This work was supported by the National Key Research and Development Program of China (No. 2019YFC1200503), by the National Science Foundation of China (No. 32072385), and by Youth Innovation Promotion Association CAS (2021084).

1. SBPH maintenance
<ol>
	<li>Rear the viruliferous and RSV-free SBPH individuals in a glass incubator (65 x 200 mm) with 5-6 rice (Oryza sativa cv. Nipponbare) seedlings per glass chamber in the laboratory. Grow the rice plants at 25 &#176;C under a 16 h light / 8 h dark photoperiod. 
	NOTE: The viruliferous and RSV-free SBPH individuals were initially caught in Jiangsu Province, China.</li>
	<li>Detect RSV in SBPH by dot-enzyme-linked immunosorbent assay (dot-ELISA) with a rabbit RSV-specific polyclonal antibody (see Table of Materials) raised against the RSV ribonucleoproteins (RNPs). 
	NOTE: For ensuring high offspring infection efficiency, viruliferous females were maintained separately, and 15% of their offspring were randomly tested for RSV infection. The details of dot-ELISA are described in steps 1.3-1.7.</li>
	<li>Homogenize single SBPH in 20 &#181;L of coating buffer (0.05 M Na2CO3-NaHCO3, pH 9.5). Spot 3 &#181;L of each on nylon membrane (see Table of Materials), and then dry the membrane at room temperature (RT).</li>
	<li>Incubate the membrane with 15 mL of blocking buffer (PBS + 3% skim milk) for 30 min at room temperature.</li>
	<li>Incubate the membrane with diluted primary rabbit-antibodies against RSV (1:10000) in 15 mL of PBS for 1 h at RT and wash the membrane three times with PBS for 5 min incubation each time.</li>
	<li>Incubate the membrane with 1.5 &#181;L of horseradish peroxidase-conjugated goat anti-rabbit antibodies (see Table of Materials) in 15 mL of PBS and wash three times with PBS for 5 min incubation each time.</li>
	<li>Develop the immunoblots with Enhanced HRP-DAB Chromogenic Kit (see Table of Materials) according to the protocols provided by the manufacturer.</li>
</ol>
2. Preparation of feeding chamber and artificial diet
<ol>
	<li>Weigh 2 g of sucrose powder and dissolve it in 40 mL of ddH2O to prepare 5% sucrose aqueous solution as the artificial diet.</li>
	<li>Filter the solution through a 0.22 &#181;m filter (see Table of Materials)&#160;to remove bacterial contamination and impurities.</li>
	<li>Starve 200 3rd-5th SBPH larvae for 3-5 h before introducing them into the chamber. 
	NOTE: 200 SBPH are prepared for one chamber; more SBPH should be prepared for several chambers.</li>
	<li>Prepare the glass cylinders as feeding chambers (Figure 1A). Cover one open end of the chamber with a paraffin membrane (see Table of Materials) before introducing the experimental insects. 
	NOTE: Each cylinder is 15.0 cm long and 2.5 cm in diameter. These glass cylinders are custom-made according to the experimental requirement.</li>
	<li>Transfer insects into a glass cylinder.</li>
	<li>Cover the other end of the chamber with stretched paraffin membrane (specifically, Parafilm M). Then, add 200 &#181;L of artificial diet to it. Finally, cover the liquid with another layer of stretched paraffin membrane. 
	NOTE: The paraffin membrane is stretched to about double its original area.</li>
	<li>Cover the chamber with aluminum foil, but leave the end with the artificial diet device exposed to the light.</li>
</ol>
3. Collection of SBPH saliva
<ol>
	<li>Collect artificial diet from RSV-free and viruliferous SBPH separately at the end of 24 h period.</li>
	<li>Cool the cylinder at 4 &#176;C to immobilize the insects.</li>
	<li>Uncover the outer film and collect the artificial diet liquid using a sterile pipette into 1.5 mL sterile tubes. Keep the collected saliva at -80 &#176;C until analysis. 
	NOTE: The collected saliva could be stored at -80 &#176;C for 1 year.</li>
	<li>Rinse the inner membrane with 50 &#181;L of fresh artificial diet three times by pipetting softly, and collect the artificial washing diet as described in step 3.3. Place the new artificial diet on the inner membrane and keep a freshly stretched Paraffin membrane on top.</li>
	<li>Repeat steps 3.2 and 3.3 for 5 days to 2 weeks. 
	NOTE: Count the survival rate of artificial feeding SBPH and ensure sufficient supplement of fresh SBPH according to the survival rate.</li>
	<li>Filter the collected samples through a 0.22 &#181;m filter&#160;unit to remove microbes and other contaminants.</li>
</ol>
4. Concentration of the collected saliva
<ol>
	<li>Transfer the collected saliva samples in a 0.5 mL 10 kD centrifugal filter (see&#160;Table of Materials)&#160;and spin at 5,500 x g at 4 &#176;C for 20 min. Collect the supernatant and make the final volume to 100 &#181;L.</li>
	<li>Measure the concentration of the collected saliva using an appropriate UV-Vis spectrophotometer following steps 4.3-4.6.</li>
	<li>Turn on the spectrophotometer and wash the pedestals three times with ddH2O.</li>
	<li>Select the following options on the screen in proper order: Proteins | Protein A280 | Select Type | 1 Abs = 1 mg/mL. Then, check the checkbox Baseline Correction 340 nm.</li>
	<li>Load 2 &#181;L of 5% sucrose aqueous solution as blank, touch Blank at the bottom of the screen.</li>
	<li>After setting standards, load 2 &#181;L of the collected saliva for measurement. Read and record the protein concentration. 
	&#8203;NOTE: 1 mg of saliva proteins were finally collected in total at least.</li>
</ol>
5. Silver staining of saliva proteins
<ol>
	<li>Extract protein from the insect saliva samples using sample loading buffer (50 mM Tris-HCl pH 6.8, 10% glycerol, 2% SDS, 0.1% bromophenol blue, and 1% &#946;-mercaptoethanol). Then, fractionate it by 10% SDS-PAGE (see Table of Materials). Load the 5% sucroseaqueous solution treated in the same manner as a negative control.</li>
	<li>Load a 20 &#181;L aliquot of the sample onto an SDS-PAGE gel alongside a prestained marker. Run the gel for 15 min at 90 Volt, and then 50 min at 140 Volt.</li>
	<li>Fix the gel in 30% (vol/vol) ethanol, 10% (vol/vol) acetic acid for at least 30 min after electrophoresis.</li>
	<li>Rinse the gel twice with 20% (vol/vol) ethanol and water separately for 10 min each time.</li>
	<li>Sensitize the gel in 0.8 mM sodium thiosulfate for 1 min, and then rinse twice in water for 1 min each time.</li>
	<li>Immerse the gel in 12 mM silver nitrate for at least 1 h, and then dip it in deionized water for 10 s before transferring it to the developer solution.</li>
	<li>When the background of the gel is getting dark, immerse the gel in a stop solution (5% acetic acid) for at least 30 min to stop the reaction.</li>
	<li>Wash the gel twice with water for 30 min each time. Develop the image with the Detection System (see Table of Materials).</li>
</ol>
6. Protein detection by western blotting
<ol>
	<li>Detect the saliva mucin-like protein of SBPH (LssgMP) and RSV by western blots using specific antibodies, respectively.</li>
	<li>Treat insect saliva samples following step 5.1.</li>
	<li>Load a 20 &#181;L aliquot of the sample onto a 10% SDS-PAGE gel alongside a prestained marker and a 20 &#181;L RSV non-infected saliva sample as a negative control. Run the gel for 15 min at 90 Volt, and then for 50 min at 140 Volt.</li>
	<li>Mix 100 mL of 10x protein transfer buffer (wet) (see&#160;Table of Materials)&#160;with 900 mL of ddH2O to a work solution (1x), and then transfer proteins to a polyvinylidene difluoride membrane using protein transfer buffer (1x).</li>
	<li>Block the membrane in 5% skim milk with 0.01 M Tris-buffered saline with 0.05% Tween 20 (TBST) at room temperature (RT) for 1 h. 
	NOTE: In this protocol, mix 100 mL of 10x TBST (see&#160;Table of Materials)&#160;with 900 mL of ddH2O into the work solution.</li>
	<li>Incubate the membrane with primary rabbit antibodies against RSV or LssgMP (both 1:10000) diluted in TBST at RT for at least 2 h. 
	NOTE: The production of primary antibodies against RSV was mentioned above. A biotechnology company produced the rabbit anti-LssgMP polyclonal antibody against LssgMP peptide GIQFDSYSASDLTRC.</li>
	<li>Wash the membrane three times with TBST for 10 min of incubation each time.</li>
	<li>Incubate the membrane with horseradish peroxidase-conjugated goat anti-rabbit antibodies diluted in 1:10000 TBST.</li>
	<li>Develop the immunoblots with the enhanced chemiluminescence Western Blotting Detection System.</li>
</ol>
7. Detection of LssgMP expression pattern in SBPH
<ol>
	<li>Immobilize the insects at 4 &#176;C for 5 min.</li>
	<li>Wash the insects with 75% ethanol and ddH2O one by one, and then dissect the insects in pre-chilled TBS (0.01 M Tris-buffered saline).</li>
	<li>Dissect the insects from the abdomen while severing the forelegs of SBPH at the coxa-trochanter joint by forceps; wash the midgut and the salivary glands twice in TBS to remove any contamination from the hemolymph.</li>
	<li>Put five tissues into a 1.5 mL RNase-free tube to extract RNA. Consider each tube as one sample.</li>
	<li>Perform RNA extraction according to the manufacturer&#39;s protocols and Reverse-transcriptional PCR (RT-PCR) (see Table of Materials).</li>
	<li>Perform quantitative real-time PCR (qRT-PCR) to investigate the relative transcript expression levels of LssgMP in extracts of the whole body or various tissues of L. striatellus. 
	NOTE: The primer pairs used for gene amplification were LssgMP-q-F/LssgMP-q-R, SYBR Green-based qPCR was performed according to the manufacturer&#39;s protocol. The transcript level of L. striatellus translation elongation factor 2 (ef2) was quantified with primer pair ef2-q-F/ef2-q-R for the normalization of the cDNA templates. And the primer sequences are attached below:LssgMP-q-F: TCCGACCTCACCAGAGTTTACAG; LssgMP-q-R: GCTTCGTCCCAGGTACTGATTCC; ef2-q-F: GTCTCCACGGATGGGCTTT; ef2-q-R: ATCTTGAATTTCTCGGCATACATTT.</li>
</ol>

