This work was supported by the National Key Research and Development Program of China (No. 2019YFC1200503), by the National Science Foundation of China (No. 32072385), and by Youth Innovation Promotion Association CAS (2021084).

1. SBPH maintenance
<ol>
	<li>Rear the viruliferous and RSV-free SBPH individuals in a glass incubator (65 x 200 mm) with 5-6 rice (Oryza sativa cv. Nipponbare) seedlings per glass chamber in the laboratory. Grow the rice plants at 25 &#176;C under a 16 h light / 8 h dark photoperiod. 
	NOTE: The viruliferous and RSV-free SBPH individuals were initially caught in Jiangsu Province, China.</li>
	<li>Detect RSV in SBPH by dot-enzyme-linked immunosorbent assay (dot-ELISA) with a rabbit RSV-specific polyclonal antibody (see Table of Materials) raised against the RSV ribonucleoproteins (RNPs). 
	NOTE: For ensuring high offspring infection efficiency, viruliferous females were maintained separately, and 15% of their offspring were randomly tested for RSV infection. The details of dot-ELISA are described in steps 1.3-1.7.</li>
	<li>Homogenize single SBPH in 20 &#181;L of coating buffer (0.05 M Na2CO3-NaHCO3, pH 9.5). Spot 3 &#181;L of each on nylon membrane (see Table of Materials), and then dry the membrane at room temperature (RT).</li>
	<li>Incubate the membrane with 15 mL of blocking buffer (PBS + 3% skim milk) for 30 min at room temperature.</li>
	<li>Incubate the membrane with diluted primary rabbit-antibodies against RSV (1:10000) in 15 mL of PBS for 1 h at RT and wash the membrane three times with PBS for 5 min incubation each time.</li>
	<li>Incubate the membrane with 1.5 &#181;L of horseradish peroxidase-conjugated goat anti-rabbit antibodies (see Table of Materials) in 15 mL of PBS and wash three times with PBS for 5 min incubation each time.</li>
	<li>Develop the immunoblots with Enhanced HRP-DAB Chromogenic Kit (see Table of Materials) according to the protocols provided by the manufacturer.</li>
</ol>
2. Preparation of feeding chamber and artificial diet
<ol>
	<li>Weigh 2 g of sucrose powder and dissolve it in 40 mL of ddH2O to prepare 5% sucrose aqueous solution as the artificial diet.</li>
	<li>Filter the solution through a 0.22 &#181;m filter (see Table of Materials)&#160;to remove bacterial contamination and impurities.</li>
	<li>Starve 200 3rd-5th SBPH larvae for 3-5 h before introducing them into the chamber. 
	NOTE: 200 SBPH are prepared for one chamber; more SBPH should be prepared for several chambers.</li>
	<li>Prepare the glass cylinders as feeding chambers (Figure 1A). Cover one open end of the chamber with a paraffin membrane (see Table of Materials) before introducing the experimental insects. 
	NOTE: Each cylinder is 15.0 cm long and 2.5 cm in diameter. These glass cylinders are custom-made according to the experimental requirement.</li>
	<li>Transfer insects into a glass cylinder.</li>
	<li>Cover the other end of the chamber with stretched paraffin membrane (specifically, Parafilm M). Then, add 200 &#181;L of artificial diet to it. Finally, cover the liquid with another layer of stretched paraffin membrane. 
	NOTE: The paraffin membrane is stretched to about double its original area.</li>
	<li>Cover the chamber with aluminum foil, but leave the end with the artificial diet device exposed to the light.</li>
</ol>
3. Collection of SBPH saliva
<ol>
	<li>Collect artificial diet from RSV-free and viruliferous SBPH separately at the end of 24 h period.</li>
	<li>Cool the cylinder at 4 &#176;C to immobilize the insects.</li>
	<li>Uncover the outer film and collect the artificial diet liquid using a sterile pipette into 1.5 mL sterile tubes. Keep the collected saliva at -80 &#176;C until analysis. 
	NOTE: The collected saliva could be stored at -80 &#176;C for 1 year.</li>
	<li>Rinse the inner membrane with 50 &#181;L of fresh artificial diet three times by pipetting softly, and collect the artificial washing diet as described in step 3.3. Place the new artificial diet on the inner membrane and keep a freshly stretched Paraffin membrane on top.</li>
	<li>Repeat steps 3.2 and 3.3 for 5 days to 2 weeks. 
	NOTE: Count the survival rate of artificial feeding SBPH and ensure sufficient supplement of fresh SBPH according to the survival rate.</li>
	<li>Filter the collected samples through a 0.22 &#181;m filter&#160;unit to remove microbes and other contaminants.</li>
</ol>
4. Concentration of the collected saliva
<ol>
	<li>Transfer the collected saliva samples in a 0.5 mL 10 kD centrifugal filter (see&#160;Table of Materials)&#160;and spin at 5,500 x g at 4 &#176;C for 20 min. Collect the supernatant and make the final volume to 100 &#181;L.</li>
	<li>Measure the concentration of the collected saliva using an appropriate UV-Vis spectrophotometer following steps 4.3-4.6.</li>
	<li>Turn on the spectrophotometer and wash the pedestals three times with ddH2O.</li>
	<li>Select the following options on the screen in proper order: Proteins | Protein A280 | Select Type | 1 Abs = 1 mg/mL. Then, check the checkbox Baseline Correction 340 nm.</li>
	<li>Load 2 &#181;L of 5% sucrose aqueous solution as blank, touch Blank at the bottom of the screen.</li>
	<li>After setting standards, load 2 &#181;L of the collected saliva for measurement. Read and record the protein concentration. 
	&#8203;NOTE: 1 mg of saliva proteins were finally collected in total at least.</li>
</ol>
5. Silver staining of saliva proteins
<ol>
	<li>Extract protein from the insect saliva samples using sample loading buffer (50 mM Tris-HCl pH 6.8, 10% glycerol, 2% SDS, 0.1% bromophenol blue, and 1% &#946;-mercaptoethanol). Then, fractionate it by 10% SDS-PAGE (see Table of Materials). Load the 5% sucroseaqueous solution treated in the same manner as a negative control.</li>
	<li>Load a 20 &#181;L aliquot of the sample onto an SDS-PAGE gel alongside a prestained marker. Run the gel for 15 min at 90 Volt, and then 50 min at 140 Volt.</li>
	<li>Fix the gel in 30% (vol/vol) ethanol, 10% (vol/vol) acetic acid for at least 30 min after electrophoresis.</li>
	<li>Rinse the gel twice with 20% (vol/vol) ethanol and water separately for 10 min each time.</li>
	<li>Sensitize the gel in 0.8 mM sodium thiosulfate for 1 min, and then rinse twice in water for 1 min each time.</li>
	<li>Immerse the gel in 12 mM silver nitrate for at least 1 h, and then dip it in deionized water for 10 s before transferring it to the developer solution.</li>
	<li>When the background of the gel is getting dark, immerse the gel in a stop solution (5% acetic acid) for at least 30 min to stop the reaction.</li>
	<li>Wash the gel twice with water for 30 min each time. Develop the image with the Detection System (see Table of Materials).</li>
</ol>
6. Protein detection by western blotting
<ol>
	<li>Detect the saliva mucin-like protein of SBPH (LssgMP) and RSV by western blots using specific antibodies, respectively.</li>
	<li>Treat insect saliva samples following step 5.1.</li>
	<li>Load a 20 &#181;L aliquot of the sample onto a 10% SDS-PAGE gel alongside a prestained marker and a 20 &#181;L RSV non-infected saliva sample as a negative control. Run the gel for 15 min at 90 Volt, and then for 50 min at 140 Volt.</li>
	<li>Mix 100 mL of 10x protein transfer buffer (wet) (see&#160;Table of Materials)&#160;with 900 mL of ddH2O to a work solution (1x), and then transfer proteins to a polyvinylidene difluoride membrane using protein transfer buffer (1x).</li>
	<li>Block the membrane in 5% skim milk with 0.01 M Tris-buffered saline with 0.05% Tween 20 (TBST) at room temperature (RT) for 1 h. 
	NOTE: In this protocol, mix 100 mL of 10x TBST (see&#160;Table of Materials)&#160;with 900 mL of ddH2O into the work solution.</li>
	<li>Incubate the membrane with primary rabbit antibodies against RSV or LssgMP (both 1:10000) diluted in TBST at RT for at least 2 h. 
	NOTE: The production of primary antibodies against RSV was mentioned above. A biotechnology company produced the rabbit anti-LssgMP polyclonal antibody against LssgMP peptide GIQFDSYSASDLTRC.</li>
	<li>Wash the membrane three times with TBST for 10 min of incubation each time.</li>
	<li>Incubate the membrane with horseradish peroxidase-conjugated goat anti-rabbit antibodies diluted in 1:10000 TBST.</li>
	<li>Develop the immunoblots with the enhanced chemiluminescence Western Blotting Detection System.</li>
</ol>
7. Detection of LssgMP expression pattern in SBPH
<ol>
	<li>Immobilize the insects at 4 &#176;C for 5 min.</li>
	<li>Wash the insects with 75% ethanol and ddH2O one by one, and then dissect the insects in pre-chilled TBS (0.01 M Tris-buffered saline).</li>
	<li>Dissect the insects from the abdomen while severing the forelegs of SBPH at the coxa-trochanter joint by forceps; wash the midgut and the salivary glands twice in TBS to remove any contamination from the hemolymph.</li>
	<li>Put five tissues into a 1.5 mL RNase-free tube to extract RNA. Consider each tube as one sample.</li>
	<li>Perform RNA extraction according to the manufacturer&#39;s protocols and Reverse-transcriptional PCR (RT-PCR) (see Table of Materials).</li>
	<li>Perform quantitative real-time PCR (qRT-PCR) to investigate the relative transcript expression levels of LssgMP in extracts of the whole body or various tissues of L. striatellus. 
	NOTE: The primer pairs used for gene amplification were LssgMP-q-F/LssgMP-q-R, SYBR Green-based qPCR was performed according to the manufacturer&#39;s protocol. The transcript level of L. striatellus translation elongation factor 2 (ef2) was quantified with primer pair ef2-q-F/ef2-q-R for the normalization of the cDNA templates. And the primer sequences are attached below:LssgMP-q-F: TCCGACCTCACCAGAGTTTACAG; LssgMP-q-R: GCTTCGTCCCAGGTACTGATTCC; ef2-q-F: GTCTCCACGGATGGGCTTT; ef2-q-R: ATCTTGAATTTCTCGGCATACATTT.</li>
</ol>

