We thank Dr. Moutusee Jubaida Islam and Dr. Luke Joyce for their contributions to this protocol. We would also like to recognize the University of Texas at Dallas Genome Center for their feedback and support. This work was funded by the Welch Foundation, award number AT-2030-20200401 to N.J.D., by the National Institutes of Health, award number R01AI116610 to K.P., and by the Felecia and John Cain Chair in Women&#39;s Health, held by P.E.Z.

The authors have nothing to disclose.

The comprehensive hybrid genome assembly protocol described here offers a streamlined approach for the successful culturing of diverse urinary microbiota and uropathogens, and the complete assembly of their genomes. Successful WGS of bacterial genomes begins with the isolation of diverse and sometimes fastidious microbes in order to extract their genomic DNA. To date, existing urine culture protocols either lack the necessary sensitivity to detect many urinary species or involve lengthy and extensive approaches that require extended time and resources11. The Modified Enhanced Urine Culture approach described offers a simplified yet comprehensive protocol for the successful isolation of bacteria belonging to 17 common urinary genera, including potentially pathogenic or beneficial commensal species, and both facultative and obligate aerobic or anaerobic bacteria. This in turn provides the necessary starting material for accurate sequencing and assembly of bacterial genomes and for critical phenotypic experiments, which contribute to the understanding of urinary health and disease. Furthermore, this modified culture approach provides for a more defined clinical diagnosis of viable microorganisms found in urine specimens and allows for their biobanking for future genomic studies. However, this protocol is not without limitations. It may require long incubation times depending on the organism as well as use of resources such as a hypoxia chamber or controlled incubators that may not be readily available. The use of anaerobic GasPaks offers an alternative solution but these are costly and do not always produce a sustained and controlled environment. Finally, culture bias as well as sample diversity may allow for particular organisms and uropathogens to outcompete fastidious bacteria. Despite these limitations, a culture of diverse urinary bacteria is made possible by this approach.
Genomic sequencing has gained popularity with the advancement of Next Generation Sequencing technologies which tremendously increased both the yield and accuracy of sequencing data14,15. Coupled with the development of algorithms for data processing and de novo assembly, complete genome sequences are at the fingertips of novice and expert scientists alike15,45. Knowledge of overall genome organization provided by complete genomes offers important evolutionary and biological insights, including gene duplication, gene loss, and horizontal gene transfer14. Additionally, genes important to antimicrobial resistance and virulence are often localized on mobile elements, which are typically not resolved in draft genome assemblies15,16.
The protocol herein follows a hybrid approach for the combination of sequencing data from short-read and long-read platforms to generate complete genome assemblies. While focused on urinary bacterial genomes, this procedure may be adapted to diverse bacteria from various isolation sources. Critical steps in this approach include following adequate sterile technique and utilizing appropriate media and culture conditions for the isolation of pure urinary bacteria. Furthermore, the extraction of intact, high-yield gDNA is essential for generating sequencing data free of contaminating reads that may hamper assembly success. Subsequent library preparation protocols are critical for the generation of quality reads of sufficient length and depth. Therefore, it is of utter importance to handle gDNA with care during library preparation for long-read sequencing in particular, as this technology&#39;s greatest benefit is the generation of long reads with no theoretical upper length limit. Also outlined are sections for the appropriate quality control (QC) of sequencing reads that eliminates noisy data and improves assembly outcome.
Despite successful DNA isolation, library preparation, and sequencing, the nature of genomic architecture of some species may still provide an obstacle for the generation of a closed genome assembly45,46. Repetitive sequences often complicate assembly computation and despite long read data, these regions may be resolved with low confidence, or not at all. Long reads thus have to be on average longer than the largest repeat region in the genome or coverage must be high (&#62;100x)19. Some genomes may remain incomplete and require manual approaches for completion. Nevertheless, hybrid assembled incomplete genomes are typically composed of fewer contigs than short-read draft genomes. Adjusting default parameters of the assembly algorithm or following more stringent cutoffs for read QC may help. Alternatively, one suggested approach is to map long reads to the incomplete regions in search of evidence for the most likely assembly path, and then confirm the path utilizing PCR and Sanger sequencing of the amplified region. Mapping reads using Minimap2 is suggested and Bandage offers a useful tool for the visualization of mapped reads along assembled contigs providing evidence for contig linkage47.
An additional challenge to generating complete genomes lies in familiarity and comfort with command-line tools. Many bioinformatic tools are developed to offer computational opportunities to any user; however, their utilization relies on an understanding with the basics of UNIX and programming. This protocol aims to provide sufficiently detailed instructions to enable individuals without prior command-line experience to generate closed genome assemblies and annotate them.