<ol>
	<li>Cheng, X., Zhu, L., He, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+understanding+of+molecular+interactions+between+rice+and+the+brown+planthopper.">Towards understanding of molecular interactions between rice and the brown planthopper.</a> Molecular Plant. 6 (3), 621-634 (2013).</li><li>Cho, W. K., Lian, S., Kim, S. M., Park, S. H., Kim, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+insights+into+research+on+Rice+Stripe+Virus.">Current insights into research on Rice Stripe Virus.</a> The Plant Pathology Journal. 29 (3), 223-233 (2013).</li><li>He, M., Guan, S. Y., He, C. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolution+of+rice+stripe+virus.">Evolution of rice stripe virus.</a> Molecular Phylogenetics and Evolution. 109, 343-350 (2017).</li><li>Wu, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonstructural+protein+NS4+of+Rice+Stripe+Virus+plays+a+critical+role+in+viral+spread+in+the+body+of+vector+insects.">Nonstructural protein NS4 of Rice Stripe Virus plays a critical role in viral spread in the body of vector insects.</a> PLoS One. 9 (2), 88636 (2014).</li><li>Huo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transovarial+transmission+of+a+plant+virus+is+mediated+by+vitellogenin+of+its+insect+vector.">Transovarial transmission of a plant virus is mediated by vitellogenin of its insect vector.</a> PLoS Pathogens. 10 (3), 1003949 (2014).</li><li>Taning, C. N., Andrade, E. C., Hunter, W. B., Christiaens, O., Smagghe, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Asian+citrus+psyllid+RNAi+pathway-RNAi+evidence.">Asian citrus psyllid RNAi pathway-RNAi evidence.</a> Scientific Reports. 6, 38082 (2016).</li><li>Garbutt, J. S., Bell&#233;s, X., Richards, E. H., Reynolds, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Persistence+of+double-stranded+RNA+in+insect+hemolymph+as+a+potential+determiner+of+RNA+interference+success:+evidence+from+Manduca+sexta+and+Blattella+germanica.">Persistence of double-stranded RNA in insect hemolymph as a potential determiner of RNA interference success: evidence from Manduca sexta and Blattella germanica.</a> Journal of Insect Physiology. 59 (2), 171-178 (2013).</li><li>Huo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Artificial+feeding+Rice+Stripe+Virus+enables+efficient+virus+infection+of+Laodelphax+striatellus.">Artificial feeding Rice Stripe Virus enables efficient virus infection of Laodelphax striatellus.</a> Journal of Virological Methods. 235, 139-143 (2016).</li><li>Huo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insect+tissue-specific+vitellogenin+facilitates+transmission+of+plant+virus.">Insect tissue-specific vitellogenin facilitates transmission of plant virus.</a> PLoS Pathogens. 14 (2), 1006909 (2018).</li><li>Huo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rice+Stripe+Virus+hitchhikes+the+vector+insect+vitellogenin+ligand-receptor+pathway+for+ovary+entry.">Rice Stripe Virus hitchhikes the vector insect vitellogenin ligand-receptor pathway for ovary entry.</a> Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences. 374, 20180312 (2019).</li><li>Bao, Y. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=De+novo+intestine-specific+transcriptome+of+the+brown+planthopper+Nilaparvata+lugens+revealed+potential+functions+in+digestion,+detoxification+and+immune+response.">De novo intestine-specific transcriptome of the brown planthopper Nilaparvata lugens revealed potential functions in digestion, detoxification and immune response.</a> Genomics. 99 (4), 256-264 (2012).</li><li>Elzinga, D. A., Jander, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+protein+effectors+in+plant-aphid+interactions.">The role of protein effectors in plant-aphid interactions.</a> Current Opinion In Plant Biology. 16 (4), 451-456 (2013).</li><li>Chung, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Herbivore+exploits+orally+secreted+bacteria+to+suppress+plant+defenses.">Herbivore exploits orally secreted bacteria to suppress plant defenses.</a> Proceedings of the National Academy of Sciences of the United States of America. 110 (39), 15728-15733 (2013).</li><li>Bos, J. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+functional+genomics+approach+identifies+candidate+effectors+from+the+aphid+species+Myzus+persicae+(green+peach+aphid).">A functional genomics approach identifies candidate effectors from the aphid species Myzus persicae (green peach aphid).</a> PLoS Genetics. 6 (11), 1001216 (2010).</li><li>Liu, X., Zhou, H., Zhao, J., Hua, H., He, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+the+secreted+watery+saliva+proteins+of+the+rice+brown+planthopper,+Nilaparvata+lugens+(St&#229;l)+by+transcriptome+and+Shotgun+LC-MS/MS+approach.">Identification of the secreted watery saliva proteins of the rice brown planthopper, Nilaparvata lugens (St&#229;l) by transcriptome and Shotgun LC-MS/MS approach.</a> Journal of Insect Physiology. 89, 60-69 (2016).</li><li>Cao, T. T., L&#252;, J., Lou, Y. G., Cheng, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Feeding-induced+interactions+between+two+rice+planthoppers,+Nilaparvata+lugens+and+Sogatella+furcifera+(Hemiptera:+Delphacidae):+effects+on+feeding+and+honeydew+excretion.">Feeding-induced interactions between two rice planthoppers, Nilaparvata lugens and Sogatella furcifera (Hemiptera: Delphacidae): effects on feeding and honeydew excretion.</a> Environmental Entomology. 42 (6), 1281-1291 (2013).</li><li>De Vos, M., Jander, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Myzus+persicae+(green+peach+aphid)+salivary+components+induce+defence+responses+in+Arabidopsis+thaliana.">Myzus persicae (green peach aphid) salivary components induce defence responses in Arabidopsis thaliana.