<ol>
	<li>Cheng, X., Zhu, L., He, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+understanding+of+molecular+interactions+between+rice+and+the+brown+planthopper.">Towards understanding of molecular interactions between rice and the brown planthopper.</a> Molecular Plant. 6 (3), 621-634 (2013).</li><li>Cho, W. K., Lian, S., Kim, S. M., Park, S. H., Kim, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+insights+into+research+on+Rice+Stripe+Virus.">Current insights into research on Rice Stripe Virus.</a> The Plant Pathology Journal. 29 (3), 223-233 (2013).</li><li>He, M., Guan, S. Y., He, C. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+rice+stripe+virus.">Evolution of rice stripe virus.</a> Molecular Phylogenetics and Evolution. 109, 343-350 (2017).</li><li>Wu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonstructural+protein+NS4+of+Rice+Stripe+Virus+plays+a+critical+role+in+viral+spread+in+the+body+of+vector+insects.">Nonstructural protein NS4 of Rice Stripe Virus plays a critical role in viral spread in the body of vector insects.</a> PLoS One. 9 (2), 88636 (2014).</li><li>Huo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transovarial+transmission+of+a+plant+virus+is+mediated+by+vitellogenin+of+its+insect+vector.">Transovarial transmission of a plant virus is mediated by vitellogenin of its insect vector.</a> PLoS Pathogens. 10 (3), 1003949 (2014).</li><li>Taning, C. N., Andrade, E. C., Hunter, W. B., Christiaens, O., Smagghe, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Asian+citrus+psyllid+RNAi+pathway-RNAi+evidence.">Asian citrus psyllid RNAi pathway-RNAi evidence.</a> Scientific Reports. 6, 38082 (2016).</li><li>Garbutt, J. S., Bell&#233;s, X., Richards, E. H., Reynolds, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Persistence+of+double-stranded+RNA+in+insect+hemolymph+as+a+potential+determiner+of+RNA+interference+success:+evidence+from+Manduca+sexta+and+Blattella+germanica.">Persistence of double-stranded RNA in insect hemolymph as a potential determiner of RNA interference success: evidence from Manduca sexta and Blattella germanica.</a> Journal of Insect Physiology. 59 (2), 171-178 (2013).</li><li>Huo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Artificial+feeding+Rice+Stripe+Virus+enables+efficient+virus+infection+of+Laodelphax+striatellus.">Artificial feeding Rice Stripe Virus enables efficient virus infection of Laodelphax striatellus.</a> Journal of Virological Methods. 235, 139-143 (2016).</li><li>Huo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insect+tissue-specific+vitellogenin+facilitates+transmission+of+plant+virus.">Insect tissue-specific vitellogenin facilitates transmission of plant virus.</a> PLoS Pathogens. 14 (2), 1006909 (2018).</li><li>Huo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+Stripe+Virus+hitchhikes+the+vector+insect+vitellogenin+ligand-receptor+pathway+for+ovary+entry.">Rice Stripe Virus hitchhikes the vector insect vitellogenin ligand-receptor pathway for ovary entry.</a> Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences. 374, 20180312 (2019).</li><li>Bao, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+intestine-specific+transcriptome+of+the+brown+planthopper+Nilaparvata+lugens+revealed+potential+functions+in+digestion,+detoxification+and+immune+response.">De novo intestine-specific transcriptome of the brown planthopper Nilaparvata lugens revealed potential functions in digestion, detoxification and immune response.</a> Genomics. 99 (4), 256-264 (2012).</li><li>Elzinga, D. A., Jander, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+protein+effectors+in+plant-aphid+interactions.">The role of protein effectors in plant-aphid interactions.</a> Current Opinion In Plant Biology. 16 (4), 451-456 (2013).</li><li>Chung, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Herbivore+exploits+orally+secreted+bacteria+to+suppress+plant+defenses.">Herbivore exploits orally secreted bacteria to suppress plant defenses.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (39), 15728-15733 (2013).</li><li>Bos, J. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+functional+genomics+approach+identifies+candidate+effectors+from+the+aphid+species+Myzus+persicae+(green+peach+aphid).">A functional genomics approach identifies candidate effectors from the aphid species Myzus persicae (green peach aphid).</a> PLoS Genetics. 6 (11), 1001216 (2010).</li><li>Liu, X., Zhou, H., Zhao, J., Hua, H., He, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+the+secreted+watery+saliva+proteins+of+the+rice+brown+planthopper,+Nilaparvata+lugens+(St&#229;l)+by+transcriptome+and+Shotgun+LC-MS/MS+approach.">Identification of the secreted watery saliva proteins of the rice brown planthopper, Nilaparvata lugens (St&#229;l) by transcriptome and Shotgun LC-MS/MS approach.</a> Journal of Insect Physiology. 89, 60-69 (2016).</li><li>Cao, T. T., L&#252;, J., Lou, Y. G., Cheng, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Feeding-induced+interactions+between+two+rice+planthoppers,+Nilaparvata+lugens+and+Sogatella+furcifera+(Hemiptera:+Delphacidae):+effects+on+feeding+and+honeydew+excretion.">Feeding-induced interactions between two rice planthoppers, Nilaparvata lugens and Sogatella furcifera (Hemiptera: Delphacidae): effects on feeding and honeydew excretion.</a> Environmental Entomology. 42 (6), 1281-1291 (2013).</li><li>De Vos, M., Jander, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Myzus+persicae+(green+peach+aphid)+salivary+components+induce+defence+responses+in+Arabidopsis+thaliana.">Myzus persicae (green peach aphid) salivary components induce defence responses in Arabidopsis thaliana.