peprotech</td><td>450-10</td><td>20 ng/mL</td></tr><tr><td>L-ascorbic acid (AA1)</td><td>Sigma</td><td>A4403</td><td>0.2 mM</td></tr><tr><td>LDN193189 (LDN)</td><td>Cayman</td><td>11802</td><td>100 nM</td></tr><tr><td>Purmorphamine (Purm)</td><td>Cayman</td><td>10009634</td><td>2 &amp;mu;M</td></tr><tr><td>Sonic Hedgehog/Shh (C24II)&lt;br/&gt; N-Terminus (SHH)</td><td>R&amp;amp;D</td><td>1845-SH</td><td>100 ng/mL</td></tr><tr><td>SB431542 (SB)</td><td>Cayman</td><td>13031</td><td>10 &amp;mu;M</td></tr><tr><td>Transforming Growth Factor type &amp;szlig;3&lt;br/&gt; (TGF&amp;szlig;3)</td><td>R&amp;amp;D</td><td>243-B3</td><td>1 ng/mL</td></tr><tr><td>Y-27632</td><td>Cayman</td><td>10005583</td><td>10 &amp;micro;M</td></tr><tr><td>&lt;strong&gt;Dissociation reagents&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Single cell dissociation reagent&lt;br/&gt; (StemPro Accutase)</td><td>Gibco</td><td>A1110501</td><td>1x</td></tr><tr><td>UltraPure 0.5M EDTA, pH 8.0</td><td>Gibco</td><td>11575020</td><td>0.5 mM</td></tr><tr><td>&lt;strong&gt;RNA isolation and cDNA kit&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>RNA isolation kit</td><td>Qiagen</td><td>74106</td><td>Rneasy MiniKit</td></tr><tr><td>RNA lysis buffer</td><td>Thermo Fisher Scientific</td><td>15596018</td><td>Trizol lysis buffer (RNA&lt;br/&gt; lysis buffer)</td></tr><tr><td>Reverse transcriptase (kit)</td><td>Thermo Fisher Scientific</td><td>18080-085</td><td>SuperScript III Reverse&lt;br/&gt; Transcriptase</td></tr><tr><td></td><td></td><td></td><td></td></tr><tr><td>&lt;strong&gt;Software&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Description/Application&lt;/strong&gt;</td></tr><tr><td>Cell Culture Framework (CCF)&lt;br/&gt; (Graphical user interface, GUI)</td><td>Hamilton Robotics</td><td>Custom-made</td><td>User interface for the automated system</td></tr><tr><td>CellPathFinder software&lt;br/&gt; (image analysis software 1)</td><td>Yokogawa</td><td>CellPathfinder HCS Software</td><td>Image analysis tool</td></tr><tr><td>CellVoyager Measurement System</td><td>Yokogawa</td><td>Included with&lt;br/&gt; CellVoyager 7000</td><td>Microscope controlling&lt;br/&gt; software</td></tr><tr><td>Columbus software&lt;br/&gt; (image analysis software 2)</td><td>Perkin Elmer</td><td>Columbus</td><td>Image analysis tool</td></tr><tr><td>Cloud based qPCR app</td><td>Thermo Fisher Scientific</td><td>Themo Fisher cloud</td><td>Analysis software for&lt;br/&gt; qRT-PCR data</td></tr><tr><td>Venus software</td><td>Hamilton Robotics</td><td>VENUS Two Dynamic&lt;br/&gt; Schedular 5.1 Software</td><td>Controlling software for the&lt;br/&gt; automated system</td></tr></tbody></table>

automated production of human induced pluripotent stem cell-derived cortical and dopaminergic neurons with integrated live-cell monitoring

Manual culture and differentiation protocols for human induced pluripotent stem cells (hiPSC) are difficult to standardize, show high variability and are prone to spontaneous differentiation into unwanted cell types. The methods are labor-intensive and are not easily amenable to large-scale experiments. To overcome these limitations, we developed an automated cell culture system coupled to a high-throughput imaging system and implemented protocols for maintaining multiple hiPSC lines in parallel and neuronal differentiation. We describe the automation of a short-term differentiation protocol using Neurogenin-2 (NGN2) over-expression to produce hiPSC-derived cortical neurons within 6&#8210;8 days, and the implementation of a long-term differentiation protocol to generate hiPSC-derived midbrain dopaminergic (mDA) neurons within 65 days. Also, we applied the NGN2 approach to a small molecule-derived neural precursor cells (smNPC)&#160;transduced with GFP lentivirus and established a live-cell automated neurite outgrowth assay. We present an automated system with protocols suitable for routine hiPSC culture and differentiation into cortical and dopaminergic neurons. Our platform is suitable for long term hands-free culture and high-content/high-throughput hiPSC-based compound, RNAi and CRISPR/Cas9 screenings to identify novel disease mechanisms and drug targets.