</a> Plant, Cell &amp; Environment. 32 (11), 1548-1560 (2009).</li><li>Wang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Understanding+the+immune+system+architecture+and+transcriptome+responses+to+southern+rice+black-streaked+dwarf+virus+in+Sogatella+furcifera.">Understanding the immune system architecture and transcriptome responses to southern rice black-streaked dwarf virus in Sogatella furcifera.</a> Scientific Reports. 6, 36254 (2016).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Penetration+into+rice+tissues+by+brown+planthopper+and+fine+structure+of+the+salivary+sheaths.">Penetration into rice tissues by brown planthopper and fine structure of the salivary sheaths.</a> Entomologia Experimentalis et Applicata. 129 (3), 295-307 (2008).</li><li>Wang, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Armet+is+an+effector+protein+mediating+aphid-plant+interactions.">Armet is an effector protein mediating aphid-plant interactions.</a> FASEB Journal: Official Publication of the Federation of American Societies for Experimental Biology. 29 (5), 2032-2045 (2015).</li><li>Chaudhary, R., Atamian, H. S., Shen, Z., Briggs, S. P., Kaloshian, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GroEL+from+the+endosymbiont+Buchnera+aphidicola+betrays+the+aphid+by+triggering+plant+defense.">GroEL from the endosymbiont Buchnera aphidicola betrays the aphid by triggering plant defense.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (24), 8919-8924 (2014).</li><li>Ma, R., Chen, J. L., Cheng, D. F., Sun, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+defense+mechanism+in+wheat+by+polyphenol+oxidase+from+aphid+saliva.">Activation of defense mechanism in wheat by polyphenol oxidase from aphid saliva.</a> Journal of Agricultural and Food Chemistry. 58 (4), 2410-2418 (2010).</li><li>Zheng, L., Seon, Y. J., McHugh, J., Papagerakis, S., Papagerakis, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clock+genes+show+circadian+rhythms+in+salivary+glands.">Clock genes show circadian rhythms in salivary glands.</a> Journal of Dental Research. 91 (8), 783-788 (2012).</li><li>Huang, H. J., Lu, J. B., Li, Q., Bao, Y. Y., Zhang, C. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+transcriptomic/proteomic+analysis+of+salivary+gland+and+secreted+saliva+in+three+planthopper+species.">Combined transcriptomic/proteomic analysis of salivary gland and secreted saliva in three planthopper species.</a> Journal of Proteomics. 172, 25-35 (2018).</li><li>Huang, H. J., Liu, C. W., Xu, H. J., Bao, Y. Y., Zhang, C. X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucin-like+protein,+a+saliva+component+involved+in+brown+planthopper+virulence+and+host+adaptation.">Mucin-like protein, a saliva component involved in brown planthopper virulence and host adaptation.</a> Journal of Insect Physiology. 98, 223-230 (2017).</li><li>Shangguan, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mucin-like+protein+of+planthopper+is+required+for+feeding+and+induces+immunity+response+in+plants.">A mucin-like protein of planthopper is required for feeding and induces immunity response in plants.</a> Plant Physiology. 176 (1), 552-565 (2018).</li><li>Petrova, A., Smith, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunodetection+of+a+brown+planthopper+(Nilaparvata+lugens+St&#229;l)+salivary+catalase-like+protein+into+tissues+of+rice,+Oryza+sativa.">Immunodetection of a brown planthopper (Nilaparvata lugens St&#229;l) salivary catalase-like protein into tissues of rice, Oryza sativa.</a> Insect Molecular Biology. 23 (1), 13-25 (2014).</li><li>Zhu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequence+of+the+small+brown+planthopper,+Laodelphax+striatellus.">Genome sequence of the small brown planthopper, Laodelphax striatellus.</a> GigaScience. 6 (12), 1-12 (2017).</li><li>Van Bel, A. J., Will, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+evaluation+of+proteins+in+watery+and+gel+saliva+of+aphids.">Functional evaluation of proteins in watery and gel saliva of aphids.</a> Frontiers In Plant Science. 7, 1840 (2016).</li><li>Perez-Vilar, J., Hill, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+structure+and+assembly+of+secreted+mucins.">The structure and assembly of secreted mucins.</a> The Journal of Biological Chemistry. 274 (45), 31751-31754 (1999).</li><li>Pitino, M., Hogenhout, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aphid+protein+effectors+promote+aphid+colonization+in+a+plant+species-specific+manner.">Aphid protein effectors promote aphid colonization in a plant species-specific manner.</a> Molecular Plant-Microbe Interactions: MPMI. 26 (1), 130-139 (2013).</li><li>Zhang, F., Zhu, L., He, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+gene+expression+in+response+to+brown+planthopper+feeding+in+rice.">Differential gene expression in response to brown planthopper feeding in rice.</a> Journal of Plant Physiology. 161 (1), 53-62 (2004).</li><li>Hogenhout, S. A., Ammar, E. -. D., Whitfield, A. E., Redinbaugh, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insect+vector+interactions+with+persistently+transmitted+viruses.">Insect vector interactions with persistently transmitted viruses.</a> Annual Review of Phytopathology. 46, 327-359 (2008).</li><li>Boissot, N., Schoeny, A., Vanlerberghe-Masutti, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vat,+an+amazing+gene+conferring+resistance+to+aphids+and+viruses+they+carry:+from+molecular+structure+to+field+effects.">Vat, an amazing gene conferring resistance to aphids and viruses they carry: from molecular structure to field effects.</a> Frontiers In Plant Science. 7, 1420 (2016).</li></ol>