</a> Plant, Cell &amp; Environment. 32 (11), 1548-1560 (2009).</li><li>Wang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+the+immune+system+architecture+and+transcriptome+responses+to+southern+rice+black-streaked+dwarf+virus+in+Sogatella+furcifera.">Understanding the immune system architecture and transcriptome responses to southern rice black-streaked dwarf virus in Sogatella furcifera.</a> Scientific Reports. 6, 36254 (2016).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Penetration+into+rice+tissues+by+brown+planthopper+and+fine+structure+of+the+salivary+sheaths.">Penetration into rice tissues by brown planthopper and fine structure of the salivary sheaths.</a> Entomologia Experimentalis et Applicata. 129 (3), 295-307 (2008).</li><li>Wang, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Armet+is+an+effector+protein+mediating+aphid-plant+interactions.">Armet is an effector protein mediating aphid-plant interactions.</a> FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology. 29 (5), 2032-2045 (2015).</li><li>Chaudhary, R., Atamian, H. S., Shen, Z., Briggs, S. P., Kaloshian, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GroEL+from+the+endosymbiont+Buchnera+aphidicola+betrays+the+aphid+by+triggering+plant+defense.">GroEL from the endosymbiont Buchnera aphidicola betrays the aphid by triggering plant defense.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (24), 8919-8924 (2014).</li><li>Ma, R., Chen, J. L., Cheng, D. F., Sun, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+defense+mechanism+in+wheat+by+polyphenol+oxidase+from+aphid+saliva.">Activation of defense mechanism in wheat by polyphenol oxidase from aphid saliva.</a> Journal of Agricultural and Food Chemistry. 58 (4), 2410-2418 (2010).</li><li>Zheng, L., Seon, Y. J., McHugh, J., Papagerakis, S., Papagerakis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clock+genes+show+circadian+rhythms+in+salivary+glands.">Clock genes show circadian rhythms in salivary glands.</a> Journal of Dental Research. 91 (8), 783-788 (2012).</li><li>Huang, H. J., Lu, J. B., Li, Q., Bao, Y. Y., Zhang, C. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+transcriptomic/proteomic+analysis+of+salivary+gland+and+secreted+saliva+in+three+planthopper+species.">Combined transcriptomic/proteomic analysis of salivary gland and secreted saliva in three planthopper species.</a> Journal of Proteomics. 172, 25-35 (2018).</li><li>Huang, H. J., Liu, C. W., Xu, H. J., Bao, Y. Y., Zhang, C. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucin-like+protein,+a+saliva+component+involved+in+brown+planthopper+virulence+and+host+adaptation.">Mucin-like protein, a saliva component involved in brown planthopper virulence and host adaptation.</a> Journal of Insect Physiology. 98, 223-230 (2017).</li><li>Shangguan, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mucin-like+protein+of+planthopper+is+required+for+feeding+and+induces+immunity+response+in+plants.">A mucin-like protein of planthopper is required for feeding and induces immunity response in plants.</a> Plant Physiology. 176 (1), 552-565 (2018).</li><li>Petrova, A., Smith, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunodetection+of+a+brown+planthopper+(Nilaparvata+lugens+St&#229;l)+salivary+catalase-like+protein+into+tissues+of+rice,+Oryza+sativa.">Immunodetection of a brown planthopper (Nilaparvata lugens St&#229;l) salivary catalase-like protein into tissues of rice, Oryza sativa.</a> Insect Molecular Biology. 23 (1), 13-25 (2014).</li><li>Zhu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+small+brown+planthopper,+Laodelphax+striatellus.">Genome sequence of the small brown planthopper, Laodelphax striatellus.</a> GigaScience. 6 (12), 1-12 (2017).</li><li>Van Bel, A. J., Will, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+evaluation+of+proteins+in+watery+and+gel+saliva+of+aphids.">Functional evaluation of proteins in watery and gel saliva of aphids.</a> Frontiers In Plant Science. 7, 1840 (2016).</li><li>Perez-Vilar, J., Hill, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+structure+and+assembly+of+secreted+mucins.">The structure and assembly of secreted mucins.</a> The Journal of Biological Chemistry. 274 (45), 31751-31754 (1999).</li><li>Pitino, M., Hogenhout, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aphid+protein+effectors+promote+aphid+colonization+in+a+plant+species-specific+manner.">Aphid protein effectors promote aphid colonization in a plant species-specific manner.</a> Molecular Plant-Microbe Interactions: MPMI. 26 (1), 130-139 (2013).</li><li>Zhang, F., Zhu, L., He, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+gene+expression+in+response+to+brown+planthopper+feeding+in+rice.">Differential gene expression in response to brown planthopper feeding in rice.</a> Journal of Plant Physiology. 161 (1), 53-62 (2004).</li><li>Hogenhout, S. A., Ammar, E. -. D., Whitfield, A. E., Redinbaugh, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insect+vector+interactions+with+persistently+transmitted+viruses.">Insect vector interactions with persistently transmitted viruses.</a> Annual Review of Phytopathology. 46, 327-359 (2008).</li><li>Boissot, N., Schoeny, A., Vanlerberghe-Masutti, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vat,+an+amazing+gene+conferring+resistance+to+aphids+and+viruses+they+carry:+from+molecular+structure+to+field+effects.">Vat, an amazing gene conferring resistance to aphids and viruses they carry: from molecular structure to field effects.</a> Frontiers In Plant Science. 7, 1420 (2016).</li></ol>