Watch this Scientific Journal Video about Automated Production of Human Induced Pluripotent Stem Cell-Derived Cortical and Dopaminergic Neurons with Integrated Live-Cell Monitoring at JoVE.com

Automated Production of Human Induced Pluripotent Stem Cell-Derived Cortical and Dopaminergic Neurons with Integrated Live-Cell Monitoring

We show the automation of human induced pluripotent stem cell (hiPSC) cultures and neuronal differentiations compatible with automated imaging and analysis.

Manual culture and differentiation protocols for human induced pluripotent stem cells (hiPSC) are difficult to standardize, show high variability and are ...

automated-production-human-induced-pluripotent-stem-cell-derived

Research

JoVE Journal

Biology

7.2K Views.  German Center for Neurodegenerative Diseases (DZNE). Het algemene doel van deze studie is om te laten zien hoe geautomatiseerde procedures voor het kweken en differentiëren van menselijke IPS-cellen in neuronale afstammingen, evenals hun geautomatiseerde beeldvorming te implementeren. Gestandaardiseerde geautomatiseerde procedures zorgen voor een lage experimentele variatie en zorgen tegelijkertijd voor een hoge fenotypische reproduceerbaarheid. Bovendien kan het systeem worden aangepast voor de ontwikkeling van nieuwe protocollen.Het a...

Video: Automated Production of Human Induced Pluripotent Stem Cell-Derived Cortical and Dopaminergic Neurons with Integrated Live-Cell Monitoring

An Optogenetic Approach for Assessing Formation of Neuronal Connections in a Co-culture System

Here we describe a protocol to generate a co-culture consisting of 2 different neuronal populations. Induced pluripotent stem cells (iPSCs) are reprogrammed from human fibroblasts using episomal vectors. Colonies of iPSCs can be observed 30 days after initiation of fibroblast reprogramming. Pluripotent colonies are manually picked and grown in neural induction medium to permit differentiation into neural progenitor cells (NPCs). iPSCs rapidly convert into neuroepithelial cells within 1 week and retain the capability to self-renew when maintained at a high culture density. Primary mouse NPCs are differentiated into astrocytes by exposure to a serum-containing medium for 7 days and form a monolayer upon which embryonic day 18 (E18) rat cortical neurons (transfected with channelrhodopsin-2 (ChR2)) are added. Human NPCs tagged with the fluorescent protein, tandem dimer Tomato (tdTomato), are then seeded onto the astrocyte/cortical neuron culture the following day and allowed to differentiate for 28 to 35 days. We demonstrate that this system forms synaptic connections between iPSC-derived neurons and cortical neurons, evident from an increase in the frequency of synaptic currents upon photostimulation of the cortical neurons. This co-culture system provides a novel platform for evaluating the ability of iPSC-derived neurons to create synaptic connections with other neuronal populations.

A protocol to generate a co-culture system consisting of neurons derived from induced pluripotent stem cells (iPSCs), primary cortical neurons and astrocytes is described. This co-culture system allows detection of the formation of synaptic contacts and circuits between new, iPSC-derived neurons and pre-existing cortical neurons expressing channelrhodopsin-2.

Here we describe a protocol to generate a co-culture consisting of 2 different neuronal populations. Induced pluripotent stem cells (iPSCs) are ...

Developmental Biology

Three-dimensional Quantification of Dendritic Spines from Pyramidal Neurons Derived from Human Induced Pluripotent Stem Cells

Dendritic spines are small protrusions that correspond to the post-synaptic compartments of excitatory synapses in the central nervous system. They are distributed along the dendrites. Their morphology is largely dependent on neuronal activity, and they are dynamic. Dendritic spines express glutamatergic receptors (AMPA and NMDA receptors) on their surface and at the levels of postsynaptic densities. Each spine allows the neuron to control its state and local activity independently. Spine morphologies have been extensively studied in glutamatergic pyramidal cells of the brain cortex, using both in vivo approaches and neuronal cultures obtained from rodent tissues. Neuropathological conditions can be associated to altered spine induction and maturation, as shown in rodent cultured neurons and one-dimensional quantitative analysis 1. The present study describes a protocol for the 3D quantitative analysis of spine morphologies using human cortical neurons derived from neural stem cells (late cortical progenitors). These cells were initially obtained from induced&#160;pluripotent stem cells. This protocol allows the analysis of spine morphologies at different culture periods, and with possible comparison between induced&#160;pluripotent stem cells obtained from control individuals with those obtained from patients with psychiatric diseases.