The authors declare that they have no conflicts of interest.

Successful rearing of insects on artificial diets was first reported in 1962 when Mittler and Dadd described the Paraffin membrane technique to hold an artificial diet29,30. And this method has been explored in many aspects of insect biology and behavior, for example, nutrient supplement, dsRNA feeding, and virus acquisition. Based on the requirements of saliva analysis, 5% sucrose is used as the general artificial diet to collect saliva of SBPH in this study. For successful saliva collection, several critical steps are worth noting here. Firstly, starving the experimental insects before introducing them into the chamber is necessary to ensure the efficiency of saliva collection. Secondly, to imitate the stylet environment, a two-layer Paraffin sandwich is made. When SBPH feeds on the artificial diet, the salivary sheath forms at the inside end facing the diet, and the watery saliva is secreted subsequently. Thirdly, an artificial medium should be collected and exchanged in time to reduce microbial contamination in the collected sample. Finally, anesthetizing the insects at 4 &#176;C for 5 min is essential to avoid the loss of insects while changing the artificial diet.
In contrast to most artificial diets which contain amino acids, vitamins, and carbohydrates, the advantages of 5% sucrose medium are noteworthy. First, it is easy to prepare. Second, the simple composition of the diet means few substances to interfere with further analysis of the various factors in saliva. Nevertheless, the survival ratio of the SBPH declined in the last days of the feeding period using 5% sucrose as the general artificial diet (Figure 1D). For overcoming this flaw, fresh SBPH should be supplied in time for enough saliva. And for further research of the salivary function on feeding behavior or virus transmission, the saliva collection duration should be limited to the accurate time before insects&#39; mortality increased owing to innutrition. It seems to be a common limitation of the artificial medium. Some other studies found that the survival of N. lugens reared on the chemically defined diet D-97 was inferior to that of those raised on the susceptible rice variety TN1, implying that the original host supplies more than just food vector insects. And several studies have focused on optimizing chemically defined diets for continuous feeding of insects to improve the rearing efficiency.
Transcriptome analysis of the salivary gland is a traditional method for saliva protein identification. And different saliva proteins have been detected in the same species of A. pisum and M. persicae14,31, and the abundance of saliva proteins determines the frequency of their detection32. However, a valid method to investigate the suspected protein in the saliva was lacking. This Paraffin membrane&#160;sandwich method provides an innovative manner to confirm a suspected saliva protein identified by transcriptome analysis, which is further proved by detecting LssgMP (Figure 2C). Moreover, protein analysis confirmed that abundant proteins are present in the collected saliva (Figure 2A), which is a sufficient quantity for further analysis by, for example, mass spectrometry. Proteomics analysis of collected saliva will be a direct and effective method for identifying secreted factors involved in the feeding stage of SBPH, minimizing the risk of detecting false-positive redundant proteins.
Saliva works as the virus carrier from insect to host plants and is an essential component of the vector-virus-plant interaction14,33,34. The titer of virus released from insect vectors is a crucial factor for the infection to the host. Compared with indirect methods that test the viral titer in infected plants, this protocol can directly detect RSV released by viruliferous SBPH (Figure 2B). Supported by this Paraffin membrane sandwich method, further comparative analyses of saliva proteins collected from RSV-free and RSV-infected insects may also reveal potential candidates involved in the virus-plant-vector interaction.

Rice stripe virus (RSV), a negative-stranded RNA virus in the genus Tenuivirus, causes severe diseases in rice production in East Asia1,2,3. Transmission of RSV from infected rice plants to healthy ones depends on insect vectors, mainly Laodelphax striatellus, which transmits RSV in a persistent-propagative manner. SBPH acquires the virus after feeding on RSV-infected plants. Once inside the insect, RSV infects the midgut epithelial cell one day after feeding and then passes through the midgut barrier to penetrate the hemolymph. Subsequently, RSV spreads into different tissues via the hemolymph and then propagates. After a latent period of about 10-14 days post-acquisition, the virus inside the salivary gland can be transmitted to the healthy host plants via the secreted saliva while SBPH sucks sap from the phloem4,5,6,7,8,9,10. An efficient feeding process and various factors in the saliva are essential for the spread of RSV from the insect to the host plant.
Insect saliva secreted by salivary glands is believed to mediate insects, viruses, and host plants.Hemipteran insects usually produce two types of saliva: gelling saliva and watery saliva11,12,13. Gelling saliva is mainly secreted into the apoplasm to sustain the movement of the stylet among host cells and is also related to overcoming plant resistance and immune responses14,15,16,17. At the probing stage of feeding, insects intermittently secrete gelling saliva that immediately gets oxidized to form a surface flange. Then, single or branched sheaths encase the stylet to reserve a tubular channel18,19,20. The surface flange on the epidermis is presumed to facilitate penetration of the stylet by serving as an anchor point, while the sheaths around the stylet may provide mechanical stability and lubrication16,21,22,23. Nlshp was identified as an essential protein for salivary sheath formation and successful feeding of brown planthopper (Nilaparvata lugens, BPH). Inhibition of the expression of the structural sheath protein (SHP) secreted by the aphid Acyrthosiphon pisum reduced its reproduction by disrupting feeding from host sieve tubes24. Moreover, in some insect species, gel saliva factors are supposed to trigger plant immune responses by forming so-called herbivore-associated molecular patterns (HAMPs). In N. lugens, NlMLP, a mucin-like protein related to sheath formation, induces plant defenses against feeding, including cell death, the expression of defense-related genes, and callose deposition 25,26. Also, some gel saliva factors in aphids have been proved to trigger plant defense responses via gene-to-gene interactions similar to pathogen-associated molecular patterns12,15,27.
For studying the saliva factors essential for insect feeding and/or pathogen transmission, it is necessary to analyze secreted saliva. Here, artificial feeding and collection methods to obtain sufficient amounts of saliva are described for further analysis. Using a medium containing only a single nutritional element, many saliva proteins were collected and analyzed by silver staining and western blotting. This method will be helpful in further research on factors in saliva that are essential for RSV transmission by SBPH.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>10-KD centrifugal filter</td>
			<td>Merck Millipore</td>
			<td>R5PA83496</td>
			<td>For concentration</td>
		</tr>
		<tr>
			<td>10x Protein Transfer Buffer(wet)</td>
			<td>macGENE</td>
			<td>MP008</td>
			<td>Transfer buffer for western blotting</td>
		</tr>
		<tr>
			<td>10x TBST buffer</td>
			<td>Coolaber</td>
			<td>SL1328-500mL&#215;10</td>
			<td>Wash buffer for western blotting</td>
		</tr>
		<tr>
			<td>Azure c600 biosystems</td>
			<td>Azure Biosystems</td>
			<td>Azure c600</td>
			<td>Imaging system for western blotting and silver staining</td>
		</tr>
		<tr>
			<td>Color Prestained protein ladder</td>
			<td>GenStar</td>
			<td>M221-01</td>
			<td>Protein marker for western blotting</td>
		</tr>
		<tr>
			<td>ECL&#160;western blotting detection reagents</td>
			<td>GE Healthcare</td>
			<td>RPN2209</td>
			<td>Western blotting detection</td>
		</tr>
		<tr>
			<td>Enchanced HRP-DAB Chromogenic Kit</td>
			<td>TIANGEN</td>
			<td>#PA110</td>
			<td>Chromogenic reaction</td>
		</tr>
		<tr>
			<td>Horseradish peroxidase-conjugated goat anti-rabbit antibodies</td>
			<td>Sigma</td>
			<td>401393-2ML</td>
			<td>Polyclonal secondary antibody for western blotting</td>
		</tr>
		<tr>
			<td>Immobilon(R)-P Polyvinylidene difluoride membrane</td>
			<td>Merck Millipore</td>
			<td>IPVH00010</td>
			<td>Transfer membrane for western blotting</td>
		</tr>
		<tr>
			<td>iTaq Universal SYBR Green Supermix</td>
			<td>Bio-Rad</td>
			<td>1725125</td>
			<td>For quantitative real-time PCR (qRT-PCR)</td>
		</tr>
		<tr>
			<td>KIT,iSCRIPT cDNA SYNTHES</td>
			<td>Bio-Rad</td>
			<td>1708891</td>
			<td>For Reverse-transcriptional PCR (RT-PCR)</td>
		</tr>
		<tr>
			<td>Millex-GP Filter, 0.22 &#181;m</td>
			<td>Merck Millipore</td>
			<td>SLGP033RB</td>
			<td>For filtration</td>
		</tr>
		<tr>
			<td>Mini-PROTEAB TGX Gels</td>
			<td>Bio-Rad</td>
			<td>4561043</td>
			<td>For SDS-PAGE</td>
		</tr>
		<tr>
			<td>NanoDrop One</td>
			<td>Thermo Scientific</td>
			<td>ND-ONEC-W</td>
			<td>Detection of protein concentration</td>
		</tr>
		<tr>
			<td>Nylon membrane</td>
			<td>PALL</td>
			<td>T42754</td>
			<td>Membrane for dot-ELISA</td>
		</tr>
		<tr>
			<td>Parafilm M Membrane</td>
			<td>Sigma</td>
			<td>P7793-1EA</td>
			<td>Making artifical diet sandwichs</td>
		</tr>
		<tr>
			<td>Rabbit anti-LssgMP polyclonal antibody against LssgMP peptides</td>
			<td>Genstript</td>
			<td></td>
			<td>Rabbit primary anti-LssgMP polyclonal antibody for western blotting</td>
		</tr>
		<tr>
			<td>Rabbit anti-RSV polyclonal antibody</td>
			<td>Genstript</td>
			<td></td>
			<td>Rabbit primary anti-RSV polyclonal antibody for western blotting and dot-ELISA</td>
		</tr>
		<tr>
			<td>RNAprep pure Micro Kit</td>
			<td>TIANGEN</td>
			<td>DP420</td>
			<td>For RNA Extraction</td>
		</tr>
	</tbody>
</table>