The authors declare that they have no conflicts of interest.

Successful rearing of insects on artificial diets was first reported in 1962 when Mittler and Dadd described the Paraffin membrane technique to hold an artificial diet29,30. And this method has been explored in many aspects of insect biology and behavior, for example, nutrient supplement, dsRNA feeding, and virus acquisition. Based on the requirements of saliva analysis, 5% sucrose is used as the general artificial diet to collect saliva of SBPH in this study. For successful saliva collection, several critical steps are worth noting here. Firstly, starving the experimental insects before introducing them into the chamber is necessary to ensure the efficiency of saliva collection. Secondly, to imitate the stylet environment, a two-layer Paraffin sandwich is made. When SBPH feeds on the artificial diet, the salivary sheath forms at the inside end facing the diet, and the watery saliva is secreted subsequently. Thirdly, an artificial medium should be collected and exchanged in time to reduce microbial contamination in the collected sample. Finally, anesthetizing the insects at 4 &#176;C for 5 min is essential to avoid the loss of insects while changing the artificial diet.
In contrast to most artificial diets which contain amino acids, vitamins, and carbohydrates, the advantages of 5% sucrose medium are noteworthy. First, it is easy to prepare. Second, the simple composition of the diet means few substances to interfere with further analysis of the various factors in saliva. Nevertheless, the survival ratio of the SBPH declined in the last days of the feeding period using 5% sucrose as the general artificial diet (Figure 1D). For overcoming this flaw, fresh SBPH should be supplied in time for enough saliva. And for further research of the salivary function on feeding behavior or virus transmission, the saliva collection duration should be limited to the accurate time before insects&#39; mortality increased owing to innutrition. It seems to be a common limitation of the artificial medium. Some other studies found that the survival of N. lugens reared on the chemically defined diet D-97 was inferior to that of those raised on the susceptible rice variety TN1, implying that the original host supplies more than just food vector insects. And several studies have focused on optimizing chemically defined diets for continuous feeding of insects to improve the rearing efficiency.
Transcriptome analysis of the salivary gland is a traditional method for saliva protein identification. And different saliva proteins have been detected in the same species of A. pisum and M. persicae14,31, and the abundance of saliva proteins determines the frequency of their detection32. However, a valid method to investigate the suspected protein in the saliva was lacking. This Paraffin membrane&#160;sandwich method provides an innovative manner to confirm a suspected saliva protein identified by transcriptome analysis, which is further proved by detecting LssgMP (Figure 2C). Moreover, protein analysis confirmed that abundant proteins are present in the collected saliva (Figure 2A), which is a sufficient quantity for further analysis by, for example, mass spectrometry. Proteomics analysis of collected saliva will be a direct and effective method for identifying secreted factors involved in the feeding stage of SBPH, minimizing the risk of detecting false-positive redundant proteins.
Saliva works as the virus carrier from insect to host plants and is an essential component of the vector-virus-plant interaction14,33,34. The titer of virus released from insect vectors is a crucial factor for the infection to the host. Compared with indirect methods that test the viral titer in infected plants, this protocol can directly detect RSV released by viruliferous SBPH (Figure 2B). Supported by this Paraffin membrane sandwich method, further comparative analyses of saliva proteins collected from RSV-free and RSV-infected insects may also reveal potential candidates involved in the virus-plant-vector interaction.

Rice stripe virus (RSV), a negative-stranded RNA virus in the genus Tenuivirus, causes severe diseases in rice production in East Asia1,2,3. Transmission of RSV from infected rice plants to healthy ones depends on insect vectors, mainly Laodelphax striatellus, which transmits RSV in a persistent-propagative manner. SBPH acquires the virus after feeding on RSV-infected plants. Once inside the insect, RSV infects the midgut epithelial cell one day after feeding and then passes through the midgut barrier to penetrate the hemolymph. Subsequently, RSV spreads into different tissues via the hemolymph and then propagates. After a latent period of about 10-14 days post-acquisition, the virus inside the salivary gland can be transmitted to the healthy host plants via the secreted saliva while SBPH sucks sap from the phloem4,5,6,7,8,9,10. An efficient feeding process and various factors in the saliva are essential for the spread of RSV from the insect to the host plant.
Insect saliva secreted by salivary glands is believed to mediate insects, viruses, and host plants.Hemipteran insects usually produce two types of saliva: gelling saliva and watery saliva11,12,13. Gelling saliva is mainly secreted into the apoplasm to sustain the movement of the stylet among host cells and is also related to overcoming plant resistance and immune responses14,15,16,17. At the probing stage of feeding, insects intermittently secrete gelling saliva that immediately gets oxidized to form a surface flange. Then, single or branched sheaths encase the stylet to reserve a tubular channel18,19,20. The surface flange on the epidermis is presumed to facilitate penetration of the stylet by serving as an anchor point, while the sheaths around the stylet may provide mechanical stability and lubrication16,21,22,23. Nlshp was identified as an essential protein for salivary sheath formation and successful feeding of brown planthopper (Nilaparvata lugens, BPH). Inhibition of the expression of the structural sheath protein (SHP) secreted by the aphid Acyrthosiphon pisum reduced its reproduction by disrupting feeding from host sieve tubes24. Moreover, in some insect species, gel saliva factors are supposed to trigger plant immune responses by forming so-called herbivore-associated molecular patterns (HAMPs). In N. lugens, NlMLP, a mucin-like protein related to sheath formation, induces plant defenses against feeding, including cell death, the expression of defense-related genes, and callose deposition 25,26. Also, some gel saliva factors in aphids have been proved to trigger plant defense responses via gene-to-gene interactions similar to pathogen-associated molecular patterns12,15,27.
For studying the saliva factors essential for insect feeding and/or pathogen transmission, it is necessary to analyze secreted saliva. Here, artificial feeding and collection methods to obtain sufficient amounts of saliva are described for further analysis. Using a medium containing only a single nutritional element, many saliva proteins were collected and analyzed by silver staining and western blotting. This method will be helpful in further research on factors in saliva that are essential for RSV transmission by SBPH.