Dendritic spines of pyramidal neurons are the sites of most excitatory synapses in mammalian brain cortex. This method describes a 3D quantitative analysis of spine morphologies in human cortical pyramidal glutamatergic neurons derived from induced&#160;pluripotent stem cells.

Dendritic spines are small protrusions that correspond to the post-synaptic compartments of excitatory synapses in the central nervous system. They are ...

Rapid Neuronal Differentiation of Induced Pluripotent Stem Cells for Measuring Network Activity on Micro-electrode Arrays

Neurons derived from human induced Pluripotent Stem Cells (hiPSCs) provide a promising new tool for studying neurological disorders. In the past decade, many protocols for differentiating hiPSCs into neurons have been developed. However, these protocols are often slow with high variability, low reproducibility, and low efficiency. In addition, the neurons obtained with these protocols are often immature and lack adequate functional activity both at the single-cell and network levels unless the neurons are cultured for several months. Partially due to these limitations, the functional properties of hiPSC-derived neuronal networks are still not well characterized. Here, we adapt a recently published protocol that describes production of human neurons from hiPSCs by forced expression of the transcription factor neurogenin-212. This protocol is rapid (yielding mature neurons within 3 weeks) and efficient, with nearly 100% conversion efficiency of transduced cells (&#62;95% of DAPI-positive cells are MAP2 positive). Furthermore, the protocol yields a homogeneous population of excitatory neurons that would allow the investigation of cell-type specific contributions to neurological disorders. We modified the original protocol by generating stably transduced hiPSC cells, giving us explicit control over the total number of neurons. These cells are then used to generate hiPSC-derived neuronal networks on micro-electrode arrays. In this way, the spontaneous electrophysiological activity of hiPSC-derived neuronal networks can be measured and characterized, while retaining interexperimental consistency in terms of cell density. The presented protocol is broadly applicable, especially for mechanistic and pharmacological studies on human neuronal networks.

We modify and implement a previously published protocol describing the rapid, reproducible, and efficient differentiation of human&#160;induced&#160;Pluripotent Stem Cells (hiPSCs) into excitatory cortical neurons12. Specifically, our modification allows for control of neuronal cell density and use on micro-electrode arrays to measure electrophysiological properties at the network level.

Neurons derived from human induced Pluripotent Stem Cells (hiPSCs) provide a promising new tool for studying neurological disorders. In the past decade, ...

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Neuroscience

Directed Dopaminergic Neuron Differentiation from Human Pluripotent Stem Cells

Dopaminergic (DA) neurons in the substantia nigra pars compacta (also known as A9 DA neurons) are the specific cell type that is lost in Parkinson&#8217;s disease (PD). There is great interest in deriving A9 DA neurons from human pluripotent stem cells (hPSCs) for regenerative cell replacement therapy for PD. During neural development, A9 DA neurons originate from the floor plate (FP) precursors located at the ventral midline of the central nervous system. Here, we optimized the culture conditions for the stepwise differentiation of hPSCs to A9 DA neurons, which mimics embryonic DA neuron development. In our protocol, we first describe the efficient generation of FP precursor cells from hPSCs using a small molecule method, and then convert the FP cells to A9 DA neurons, which could be maintained in vitro for several months. This efficient, repeatable and controllable protocol works well in human embryonic stem cells (hESCs) and human induced pluripotent stem cells (hiPSCs) from normal persons and PD patients, in which one could derive A9 DA neurons to perform in vitro disease modeling and drug screening and in vivo cell transplantation therapy for PD.

We, based on knowledge from developmental biology and published research, developed an optimized protocol to efficiently generate A9 midbrain dopaminergic neurons from both human embryonic stem cells and human induced pluripotent stem cells, which would be useful for disease modeling and cell replacement therapy for Parkinson&#8217;s disease.

Dopaminergic (DA) neurons in the substantia nigra pars compacta  (also known as A9 DA neurons) are the specific cell type that is lost in ...

Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases

The lack of relevant in vitro neural models is an important obstacle on medical progress for neuropathologies. Establishment of relevant cellular models is crucial both to better understand the pathological mechanisms of these diseases and identify new therapeutic targets and strategies. To be pertinent, an in vitro model must reproduce the pathological features of a human disease. However, in the context of neurodegenerative disease, a relevant in vitro model should provide neural cell replacement as a valuable therapeutic opportunity. 
Such a model would not only allow screening of therapeutic molecules but also can be used to optimize neural protocol differentiation [for example, in the context of transplantation in Parkinson's disease (PD)]. This study describes two in vitro protocols of 1) human glioblastoma development within a human neural organoids (NO) and 2) neuron dopaminergic (DA) differentiation generating a three-dimensional (3D) organoid. For this purpose, a well-standardized protocol was established that allows the production of size-calibrated neurospheres derived from human embryonic stem cell (hESC) differentiation. The first model can be used to reveal molecular and cellular events occurring during in glioblastoma development within the neural organoid, while the DA organoid not only represents a suitable source of DA neurons for cell therapy in Parkinson's disease but also can be used for drug testing.

This study introduces and describes protocols to derive two specific human neural organoids&#160;as a relevant and accurate model for studying 1) human glioblastoma development within human neural organoids exclusively in humans and 2) neuron dopaminergic differentiation generating a three-dimensional organoid.

The lack of relevant in vitro neural models is an important obstacle on medical progress for neuropathologies. Establishment of relevant cellular models ...

Bioengineering

Rapid and Efficient Generation of Neurons from Human Pluripotent Stem Cells in a Multititre Plate Format

Existing protocols for the generation of neurons from human pluripotent stem cells (hPSCs) are often tedious in that they are multistep procedures involving the isolation and expansion of neural precursor cells, prior to terminal differentiation. In comparison to these time-consuming approaches, we have recently found that combined inhibition of three signaling pathways, TGF&beta;/SMAD2, BMP/SMAD1, and FGF/ERK, promotes rapid induction of neuroectoderm from hPSCs, followed by immediate differentiation into functional neurons. Here, we have adapted our procedure to a novel multititre plate format, to further enhance its reproducibility and to make it compatible with mid-throughput applications. It comprises four days of neuroectoderm formation in floating spheres (embryoid bodies), followed by a further four days of differentiation into neurons under adherent conditions. Most cells obtained with this protocol appear to be bipolar sensory neurons. Moreover, the procedure is highly efficient, does not require particular expert skills, and is based on a simple chemically defined medium with cost-efficient small molecules. Due to these features, the procedure may serve as a useful platform for further functional investigation as well as for cell-based screening approaches requiring human sensory neurons or neurons of any type.

Protocols for neuronal differentiation of pluripotent human stem cells (hPSCs) are often time-consuming and require substantial cell culture skills. Here, we have adapted a small molecule-based differentiation procedure to a multititre plate format, allowing simple, rapid, and efficient generation of human neurons in a controlled manner.

Existing protocols for the generation of neurons from human pluripotent stem cells (hPSCs) are often tedious in that they are  multistep procedures ...

Post-differentiation Replating of Human Pluripotent Stem Cell-derived Neurons for High-content Screening of Neuritogenesis and Synapse Maturation

Neurons differentiated in two-dimensional culture from human pluripotent stem-cell-derived neural progenitor cells (NPCs) represent a powerful model system to explore disease mechanisms and carry out high content screening (HCS) to interrogate compound libraries or identify gene mutation phenotypes. However, with human cells the transition from NPC to functional, mature neuron requires several weeks. Synapses typically start to form after 3 weeks of differentiation in monolayer culture, and several neuron-specific proteins, for example the later expressing pan-neuronal marker NeuN, or the layer 5/6 cerebral cortical neuron marker CTIP2, begin to express around 4-5 weeks post-differentiation. This lengthy differentiation time can be incompatible with optimal culture conditions used for small volume, multi-well HCS platforms. Among the many challenges are the need for well-adhered, uniformly distributed cells with minimal cell clustering, and culture procedures that foster long-term viability and functional synapse maturation. One approach is to differentiate neurons in a large volume format, then replate them at a later time point in HCS-compatible multi-wells. Some main challenges when using this replating approach concern reproducibility and cell viability, due to the stressful disruption of the dendritic and axonal network. Here we demonstrate a detailed and reliable procedure for enzymatically resuspending human induced pluripotent stem cell (hiPSC)-derived neurons after their differentiation for 4-8 weeks in a large-volume format, transferring them to 384-well microtiter plates, and culturing them for a further 1-3 weeks with excellent cell survival. This replating of human neurons not only allows the study of synapse assembly and maturation within two weeks from replating, but also enables studies of neurite regeneration and growth cone characteristics. We provide examples of scalable assays for neuritogenesis and synaptogenesis using a 384-well platform.