two-layered membrane sandwich method for laodelphax striatellus saliva collection

Rice stripe virus (RSV), which causes significant economic loss of agriculture in East Asia, entirely depends on insect vectors for its effective transmission among host rice. Laodelphax striatellus (small brown planthopper, SBPH) is the primary insect vector that horizontally transmits RSV while sucking sap from the phloem. Saliva plays a significant role in insects' feeding behavior. A convenient method that will be useful for research on insects' saliva with piercing-sucking feeding behavior is described here. In this method, insects were allowed to feed on an artificial diet sandwiched between two stretched paraffin film layers. The diet containing the saliva was collected each day, filtered, and concentrated for further analysis. Finally, the quality of collected saliva was examined by protein staining and immunoblotting. This method was exemplified by detecting the presence of RSV and a mucin-like protein in the saliva of SBPH. These artificial feeding and saliva collection method will lay a foundation for further research on factors in insect saliva related to feeding behavior and virus transmission.

Schematics of artificial feeding installation and saliva collection 
Figure 1A depicts the glass cylinder (15 cm x 2.5 cm) used as a feeding chamber to collect the saliva. Firstly, the SBPH larvae were starved for several hours to improve the collection efficiency and then immobilized by chilling for 5 min. After the insects were transferred into the glass cylinder, both open ends of the chamber were covered with stretched Paraffin membrane. At one end, 200 &#181;L of 5% sucrose was sandwiched between two layers of Paraffin membrane extended to about double its original area (Figure 1B). The chamber was covered with foil, but the end with the artificial diet was exposed to light. Because SBPH displays phototropic behavior, the starved insects gathered at the end were exposed to light and fed on the artificial diet solution through the stretched inner Paraffin membrane. Based on it, saliva could be released into the artificial diet, which was collected each day. The Parafilm-diet device was replaced with a new one every day. In this way, the artificial diet was collected for 5 days to 2 weeks, and then the whole sample was concentrated to a final volume of 100 &#181;L using a 10 KD centrifugal filter (Figure 1C). During the collection of saliva, the survival rate of SBPH feeding the 5% sucrose was counted. In the first 4 days, more than 80% SBPH survived. However, from the 5th day onward, mortality increased quickly to 40%, and less than half SBPH survived on the 7th day (Figure 1D). To collect sufficient saliva, fresh SBPH was suggested to supply on the 4th day.
Verification of collected saliva proteins 
For assessing the effectiveness of this collection method, the saliva sample was subjected to protein analysis. Firstly, proteins were separated by SDS-PAGE, and then detected by silver staining (Figure 2A). Compared with the negative control (5% sucrose), the concentrated saliva samples from RSV-infected SBPH saliva contained many proteins that could be further analyzed, for example, by mass spectrometry. As the primary insect vector of RSV, SBPH transmits the virus to plants via its sucking-piercing feeding process. The successful release of RSV is related to saliva secretion, and RSV is considered to be an essential factor in viruliferous insects&#39; saliva. Here, saliva was tested after collecting non-infected and viruliferous insects with an antibody against RSV and successfully detected the RSV coat protein (CP) in the viruliferous sample (Figure 2B). Another study found that mucin proteins are essential gel saliva proteins in hemipteran insects to meditate the formation of a sheath for feeding23. For confirming that SBPH also produces a mucin protein, the whole open reading frame of a putative mucin-encoding gene was amplified from RNA extracted from the saliva gland of SBPH. Its sequence was used as a query in BLAST analyses against the genome sequence of SBPH28. A gene consisting of 2175 bp, named LssgMP, was identified. An antibody against this protein was prepared previously and was used to detect the protein in the collected sample by western blot analysis. A 78 KD protein was detected in non-infected and viruliferous samples, demonstrating that LssgMP is a saliva protein (Figure 2C). Next, the transcript levels of LssgMP in different tissues (salivary gland, gut, and remaining body) were determined by qRT-PCR. The results showed that the gene transcript level was 20-fold higher in the salivary gland than in the gut and other body parts (Figure 2D), confirming the specific expression of LssgMP in the salivary gland.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62831/62831fig01.jpg" /> 
Figure 1: Diagram of feeding chamber with Paraffin membrane sandwich to allow feeding of SBPH on artificial diet. (A) Illustration of artificial feeding chamber. The cylinder is 15.0 cm long and 2.5 cm in diameter. At one end of the chamber is the Paraffin membrane sandwich; the other end and the cylinder wall covered with tin foil paper (slanted lines) represent the device covered with tin foil paper. The light source was set to attract SBPH to feed on the artificial diet. (B) Diagram of Paraffin sandwich containing artificial diet. 200 &#181;L of 5% sucrose aqueous solution was sandwiched between two layers of Paraffin membranes stretched to about double its original area. (C) The concentration of collected saliva using a 10 KD centrifugal filter. (D) The survival rate of SBPH feeding on 5% sucrose. Mean and SEM was calculated from four biological replicates with three technical replicates. <a href="https://www.jove.com/files/ftp_upload/62831/62831fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62831/62831fig02.jpg" /> 
Figure 2: Verification of collected saliva proteins. (A) Saliva proteins detection by silver staining. The 5% sucrose is negative control. (B) Detection of rice stripe virus coat protein (CP) in collected saliva by western blot analysis. (C) Western blotting to confirm the presence of LssgMP in collected saliva. (D) Specific expression of LssgMP in the salivary gland of L. striatellus. ef2:&#160;translation elongation factor 2 of SBPH. Mean and SEM was calculated from four biological replicates with three technical replicates. <a href="https://www.jove.com/files/ftp_upload/62831/62831fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Two-layered Membrane Sandwich Method for Laodelphax striatellus Saliva Collection at JoVE.com

Two-layered Membrane Sandwich Method for Laodelphax striatellus Saliva Collection

The present protocol describes a method to collect sufficient saliva from piercing-sucking insects using an artificial medium. This is a convenient method for collecting insect saliva and studying salivary function on insect feeding behavior and vector-borne virus transmission.