<table><tbody><tr><td>10-KD centrifugal filter</td><td>Merck Millipore</td><td>R5PA83496</td><td>For concentration</td></tr><tr><td>10x Protein Transfer Buffer(wet)</td><td>macGENE</td><td>MP008</td><td>Transfer buffer for western blotting</td></tr><tr><td>10x TBST buffer</td><td>Coolaber</td><td>SL1328-500mL&amp;times;10</td><td>Wash buffer for western blotting</td></tr><tr><td>Azure c600 biosystems</td><td>Azure Biosystems</td><td>Azure c600</td><td>Imaging system for western blotting and silver staining</td></tr><tr><td>Color Prestained protein ladder</td><td>GenStar</td><td>M221-01</td><td>Protein marker for western blotting</td></tr><tr><td>ECL&amp;nbsp;western blotting detection reagents</td><td>GE Healthcare</td><td>RPN2209</td><td>Western blotting detection</td></tr><tr><td>Enchanced HRP-DAB Chromogenic Kit</td><td>TIANGEN</td><td>#PA110</td><td>Chromogenic reaction</td></tr><tr><td>Horseradish peroxidase-conjugated goat anti-rabbit antibodies</td><td>Sigma</td><td>401393-2ML</td><td>Polyclonal secondary antibody for western blotting</td></tr><tr><td>Immobilon(R)-P Polyvinylidene difluoride membrane</td><td>Merck Millipore</td><td>IPVH00010</td><td>Transfer membrane for western blotting</td></tr><tr><td>iTaq Universal SYBR Green Supermix</td><td>Bio-Rad</td><td>1725125</td><td>For quantitative real-time PCR (qRT-PCR)</td></tr><tr><td>KIT,iSCRIPT cDNA SYNTHES</td><td>Bio-Rad</td><td>1708891</td><td>For Reverse-transcriptional PCR (RT-PCR)</td></tr><tr><td>Millex-GP Filter, 0.22 &amp;micro;m</td><td>Merck Millipore</td><td>SLGP033RB</td><td>For filtration</td></tr><tr><td>Mini-PROTEAB TGX Gels</td><td>Bio-Rad</td><td>4561043</td><td>For SDS-PAGE</td></tr><tr><td>NanoDrop One</td><td>Thermo Scientific</td><td>ND-ONEC-W</td><td>Detection of protein concentration</td></tr><tr><td>Nylon membrane</td><td>PALL</td><td>T42754</td><td>Membrane for dot-ELISA</td></tr><tr><td>Parafilm M Membrane</td><td>Sigma</td><td>P7793-1EA</td><td>Making artifical diet sandwichs</td></tr><tr><td>Rabbit anti-LssgMP polyclonal antibody against LssgMP peptides</td><td>Genstript</td><td></td><td>Rabbit primary anti-LssgMP polyclonal antibody for western blotting</td></tr><tr><td>Rabbit anti-RSV polyclonal antibody</td><td>Genstript</td><td></td><td>Rabbit primary anti-RSV polyclonal antibody for western blotting and dot-ELISA</td></tr><tr><td>RNAprep pure Micro Kit</td><td>TIANGEN</td><td>DP420</td><td>For RNA Extraction</td></tr></tbody></table>

two-layered membrane sandwich method for laodelphax striatellus saliva collection

Rice stripe virus (RSV), which causes significant economic loss of agriculture in East Asia, entirely depends on insect vectors for its effective transmission among host rice. Laodelphax striatellus (small brown planthopper, SBPH) is the primary insect vector that horizontally transmits RSV while sucking sap from the phloem. Saliva plays a significant role in insects' feeding behavior. A convenient method that will be useful for research on insects' saliva with piercing-sucking feeding behavior is described here. In this method, insects were allowed to feed on an artificial diet sandwiched between two stretched paraffin film layers. The diet containing the saliva was collected each day, filtered, and concentrated for further analysis. Finally, the quality of collected saliva was examined by protein staining and immunoblotting. This method was exemplified by detecting the presence of RSV and a mucin-like protein in the saliva of SBPH. These artificial feeding and saliva collection method will lay a foundation for further research on factors in insect saliva related to feeding behavior and virus transmission.

Schematics of artificial feeding installation and saliva collection 
Figure 1A depicts the glass cylinder (15 cm x 2.5 cm) used as a feeding chamber to collect the saliva. Firstly, the SBPH larvae were starved for several hours to improve the collection efficiency and then immobilized by chilling for 5 min. After the insects were transferred into the glass cylinder, both open ends of the chamber were covered with stretched Paraffin membrane. At one end, 200 &#181;L of 5% sucrose was sandwiched between two layers of Paraffin membrane extended to about double its original area (Figure 1B). The chamber was covered with foil, but the end with the artificial diet was exposed to light. Because SBPH displays phototropic behavior, the starved insects gathered at the end were exposed to light and fed on the artificial diet solution through the stretched inner Paraffin membrane. Based on it, saliva could be released into the artificial diet, which was collected each day. The Parafilm-diet device was replaced with a new one every day. In this way, the artificial diet was collected for 5 days to 2 weeks, and then the whole sample was concentrated to a final volume of 100 &#181;L using a 10 KD centrifugal filter (Figure 1C). During the collection of saliva, the survival rate of SBPH feeding the 5% sucrose was counted. In the first 4 days, more than 80% SBPH survived. However, from the 5th day onward, mortality increased quickly to 40%, and less than half SBPH survived on the 7th day (Figure 1D). To collect sufficient saliva, fresh SBPH was suggested to supply on the 4th day.
Verification of collected saliva proteins 
For assessing the effectiveness of this collection method, the saliva sample was subjected to protein analysis. Firstly, proteins were separated by SDS-PAGE, and then detected by silver staining (Figure 2A). Compared with the negative control (5% sucrose), the concentrated saliva samples from RSV-infected SBPH saliva contained many proteins that could be further analyzed, for example, by mass spectrometry. As the primary insect vector of RSV, SBPH transmits the virus to plants via its sucking-piercing feeding process. The successful release of RSV is related to saliva secretion, and RSV is considered to be an essential factor in viruliferous insects&#39; saliva. Here, saliva was tested after collecting non-infected and viruliferous insects with an antibody against RSV and successfully detected the RSV coat protein (CP) in the viruliferous sample (Figure 2B). Another study found that mucin proteins are essential gel saliva proteins in hemipteran insects to meditate the formation of a sheath for feeding23. For confirming that SBPH also produces a mucin protein, the whole open reading frame of a putative mucin-encoding gene was amplified from RNA extracted from the saliva gland of SBPH. Its sequence was used as a query in BLAST analyses against the genome sequence of SBPH28. A gene consisting of 2175 bp, named LssgMP, was identified. An antibody against this protein was prepared previously and was used to detect the protein in the collected sample by western blot analysis. A 78 KD protein was detected in non-infected and viruliferous samples, demonstrating that LssgMP is a saliva protein (Figure 2C). Next, the transcript levels of LssgMP in different tissues (salivary gland, gut, and remaining body) were determined by qRT-PCR. The results showed that the gene transcript level was 20-fold higher in the salivary gland than in the gut and other body parts (Figure 2D), confirming the specific expression of LssgMP in the salivary gland.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62831/62831fig01.jpg" /> 
Figure 1: Diagram of feeding chamber with Paraffin membrane sandwich to allow feeding of SBPH on artificial diet. (A) Illustration of artificial feeding chamber. The cylinder is 15.0 cm long and 2.5 cm in diameter. At one end of the chamber is the Paraffin membrane sandwich; the other end and the cylinder wall covered with tin foil paper (slanted lines) represent the device covered with tin foil paper. The light source was set to attract SBPH to feed on the artificial diet. (B) Diagram of Paraffin sandwich containing artificial diet. 200 &#181;L of 5% sucrose aqueous solution was sandwiched between two layers of Paraffin membranes stretched to about double its original area. (C) The concentration of collected saliva using a 10 KD centrifugal filter. (D) The survival rate of SBPH feeding on 5% sucrose. Mean and SEM was calculated from four biological replicates with three technical replicates. <a href="https://www.jove.com/files/ftp_upload/62831/62831fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62831/62831fig02.jpg" /> 
Figure 2: Verification of collected saliva proteins. (A) Saliva proteins detection by silver staining. The 5% sucrose is negative control. (B) Detection of rice stripe virus coat protein (CP) in collected saliva by western blot analysis. (C) Western blotting to confirm the presence of LssgMP in collected saliva. (D) Specific expression of LssgMP in the salivary gland of L. striatellus. ef2:&#160;translation elongation factor 2 of SBPH. Mean and SEM was calculated from four biological replicates with three technical replicates. <a href="https://www.jove.com/files/ftp_upload/62831/62831fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Two-layered Membrane Sandwich Method for Laodelphax striatellus Saliva Collection at JoVE.com

Two-layered Membrane Sandwich Method for Laodelphax striatellus Saliva Collection

The present protocol describes a method to collect sufficient saliva from piercing-sucking insects using an artificial medium. This is a convenient method for collecting insect saliva and studying salivary function on insect feeding behavior and vector-borne virus transmission.