This protocol describes a detailed procedure for resuspending and culturing human stem cell derived neurons that were previously differentiated from neural progenitors in vitro for multiple weeks. The procedure facilitates imaging-based assays of neurites, synapses, and late-expressing neuronal markers in a format compatible with light microscopy and high-content screening.

Neurons differentiated in two-dimensional culture from human pluripotent stem-cell-derived neural progenitor cells (NPCs) represent a powerful model ...

Production of Human Neurogenin 2-Inducible Neurons in a Three-Dimensional Suspension Bioreactor

The derivation of neuronal lineage cells from human induced pluripotent stem cells (hiPSCs) marked a milestone in brain research. Since their first advent, protocols have been continuously optimized and are now widely used in research and drug development. However, the very long duration of these conventional differentiation and maturation protocols and the increasing demand for high-quality hiPSCs and their neural derivatives raise the need for the adoption, optimization, and standardization of these protocols to large-scale production. This work presents a fast and efficient protocol for the differentiation of genetically modified, doxycycline-inducible neurogenin 2 (iNGN2)-expressing hiPSCs into neurons using a benchtop three-dimensional (3D) suspension bioreactor.
In brief, single-cell suspensions of iNGN2-hiPSCs were allowed to form aggregates within 24 h, and neuronal lineage commitment was induced by the addition of doxycycline. Aggregates were dissociated after 2 days of induction and cells were either cryopreserved or replated for terminal maturation. The generated iNGN2 neurons expressed classical neuronal markers early on and formed complex neuritic networks within 1 week after replating, indicating an increasing maturity of neuronal cultures. In summary, a detailed step-by-step protocol for the fast generation of hiPSC-derived neurons in a 3D environment is provided that holds great potential as a starting point for disease modeling, phenotypic high-throughput drug screenings, and large-scale toxicity testing.

This article describes a protocol for the generation of human induced pluripotent stem cell-derived neurons in a benchtop 3D suspension bioreactor.

The derivation of neuronal lineage cells from human induced pluripotent stem cells (hiPSCs) marked a milestone in brain research. Since their first ...

Monitoring Pluripotent Stem Cell Differentiation by Image-Based ML Strategy

A Live-cell Image-Based Machine Learning Strategy to Monitor Pluripotent Stem Cell Differentiation

Pluripotent stem cell (PSC) technologies have been widely used in drug discovery, disease modeling, and regenerative medicine.&#160;However, available PSC-to-functional cell differentiation systems are impeded by problems of severe line-to-line and batch-to-batch variability. Precise control of cell differentiation in real time is therefore important. In this protocol, we describe a non-invasive and intelligent strategy that overcomes the variability in cell differentiation by using bright-field image-based machine learning. Taking PSC-to-cardiomyocyte differentiation as an example, this methodology provides detailed information for control of the initial PSC state, early assessment and intervention in differentiation conditions, and elimination of the misdifferentiated cell contamination, together realizing consistently high-quality differentiation from PSCs to functional cells. In principle, this strategy can be extended to other cell differentiation or reprogramming systems with multiple steps to support cell manufacturing, as well as to further our understanding of the mechanisms during cell fate conversion.

Author Spotlight: Enhancing PSC-to-Functional Cell Differentiation Using ML Models Based on Live-Cell Bright-Field Imaging

Available pluripotent stem cell (PSC)-to-functional cell differentiation systems are currently impeded by problems of severe line-to-line and batch-to-batch variability. Here, using cardiac differentiation as the main example, we present a protocol to intelligently monitor and modulate the process of PSC differentiation based on image-based machine learning.

Pluripotent stem cell (PSC) technologies have been widely used in drug discovery, disease modeling, and regenerative medicine.&#160;However, available ...

Automated Production of Human Induced Pluripotent Stem Cell-Derived Cortical and Dopaminergic Neurons with Integrated Live-Cell Monitoring

Samenvatting

Meer video's verkennen