Two-layered Membrane Sandwich Method for Laodelphax striatellus Saliva Collection

Rice stripe virus (RSV), which causes significant economic loss of agriculture in East Asia, entirely depends on insect vectors for its effective ...

two-layered-membrane-sandwich-method-for-laodelphax-striatellus

Nanyang Technological University

Research

JoVE Journal

Biology

2.3K Views.  Chinese Academy of Sciences. The present protocol describes a method to collect sufficient saliva from piercing-sucking insects using an artificial medium. This is a convenient method for collecting insect saliva and studying salivary function on insect feeding behavior and vector-borne virus transmission.

Video: Two-layered Membrane Sandwich Method for Laodelphax striatellus Saliva Collection

Gibberella zeae Ascospore Production and Collection for Microarray Experiments.

Fusarium graminearum Schwabe (teleomorph Gibberella zeae) is a plant pathogen causing scab disease on wheat and barley that reduces crop yield and grain quality. F. graminearum also causes stalk and ear rots of maize and is a producer of mycotoxins such as the trichothecenes that contaminate grain and are harmful to humans and livestock (Goswami and Kistler, 2004).

The fungus produces two types of spores. Ascospores, the propagules resulting from sexual reproduction, are the main source of primary infection.  These spores are forcibly discharged from mature perithecia and dispersed by wind (Francl et al 1999). Secondary infections are mainly caused by macroconidia which are produced by asexual means on the plant surface. To study the developmental processes of ascospores in this fungus, a procedure for their collection in large quantity under sterile conditions was required. Our protocol was filmed in order to generate the highest level of information for understanding and reproducibility; crucial aspects when full genome gene expression profiles are generated and interpreted. In particular, the variability of ascospore germination and biological activity are dependent on the prior manipulation of the material. The use of video for documenting every step in ascospore production is proposed in order to increase standardization, complying with the increasingly stringent requirements for microarray analysis. The procedure requires only standard laboratory equipment. Steps are shown to prevent contamination and favor time synchronization of ascospores.

To study the developmental processes of ascospores in Gibberella zeae, a procedure for collection under sterile conditions is filmed in order to generate the highest level of information for protocol description. This should facilitate the reproducibility of the experiment, a crucial aspect when full genome expression profile tests are implemented.

Fusarium graminearum Schwabe (teleomorph Gibberella zeae) is a plant pathogen causing scab disease on wheat and barley that reduces crop yield and grain ...

Crystallizing Membrane Proteins for Structure Determination using Lipidic Mesophases

A detailed protocol for crystallizing membrane proteins by using lipidic mesophases is described. This method has variously been referred to as the lipidic cubic phase or in meso method. The method has been shown to be quite versatile in that it has been used to solve X-ray crystallographic structures of prokaryotic and eukaryotic proteins, proteins that are monomeric, homo- and hetero-multimeric, chromophore-containing and chromophore-free, and alpha-helical and beta-barrel proteins. Recent successes using in meso crystallization are the human engineered beta2-adrenergic and adenosine A2a G protein-coupled receptors. Protocols are presented for reconstituting the membrane protein into the monoolein-based mesophase, and for setting up crystallizations in the manual mode. Additional steps in the overall process, such as crystal harvesting, are to be addressed in future video articles. The time required to prepare the protein-loaded mesophase and to set up a crystallization plate manually is about one hour.

Herein is described the procedure implemented in the Caffrey Membrane Structural and Functional Biology Group to set up manually crystallization trials of membrane proteins in lipidic mesophases.

A detailed protocol for crystallizing membrane proteins by using lipidic mesophases is described. This method has variously been referred to as the ...

High-throughput Crystallization of Membrane Proteins Using the Lipidic Bicelle Method

Membrane proteins (MPs) play a critical role in many physiological processes such as pumping specific molecules across the otherwise impermeable membrane bilayer that surrounds all cells and organelles. Alterations in the function of MPs result in many human diseases and disorders; thus, an intricate understanding of their structures remains a critical objective for biological research. However, structure determination of MPs remains a significant challenge often stemming from their hydrophobicity. 
MPs have substantial hydrophobic regions embedded within the bilayer. Detergents are frequently used to solubilize these proteins from the bilayer generating a protein-detergent micelle that can then be manipulated in a similar manner as soluble proteins. Traditionally, crystallization trials proceed using a protein-detergent mixture, but they often resist crystallization or produce crystals of poor quality. These problems arise due to the detergent&prime;s inability to adequately mimic the bilayer resulting in poor stability and heterogeneity. In addition, the detergent shields the hydrophobic surface of the MP reducing the surface area available for crystal contacts. To circumvent these drawbacks MPs can be crystallized in lipidic media, which more closely simulates their endogenous environment, and has recently become a de novo technique for MP crystallization.
Lipidic cubic phase (LCP) is a three-dimensional lipid bilayer penetrated by an interconnected system of aqueous channels1. Although monoolein is the lipid of choice, related lipids such as monopalmitolein and monovaccenin have also been used to make LCP2. MPs are incorporated into the LCP where they diffuse in three dimensions and feed crystal nuclei. A great advantage of the LCP is that the protein remains in a more native environment, but the method has a number of technical disadvantages including high viscosity (requiring specialized apparatuses) and difficulties in crystal visualization and manipulation3,4. Because of these technical difficulties, we utilized another lipidic medium for crystallization-bicelles5,6 (Figure 1). Bicelles are lipid/amphiphile mixtures formed by blending a phosphatidylcholine lipid (DMPC) with an amphiphile (CHAPSO) or a short-chain lipid (DHPC). Within each bicelle disc, the lipid molecules generate a bilayer while the amphiphile molecules line the apolar edges providing beneficial properties of both bilayers and detergents. Importantly, below their transition temperature, protein-bicelle mixtures have a reduced viscosity and are manipulated in a similar manner as detergent-solubilized MPs, making bicelles compatible with crystallization robots. 
Bicelles have been successfully used to crystallize several membrane proteins5,7-11 (Table 1). This growing collection of proteins demonstrates the versatility of bicelles for crystallizing both alpha helical and beta sheet MPs from prokaryotic and eukaryotic sources. Because of these successes and the simplicity of high-throughput implementation, bicelles should be part of every membrane protein crystallographer&prime;s arsenal. In this video, we describe the bicelle methodology and provide a step-by-step protocol for setting up high-throughput crystallization trials of purified MPs using standard robotics.

Bicelles are lipid/amphiphile mixtures that maintain membrane proteins (MPs) within a lipid bilayer but have unique phase behavior that facilitates high-throughput screening by crystallization robots. This technique has successfully produced a number of high-resolution structures from both prokaryotic and eukaryotic sources. This video describes protocols for generating the lipidic bicelle mixture, incorporating MPs into the bicelle mixture, setting up crystallizations trials (manually as well as robotically) and harvesting crystals from the medium.

Membrane proteins (MPs) play a critical role in many physiological processes such as pumping specific molecules across the otherwise impermeable membrane ...