Two-layered Membrane Sandwich Method for Laodelphax striatellus Saliva Collection

Rice stripe virus (RSV), which causes significant economic loss of agriculture in East Asia, entirely depends on insect vectors for its effective ...

two-layered-membrane-sandwich-method-for-laodelphax-striatellus

Universidad San Sebastian

Research

JoVE Journal

Biology

2.3K Views.  Chinese Academy of Sciences. Kunstmatige voeding en speekselverzameling bieden een directe methode voor het detecteren van effectoren in insectenspeeksel. Dit is echter nog niet eerder in detail beschreven. Dit protocol is effectief voor speekselverzameling van saprofytische insecten.Bovendien is het een eenvoudige techniek, omdat we medium gebruiken dat alleen sucrose bevat als een kunstmatig dieet. Het speeksel van saprofytische insecten kan van invloed zijn op het immuunsysteem van de gastheer om het voedingsge...

Video: Two-layered Membrane Sandwich Method for Laodelphax striatellus Saliva Collection

Methods to Examine the Lymph Gland and Hemocytes in Drosophila Larvae

Many parallels exist between the Drosophila and mammalian hematopoietic systems, even though Drosophila lack the lymphoid lineage that characterize mammalian adaptive immunity. Drosophila and mammalian hematopoiesis occur in spatially and temporally distinct phases to produce several blood cell lineages. Both systems maintain reservoirs of blood cell progenitors with which to expand or replace mature lineages. The hematopoietic system allows Drosophila and mammals to respond to and to adapt to immune challenges. Importantly, the transcriptional regulators and signaling pathways that control the generation, maintenance, and function of the hematopoietic system are conserved from flies to mammals. These similarities allow Drosophila to be used to genetically model hematopoietic development and disease.
Here we detail assays to examine the hematopoietic system of Drosophila larvae. In particular, we outline methods to measure blood cell numbers and concentration, visualize a specific mature lineage in vivo, and perform immunohistochemistry on blood cells in circulation and in the hematopoietic organ. These assays can reveal changes in gene expression and cellular processes including signaling, survival, proliferation, and differentiation and can be used to investigate a variety of questions concerning hematopoiesis. Combined with the genetic tools available in Drosophila, these assays can be used to evaluate the hematopoietic system upon defined genetic alterations. While not specifically outlined here, these assays can also be used to examine the effect of environmental alterations, such as infection or diet, on the hematopoietic system.

Methods to Examine the Lymph Gland and Hemocytes in Drosophila Larvae

Drosophila and mammalian hematopoietic systems share many common features, making Drosophila an attractive genetic model to study hematopoiesis. Here we demonstrate dissection and mounting of the major larval hematopoietic organ for immunohistochemistry. We also describe methods to assay various larval hematopoietic compartments including circulating hemocytes and sessile crystal cells.

Many parallels exist between the Drosophila and mammalian hematopoietic systems, even though Drosophila lack the lymphoid lineage that characterize ...

Developmental Biology

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

Ticks are found worldwide and afflict humans with many tick-borne illnesses. Ticks are vectors for pathogens that cause Lyme disease and tick-borne relapsing fever (Borrelia spp.), Rocky Mountain Spotted fever (Rickettsia rickettsii), ehrlichiosis (Ehrlichia chaffeensis and E. equi), anaplasmosis (Anaplasma phagocytophilum), encephalitis (tick-borne encephalitis virus), babesiosis (Babesia spp.), Colorado tick fever (Coltivirus), and tularemia (Francisella tularensis) 1-8. To be properly transmitted into the host these infectious agents differentially regulate gene expression, interact with tick proteins, and migrate through the tick 3,9-13. For example, the Lyme disease agent, Borrelia burgdorferi, adapts through differential gene expression to the feast and famine stages of the tick's enzootic cycle 14,15. Furthermore, as an Ixodes tick consumes a bloodmeal Borrelia replicate and migrate from the midgut into the hemocoel, where they travel to the salivary glands and are transmitted into the host with the expelled saliva 9,16-19.
As a tick feeds the host typically responds with a strong hemostatic and innate immune response 11,13,20-22. Despite these host responses, I. scapularis can feed for several days because tick saliva contains proteins that are immunomodulatory, lytic agents, anticoagulants, and fibrinolysins to aid the tick feeding 3,11,20,21,23. The immunomodulatory activities possessed by tick saliva or salivary gland extract (SGE) facilitate transmission, proliferation, and dissemination of numerous tick-borne pathogens 3,20,24-27. To further understand how tick-borne infectious agents cause disease it is essential to dissect actively feeding ticks and collect tick saliva. This video protocol demonstrates dissection techniques for the collection of hemolymph and the removal of salivary glands from actively feeding I. scapularis nymphs after 48 and 72 hours post mouse placement. We also demonstrate saliva collection from an adult female I. scapularis tick.

Saliva, Salivary Gland, and Hemolymph Collection from Ixodes scapularis Ticks

The collection of infected tick hemolymph, salivary glands, and saliva is important to study how tick-borne pathogens cause disease. In this protocol we demonstrate how to collect hemolymph and salivary glands from feeding Ixodes scapularis nymphs. We also demonstrate saliva collection from female I. scapularis adults.

Ticks are found worldwide and afflict humans with many tick-borne illnesses. Ticks are vectors for pathogens that cause Lyme disease and tick-borne ...

Immunology and Infection

Sampling Human Indigenous Saliva Peptidome Using a Lollipop-Like Ultrafiltration Probe: Simplify and Enhance Peptide Detection for Clinical Mass Spectrometry

Although human saliva proteome and peptidome have been revealed 1-2 they were majorly identified from tryptic digests of saliva proteins. Identification of indigenous peptidome of human saliva without prior digestion with exogenous enzymes becomes imperative, since native peptides in human saliva provide potential values for diagnosing disease, predicting disease progression, and monitoring therapeutic efficacy. Appropriate sampling is a critical step for enhancement of identification of human indigenous saliva peptidome. Traditional methods of sampling human saliva involving centrifugation to remove debris 3-4 may be too time-consuming to be applicable for clinical use. Furthermore, debris removal by centrifugation may be unable to clean most of the infected pathogens and remove the high abundance proteins that often hinder the identification of low abundance peptidome.
Conventional proteomic approaches that primarily utilize two-dimensional gel electrophoresis (2-DE) gels in conjugation with in-gel digestion are capable of identifying many saliva proteins 5-6. However, this approach is generally not sufficiently sensitive to detect low abundance peptides/proteins. Liquid chromatography-Mass spectrometry (LC-MS) based proteomics is an alternative that can identify proteins without prior 2-DE separation. Although this approach provides higher sensitivity, it generally needs prior sample pre-fractionation 7 and pre-digestion with trypsin, which makes it difficult for clinical use. 
To circumvent the hindrance in mass spectrometry due to sample preparation, we have developed a technique called capillary ultrafiltration (CUF) probes 8-11. Data from our laboratory demonstrated that the CUF probes are capable of capturing proteins in vivo from various microenvironments in animals in a dynamic and minimally invasive manner 8-11. No centrifugation is needed since a negative pressure is created by simply syringe withdrawing during sample collection. The CUF probes combined with LC-MS have successfully identified tryptic-digested proteins 8-11. In this study, we upgraded the ultrafiltration sampling technique by creating a lollipop-like ultrafiltration (LLUF) probe that can easily fit in the human oral cavity. The direct analysis by LC-MS without trypsin digestion showed that human saliva indigenously contains many peptide fragments derived from various proteins. Sampling saliva with LLUF probes avoided centrifugation but effectively removed many larger and high abundance proteins. Our mass spectrometric results illustrated that many low abundance peptides became detectable after filtering out larger proteins with LLUF probes. Detection of low abundance saliva peptides was independent of multiple-step sample separation with chromatography. For clinical application, the LLUF probes incorporated with LC-MS could potentially be used in the future to monitor disease progression from saliva.

Considering saliva sampling for future clinical application, a lollipop-like ultrafiltration (LLUF) probe was fabricated to fit in the human oral cavity. Direct analysis of undigested saliva by NanoLC-LTQ mass spectrometry demonstrated the ability of LLUF probes to remove large proteins and high abundance proteins, and make low-abundant peptides more detectable.

Although human saliva proteome and peptidome have been revealed 1-2 they were majorly identified from tryptic digests of saliva proteins. Identification ...

Medicine

Formation of Biomembrane Microarrays with a Squeegee-based Assembly Method

Lipid bilayer membranes form the plasma membranes of cells and define the boundaries of subcellular organelles. In nature, these membranes are heterogeneous mixtures of many types of lipids, contain membrane-bound proteins and are decorated with carbohydrates. In some experiments, it is desirable to decouple the biophysical or biochemical properties of the lipid bilayer from those of the natural membrane. Such cases call for the use of model systems such as giant vesicles, liposomes or supported lipid bilayers (SLBs). Arrays of SLBs are particularly attractive for sensing applications and mimicking cell-cell interactions. Here we describe a new method for forming SLB arrays. Submicron-diameter SiO2 beads are first coated with lipid bilayers to form spherical SLBs (SSLBs). The beads are then deposited into an array of micro-fabricated submicron-diameter microwells. The preparation technique uses a "squeegee" to clean the substrate surface, while leaving behind SSLBs that have settled into microwells. This method requires no chemical modification of the microwell substrate, nor any particular targeting ligands on the SSLB. Microwells are occupied by single beads because the well diameter is tuned to be just larger than the bead diameter. Typically, more 75% of the wells are occupied, while the rest remain empty. In buffer SSLB arrays display long-term stability of greater than one week. Multiple types of SSLBs can be placed in a single array by serial deposition, and the arrays can be used for sensing, which we demonstrate by characterizing the interaction of cholera toxin with ganglioside GM1. We also show that phospholipid vesicles without the bead supports and biomembranes from cellular sources can be arrayed with the same method and cell-specific membrane lipids can be identified.

Supported lipid bilayers and natural membrane particles are convenient systems that can approximate the properties of cell membranes and be incorporated in a variety of analytical strategies. Here we demonstrate a method for preparing microarrays composed of supported lipid bilayer-coated SiO2 beads, phospholipid vesicles or natural membrane particles.

Lipid bilayer membranes form the plasma membranes of cells and define the boundaries of subcellular organelles. In nature, these membranes are ...

Bioengineering

Use of a High-throughput In Vitro Microfluidic System to Develop Oral Multi-species Biofilms

There are few high-throughput in vitro systems which facilitate the development of multi-species biofilms that contain numerous species commonly detected within in vivo oral biofilms. Furthermore, a system that uses natural human saliva as the nutrient source, instead of artificial media, is particularly desirable in order to support the expression of cellular and biofilm-specific properties that mimic the in vivo communities. We describe a method for the development of multi-species oral biofilms that are comparable, with respect to species composition, to supragingival dental plaque, under conditions similar to the human oral cavity. Specifically, this methods article will describe how a commercially available microfluidic system can be adapted to facilitate the development of multi-species oral biofilms derived from and grown within pooled saliva. Furthermore, a description of how the system can be used in conjunction with a confocal laser scanning microscope to generate 3-D biofilm reconstructions for architectural and viability analyses will be presented. Given the broad diversity of microorganisms that grow within biofilms in the microfluidic system (including Streptococcus, Neisseria, Veillonella, Gemella, and Porphyromonas), a protocol will also be presented describing how to harvest the biofilm cells for further subculture&#160;or DNA extraction and analysis. The limits of both the microfluidic biofilm system and the current state-of-the-art data analyses will be addressed. Ultimately, it is envisioned that this article will provide a baseline technique that will improve the study of oral biofilms and aid in the development of additional technologies that can be integrated with the microfluidic platform.

Use of a High-throughput In Vitro Microfluidic System to Develop Oral Multi-species Biofilms

The goal of this methods paper is to describe the use of a microfluidic system for the development of multi-species biofilms that contain species typically identified in human supragingival dental plaque.&#160;Methods to describe biofilm architecture, biofilm viability, and an approach to harvest biofilm for culture-dependent or culture-independent analyses are highlighted.

There are few high-throughput in vitro systems which facilitate the development of multi-species biofilms that contain numerous species commonly detected ...

Biomembrane Fabrication by the Solvent-assisted Lipid Bilayer (SALB) Method

In order to mimic cell membranes, the supported lipid bilayer (SLB) is an attractive platform which enables in vitro investigation of membrane-related processes while conferring biocompatibility and biofunctionality to solid substrates. The spontaneous adsorption and rupture of phospholipid vesicles is the most commonly used method to form SLBs. However, under physiological conditions, vesicle fusion (VF) is limited to only a subset of lipid compositions and solid supports. Here, we describe a one-step general procedure called the solvent-assisted lipid bilayer (SALB) formation method in order to form SLBs which does not require vesicles. The SALB method involves the deposition of lipid molecules onto a solid surface in the presence of water-miscible organic solvents (e.g., isopropanol) and subsequent solvent-exchange with aqueous buffer solution in order to trigger SLB formation. The continuous solvent exchange step enables application of the method in a flow-through configuration suitable for monitoring bilayer formation and subsequent alterations using a wide range of surface-sensitive biosensors. The SALB method can be used to fabricate SLBs on a wide range of hydrophilic solid surfaces, including those which are intractable to vesicle fusion. In addition, it enables fabrication of SLBs composed of lipid compositions which cannot be prepared using the vesicle fusion method. Herein, we compare results obtained with the SALB and conventional vesicle fusion methods on two illustrative hydrophilic surfaces, silicon dioxide and gold. To optimize the experimental conditions for preparation of high quality bilayers prepared via the SALB method, the effect of various parameters, including the type of organic solvent in the deposition step, the rate of solvent exchange, and the lipid concentration is discussed along with troubleshooting tips. Formation of supported membranes containing high fractions of cholesterol is also demonstrated with the SALB method, highlighting the technical capabilities of the SALB technique for a wide range of membrane configurations.