Blood Collection for Biochemical Analysis in Adult Zebrafish

The zebrafish has been used as an animal model for studies of several human diseases. It can serve as a powerful preclinical platform for studies of molecular events and therapeutic strategies as well as for evaluating the physiological mechanisms of some pathologies1. 
There are relatively few publications related to adult zebrafish physiology of organs and systems2, which may lead researchers to infer that the basic techniques needed to allow the exploration of zebrafish systems are lacking3. Hematologic biochemical values of zebrafish were first reported in 2003 by Murtha and colleagues4 who employed a blood collection technique first described by Jagadeeswaran and colleagues in 1999. Briefly, blood was collected via a micropipette tip through a lateral incision, approximately 0.3 cm in length, in the region of the dorsal aorta5. Because of the minute dimensions involved, this is a high-precision technique requiring a highly skilled practitioner. The same technique was used by the same group in another publication in that same year6. In 2010, Eames and colleagues assessed whole blood glucose levels in zebrafish7. They gained access to the blood by performing decapitations with scissors and then inserting a heparinized microcapillary collection tube into the pectoral articulation. They mention difficulties with hemolysis that were solved with an appropriate storage temperature based on the work Kilpatrick et al.8. When attempting to use Jagadeeswaran's technique in our laboratory, we found that it was difficult to make the incision in precisely the right place as not to allow a significant amount of blood to be lost before collection could be started. 
Recently, Gupta et al.9 described how to dissect adult zebrafish organs, Kinkle et al.10 described how to perform intraperitoneal injections, and Pugach et al.11 described how to perform retro-orbital injections. However, more work is needed to more fully explore basic techniques for research in zebrafish.
The small size of zebrafish presents challenges for researchers using it as an experimental model. Furthermore, given this smallness of scale, it is important that simple techniques are developed to enable researchers to explore the advantages of the zebrafish model.

This paper presents a technique for collection of blood from the dorsal aorta of Zebrafish. It also provides instructions for obtaining serum for use in biochemical analyses, such as tests for determining cholesterol and triglyceride levels.

The zebrafish has been used as an animal model for studies of several human diseases. It can serve as a powerful preclinical platform for studies of ...

Use of a Robot for High-throughput Crystallization of Membrane Proteins in Lipidic Mesophases

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through macromolecular X-ray crystallography (MX). An essential ingredient of MX is a steady supply of ideally diffraction-quality crystals. The in meso or lipidic cubic phase (LCP) method for crystallizing membrane proteins is one of several methods available for crystallizing membrane proteins. It makes use of a bicontinuous mesophase in which to grow crystals. As a method, it has had some spectacular successes of late and has attracted much attention with many research groups now interested in using it. One of the challenges associated with the method is that the hosting mesophase is extremely viscous and sticky, reminiscent of a thick toothpaste. Thus, dispensing it manually in a reproducible manner in small volumes into crystallization wells requires skill, patience and a steady hand. A protocol for doing just that was developed in the Membrane Structural &amp; Functional Biology (MS&amp;FB) Group1-3. JoVE video articles describing the method are available1,4. 
The manual approach for setting up in meso trials has distinct advantages with specialty applications, such as crystal optimization and derivatization. It does however suffer from being a low throughput method. Here, we demonstrate a protocol for performing in meso crystallization trials robotically. A robot offers the advantages of speed, accuracy, precision, miniaturization and being able to work continuously for extended periods under what could be regarded as hostile conditions such as in the dark, in a reducing atmosphere or at low or high temperatures. An in meso robot, when used properly, can greatly improve the productivity of membrane protein structure and function research by facilitating crystallization which is one of the slow steps in the overall structure determination pipeline. 
In this video article, we demonstrate the use of three commercially available robots that can dispense the viscous and sticky mesophase integral to in meso crystallogenesis. The first robot was developed in the MS&amp;FB Group5,6. The other two have recently become available and are included here for completeness.	
An overview of the protocol covered in this article is presented in Figure 1. All manipulations were performed at room temperature (~20 &deg;C) under ambient conditions.

Herein is described a robotic approach to high-throughput crystallization of membrane proteins in lipidic mesophases for use in structure determination using macromolecular X-ray crystallography. Three robots capable of handling the viscous and sticky protein-laden mesophase integral to the method are introduced.

Structure-function studies of membrane proteins greatly benefit from having available high-resolution 3-D structures of the type provided through ...

Harvesting and Cryo-cooling Crystals of Membrane Proteins Grown in Lipidic Mesophases for Structure Determination by Macromolecular Crystallography

An important route to understanding how proteins function at a mechanistic level is to have the structure of the target protein available, ideally at atomic resolution. Presently, there is only one way to capture such information as applied to integral membrane proteins (Figure 1), and the complexes they form, and that method is macromolecular X-ray crystallography (MX). To do MX diffraction quality crystals are needed which, in the case of membrane proteins, do not form readily. A method for crystallizing membrane proteins that involves the use of lipidic mesophases, specifically the cubic and sponge phases1-5, has gained considerable attention of late due to the successes it has had in the G protein-coupled receptor field6-21 (<a href="http://www.mpdb.tcd.ie" target="_blank">www.mpdb.tcd.ie</a>). However, the method, henceforth referred to as the in meso or lipidic cubic phase method, comes with its own technical challenges. These arise, in part, due to the generally viscous and sticky nature of the lipidic mesophase in which the crystals, which are often micro-crystals, grow. Manipulating crystals becomes difficult as a result and particularly so during harvesting22,23. Problems arise too at the step that precedes harvesting which requires that the glass sandwich plates in which the crystals grow (Figure 2)24,25 are opened to expose the mesophase bolus, and the crystals therein, for harvesting, cryo-cooling and eventual X-ray diffraction data collection.
The cubic and sponge mesophase variants (Figure 3) from which crystals must be harvested have profoundly different rheologies4,26. The cubic phase is viscous and sticky akin to a thick toothpaste. By contrast, the sponge phase is more fluid with a distinct tendency to flow. Accordingly, different approaches for opening crystallization wells containing crystals growing in the cubic and the sponge phase are called for as indeed different methods are required for harvesting crystals from the two mesophase types. Protocols for doing just that have been refined and implemented in the Membrane Structural and Functional Biology (MS&amp;FB) Group, and are described in detail in this JoVE article (Figure 4). Examples are given of situations where crystals are successfully harvested and cryo-cooled. We also provide examples of cases where problems arise that lead to the irretrievable loss of crystals and describe how these problems can be avoided. In this article the Viewer is provided with step-by-step instructions for opening glass sandwich crystallization wells, for harvesting and for cryo-cooling crystals of membrane proteins growing in cubic and in sponge phases.

Herein is described procedures implemented in the Caffrey Membrane Structural and Functional Biology Group to harvest and cryo-cool membrane protein crystals grown in lipidic cubic and sponge phases for use in structure determination using macromolecular X-ray crystallography.

An important route to understanding how proteins function at a mechanistic level is to have the structure of the target protein available, ideally at ...