Biomembrane Fabrication by the Solvent-assisted Lipid Bilayer SALB Method

We present an experimental protocol to form a supported lipid bilayer on solid substrates without using lipid vesicles. We demonstrate a one-step method to form a lipid bilayer on silicon dioxide and gold as well as supported membranes with cholesterol-enriched domain for various biological applications.

In order to mimic cell membranes, the supported lipid bilayer (SLB) is an attractive platform which enables in vitro investigation of membrane-related ...

Developing a Salivary Antibody Multiplex Immunoassay to Measure Human Exposure to Environmental Pathogens

The etiology and impacts of human exposure to environmental pathogens are of major concern worldwide and, thus, the ability to assess exposure and infections using cost effective, high-throughput approaches would be indispensable. This manuscript describes the development and analysis of a bead-based multiplex immunoassay capable of measuring the presence of antibodies in human saliva to multiple pathogens simultaneously. Saliva is particularly attractive in this application because it is noninvasive, cheaper and easier to collect than serum. Antigens from environmental pathogens were coupled to carboxylated microspheres (beads) and used to measure antibodies in very small volumes of human saliva samples using a bead-based, solution-phase assay. Beads were coupled with antigens from Campylobacter jejuni, Helicobacter pylori, Toxoplasma gondii, noroviruses (G I.1 and G II.4) and hepatitis A virus. To ensure that the antigens were sufficiently coupled to the beads, coupling was confirmed using species-specific, animal-derived primary capture antibodies, followed by incubation with biotinylated anti-species secondary detection antibodies and streptavidin-R-phycoerythrin reporter (SAPE). As a control to measure non-specific binding, one bead set was treated identically to the others except it was not coupled to any antigen. The antigen-coupled and control beads were then incubated with prospectively-collected human saliva samples, measured on a high throughput analyzer based on the principles of flow cytometry, and the presence of antibodies to each antigen was measured in Median Fluorescence Intensity units (MFI). This multiplex immunoassay has a number of advantages, including more data with less sample; reduced costs and labor; and the ability to customize the assay to many targets of interest. Results indicate that the salivary multiplex immunoassay may be capable of identifying previous exposures and infections, which can be especially useful in surveillance studies involving large human populations.

In the current climate of scarce resources, new technologies are emerging that allow researchers to conduct studies cheaper, faster and with more precision. Here we describe the development of a bead-based salivary antibody multiplex immunoassay to measure human exposure to multiple environmental pathogens simultaneously.

The etiology and impacts of human exposure to environmental pathogens are of major concern worldwide and, thus, the ability to assess exposure and ...

Forced Salivation As a Method to Analyze Vector Competence of Mosquitoes

Vector competence is defined as the potential of a mosquito species to transmit a mosquito-borne virus (mobovirus) to a vertebrate host. Viable virus particles are transmitted during a blood meal via the saliva of an infected mosquito. Forced salivation assays allow determining the vector potential on the basis of single mosquitoes, avoiding the use of animal experiments. The method is suitable to analyze a large number of mosquitoes in one experiment within a short period of time. Forced salivation assays were used to analyze 856 individual mosquitoes trapped in Germany, including two different Culex pipiens pipiens biotypes, Culex torrentium as well as Aedes albopictus, which were experimentally infected with Zika virus (ZIKV) and incubated at 18 &#176;C or 27 &#176;C for two and three weeks. The results indicated the lack of vector competence of the different Culex taxa for ZIKV. In contrast, Aedes albopictus was susceptible to ZIKV, but only at 27 &#176;C, with transmission rates similar to an Aedes aegypti laboratory colony tested in parallel.

For efficient control of mosquito borne virus transmission, the knowledge of the vector potential of respective mosquitoes is of particular interest. We describe forced salivation as a method to analyze vector competence of Aedes albopictus and three different Culex taxa for the transmission of Zika virus.

Vector competence is defined as the potential of a mosquito species to transmit a mosquito-borne virus (mobovirus) to a vertebrate host. Viable virus ...

Dissection and Immunostaining of Larval Salivary Glands from Anopheles gambiae Mosquitoes

Mosquito salivary glands (SGs) are a requisite gateway organ for the transmission of insect-borne pathogens. Disease-causing agents, including viruses and the Plasmodium parasites that cause malaria, accumulate in the secretory cavities of SG cells. Here, they are poised for transmission to their vertebrate hosts during a subsequent blood meal. As adult glands form as an elaboration of larval SG duct bud remnants that persist beyond early pupal SG histolysis, the larval SG is an ideal target for interventions that limit disease transmission. Understanding larval SG development can help develop a better understanding of its morphology and functional adaptations and aid in the assessment of new interventions that target this organ. This video protocol demonstrates an efficient technique for isolating, fixing, and staining larval SGs from Anopheles gambiae mosquitoes. Glands dissected from larvae in a 25% ethanol solution are fixed in a methanol-glacial acetic acid mixture, followed by a cold acetone wash. After a few rinses in phosphate-buffered saline (PBS), SGs can be stained with a broad array of marker dyes and/or antisera against SG-expressed proteins. This method for larval SG isolation could also be used to collect tissue for in situ hybridization analysis, other transcriptomic applications, and proteomic studies.

Dissection and Immunostaining of Larval Salivary Glands from Anopheles gambiae Mosquitoes

The adult mosquito salivary gland (SG) is required for the transmission of all mosquito-borne pathogens to their human hosts, including viruses and parasites. This video demonstrates efficient isolation of the SGs from the larval (L4) stage Anopheles gambiae mosquitoes and preparation of the L4 SGs for further analysis.

Mosquito salivary glands (SGs) are a requisite gateway organ for the transmission of insect-borne pathogens. Disease-causing agents, including viruses and ...

Effective Oral RNA Interference (RNAi) Administration to Adult Anopheles gambiae Mosquitoes

RNA interference has been a heavily utilized tool for reverse genetic analysis for two decades. In adult mosquitoes, double-stranded RNA (dsRNA) administration has been accomplished primarily via injection, which requires significant time and is not suitable for field applications. To overcome these limitations, here we present a more efficient method for robust activation of RNAi by oral delivery of dsRNA to adult Anopheles gambiae. Long dsRNAs were produced in Escherichia coli strain HT115 (DE3), and a concentrated suspension of heat-killed dsRNA-containing bacteria in 10% sucrose was offered on cotton balls ad-libitum to adult mosquitoes. Cotton balls were replaced every 2 days for the duration of the treatment. Use of this method to target doublesex (a gene involved in sex differentiation) or fork head (which encodes a salivary gland transcription factor) resulted in reduced target gene expression and/or protein immunofluorescence signal, as measured by quantitative Real-Time PCR (qRT-PCR) or fluorescence confocal microscopy, respectively. Defects in salivary gland morphology were also observed. This highly flexible, user-friendly, low-cost, time-efficient method of dsRNA delivery could be broadly applicable to target genes important for insect vector physiology and beyond.

Effective Oral RNA Interference RNAi Administration to Adult Anopheles gambiae Mosquitoes

The oral administration of dsRNA produced by bacteria, a delivery method for RNA interference (RNAi) that is routinely used in Caenorhabditis elegans, was successfully applied here to adult mosquitoes. Our method allows for robust reverse genetics studies and transmission-blocking vector studies without the use of injection.

Two-layered Membrane Sandwich Method for Laodelphax striatellus Saliva Collection

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video