A Practical and Novel Method to Extract Genomic DNA from Blood Collection Kits for Plasma Protein Preservation

Laboratory tests can be done on the cellular or fluid portions of the blood. The use of different blood collection tubes determines the portion of the blood that can be analyzed (whole blood, plasma or serum). Laboratories involved in studying the genetic basis of human disorders rely on anticoagulated whole blood collected in EDTA-containing vacutainer as the source of DNA for genetic / genomic analysis. Because most clinical laboratories perform biochemical, serologic and viral testing as a first step in phenotypic outcome investigation, anticoagulated blood is also collected in heparin-containing tube (plasma tube). Therefore when DNA and plasma are needed for simultaneous and parallel analyses of both genomic and proteomic data, it is customary to collect blood in both EDTA and heparin tubes. If blood could be collected in a single tube and serve as a source for both plasma and DNA, that method would be considered an advancement to existing methods. The use of the compacted blood after plasma extraction represents an alternative source for genomic DNA, thus minimizing the amount of blood samples processed and reducing the number of samples required from each patient. This would ultimately save time and resources.
The BD P100 blood collection system for plasma protein preservation were created as an improved method over previous plasma or serum collection tubes1, to stabilize the protein content of blood, enabling better protein biomarker discovery and proteomics experimentation from human blood. The BD P100 tubes contain 15.8 ml of spray-dried K2EDTA and a lyophilized proprietary broad spectrum cocktail of protease inhibitors to prevent coagulation and stabilize the plasma proteins. They also include a mechanical separator, which provides a physical barrier between plasma and cell pellets after centrifugation. Few methods have been devised to extract DNA from clotted blood samples collected in old plasma tubes2-4. Challenges from these methods were mainly associated with the type of separator inside the tubes (gel separator) and included difficulty in recovering the clotted blood, the inconvenience of fragmenting or dispersing the clot, and obstruction of the clot extraction by the separation gel.
We present the first method that extracts and purifies genomic DNA from blood drawn in the new BD P100 tubes. We compare the quality of the DNA sample from P100 tubes to that from EDTA tubes. Our approach is simple and efficient. It involves four major steps as follows: 1) the use of a plasma BD P100 (BD Diagnostics, Sparks, MD, USA) tube with mechanical separator for blood collection, 2) the removal of the mechanical separator using a combination of sucrose and a sterile paperclip metallic hook, 3) the separation of the buffy coat layer containing the white cells and 4) the isolation of the genomic DNA from the buffy coat using a regular commercial DNA extraction kit or a similar standard protocol.

We are describing a new method of isolating genomic DNA from whole blood collected for plasma/serology. After plasma collection, the compacted blood is usually discarded. Our novel method represents a significant improvement over existing methods and makes DNA and plasma available from a single collection, without requesting additional blood.

Laboratory tests can be done on the cellular or  fluid portions of the blood. The use of different blood collection tubes  determines the portion of the ...

Milk Collection Methods for Mice and Reeves' Muntjac Deer

Animal models are commonly used throughout research laboratories to accomplish what would normally be considered impractical in a pathogen&#8217;s native host. Milk collection from animals allows scientists the opportunity to study many aspects of reproduction including vertical transmission, passive immunity, mammary gland biology, and lactation. Obtaining adequate volumes of milk for these studies is a challenging task, especially from small animal models. Here we illustrate an inexpensive and facile method for milk collection in mice and Reeves&#8217; muntjac deer that does not require specialized equipment or extensive training. This particular method requires two researchers: one to express the milk and to stabilize the animal, and one to collect the milk in an appropriate container from either a Muntjac or mouse model. The mouse model also requires the use of a P-200 pipetman and corresponding pipette tips. While this method is low cost and relatively easy to perform, researchers should be advised that anesthetizing the animal is required for optimal milk collection.

Milk collection from animal models facilitates various research avenues: understanding passive immunity, identifying pathogens responsible for vertical transmission and, through the use of transgenic mice, even commercial production of proteins found in human breast milk. Here we illustrate a simple method for milk collection in mice and Reeves&#8217; muntjac deer.

Animal models are commonly used throughout research laboratories to accomplish what would normally be considered impractical in a pathogen&#8217;s native ...

Collection and Analysis of Arabidopsis Phloem Exudates Using the EDTA-facilitated Method

The plant phloem is essential for the long-distance transport of (photo-) assimilates as well as of signals conveying biotic or abiotic stress. It contains sugars, amino acids, proteins, RNA, lipids and other metabolites. While there is a large interest in understanding the composition and function of the phloem, the role of many of these molecules and thus, their importance in plant development and stress response has yet to be determined. One barrier to phloem analysis lies in the fact that the phloem seals itself upon wounding. As a result, the number of plants from which phloem sap can be obtained is limited. One method that allows collection of phloem exudates from several plant species without added equipment is the EDTA-facilitated phloem exudate collection described here. While it is easy to use, it does lead to the wounding of cells and care has to be taken to remove contents of damaged cells. In addition, several controls to prove purity of the exudate are necessary. Because it is an exudation rather than a direct collection of the phloem sap (not possible in many species) only relative quantification of its contents can occur. The advantage of this method over others is that it can be used in many herbaceous or woody plant species (Perilla, Arabidopsis, poplar, etc.) and requires minimal equipment and training. It leads to reasonably large amounts of exudates that can be used for subsequent analysis of proteins, sugars, lipids, RNA, viruses and metabolites. It is simple enough that it can be used in both a research as well as in a teaching laboratory.

Collection and Analysis of Arabidopsis Phloem Exudates Using the EDTA-facilitated Method

Knowledge of the composition of the phloem sap as well as the mechanism of its loading and long-distance transport is essential for the understanding of long-distance signaling in plant development and stress/pathogen response and of assimilate transport. This manuscript describes the collection of phloem exudates using the EDTA-facilitated method.

The plant phloem is essential for the long-distance transport of (photo-) assimilates as well as of signals conveying biotic or abiotic stress. It ...

Microperfusion Technique to Investigate Regulation of Microvessel Permeability in Rat Mesentery

Experiments to measure the permeability properties of individually perfused microvessels provide a bridge between investigation of molecular and cellular mechanisms regulating vascular permeability in cultured endothelial cell monolayers and the functional exchange properties of whole microvascular beds. A method to cannulate and perfuse venular microvessels of rat mesentery and measure the hydraulic conductivity of the microvessel wall is described. The main equipment needed includes an intravital microscope with a large modified stage that supports micromanipulators to position three different microtools: (1) a beveled glass micropipette to cannulate and perfuse the microvessel; (2) a glass micro-occluder to transiently block perfusion and enable measurement of transvascular water flow movement at a measured hydrostatic pressure, and (3) a blunt glass rod to stabilize the mesenteric tissue at the site of cannulation. The modified Landis micro-occlusion technique uses red cells suspended in the artificial perfusate as markers of transvascular fluid movement, and also enables repeated measurements of these flows as experimental conditions are changed and hydrostatic and colloid osmotic pressure difference across the microvessels are carefully controlled. Measurements of hydraulic conductivity first using a control perfusate, then after re-cannulation of the same microvessel with the test perfusates enable paired comparisons of the microvessel response under these well-controlled conditions. Attempts to extend the method to microvessels in the mesentery of mice with genetic modifications expected to modify vascular permeability were severely limited because of the absence of long straight and unbranched microvessels in the mouse mesentery, but the recent availability of the rats with similar genetic modifications using the CRISPR/Cas9 technology is expected to open new areas of investigation where the methods described herein can be applied.

The modified Landis technique enables paired measurement of the hydraulic conductivity of individual microvessels in the mesentery of normal and genetically modified rats under control and test conditions using microperfusion techniques. It provides a convenient method to evaluate mechanisms that regulate microvessel permeability and transvascular exchange under physiological conditions.

Experiments to measure the permeability properties of individually perfused microvessels provide a bridge between investigation of molecular and cellular ...