The urinary microbiome is an emerging area of research that has shattered a decades long misconception that the urinary tract is sterile in healthy individuals. Members of the urinary microbiota may serve to balance the urinary environment and prevent urinary tract infection (UTI)1,2. Uropathogenic bacteria invade the urinary tract and employ diverse virulence mechanisms to displace the resident microbiota, colonize the urothelium, evade immune responses and counteract environmental pressures3,4. Urine is a relatively nutrient-limited medium characterized by high osmolarity, limited nitrogen and carbohydrate availability, low oxygenation, and low pH5,6,7. Urine is also considered to be antimicrobial, composed of high concentrations of inhibitory urea and antimicrobial peptides such as the human cathelicidin LL-378. Investigating mechanisms employed by both resident bacteria and uropathogens to colonize the urinary tract is critical to further understanding urinary tract health and developing new strategies for UTI treatment. Furthermore, as the failure of front-line antimicrobial therapies becomes more common, it is increasingly important to monitor the dissemination of mobile genetic elements carrying antimicrobial resistance determinants within populations of urinary bacteria9,10.
To investigate genotypes and phenotypes of urinary bacteria, their successful culture and subsequent whole genome sequencing (WGS) is imperative. Culture-dependent methods are necessary to detect and identify viable microbes in urine samples11. Standard clinical urine culture involves plating urine onto 5% sheep blood agar (BAP) and MacConkey agar and incubating aerobically at 35 &#176;C for 24 h12. However, with a detection threshold of &#8805;105 CFU/mL13, many members of the urinary microbiota are not reported by this method. Improved culturing techniques such as Enhanced Quantitative Urine Culture (EQUC)11 employ various combinations of different urine volumes, incubation times, culture media, and atmospheric conditions to identify microbes commonly missed by standard urine culture. Described in this protocol is a modified version of EQUC, termed here Modified Enhanced Urine Culture protocol, that enables culturing of diverse urinary bacteria and uropathogens using selective media and optimal atmospheric conditions but is not inherently quantitative. The successful isolation of urinary bacteria enables the extraction of genomic DNA (gDNA) for downstream WGS and genome assembly.
Genome assemblies, complete assemblies in particular, enable the discovery of genetic factors that may contribute to colonization, niche maintenance, and virulence among both resident microbiota and uropathogenic bacteria. Draft genome assemblies contain a diverse number of contiguous sequences (contigs) that may contain sequencing errors and lack orientation information. In a complete genome assembly, both the orientation and the accuracy of every base pair have been verified14. Furthermore, obtaining complete genome sequences provides insight into genome structure, genetic diversity, and mobile genetic elements15. Short reads alone may identify the presence or absence of important genes but may not pinpoint their genomic context16. With enabling long-read sequencing technologies such as Oxford Nanopore and PacBio, generating&#160;closed de novo assemblies of bacterial genomes no longer requires strenuous methods such as manual closing of de novo assemblies by multiplex PCR17,18. The combination of Next Generation short-read sequencing and Nanopore long-read sequencing technologies allows the facile generation of accurate, complete, and closed bacterial genome assemblies at relatively low costs19. Short-read sequencing produces accurate yet fragmented genome assemblies generally consisting of an average of 40-100 contigs, while Nanopore sequencing generates long reads of about 5-100 kb in length that are less accurate but can serve as scaffolds to join contigs and resolve genomic synteny. Hybrid approaches utilizing both short-read and long-read technologies can produce accurate and complete bacterial genomes19.
Described here is a comprehensive protocol for the isolation and identification of bacteria from human urine, genomic DNA extraction, sequencing, and complete genome assembly using a hybrid assembly approach. This protocol provides a special emphasis on the steps necessary to properly modify reads generated by short-read and long-read sequencing for the accurate assembly of a closed bacterial chromosome and extrachromosomal elements such as plasmids.

<table><tbody><tr><td>&lt;strong&gt;Equipment:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Bioanalyzer 2100</td><td>Agilent</td><td>G29398A</td><td>Optional but recommended</td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>--</td><td>Any centrifuge for spinning conicals and microcentrifuge tubes (e.g. Models 5810R/5424R)</td></tr><tr><td>Electrophoresis</td><td>BioRad Laboratories</td><td>1645070</td><td></td></tr><tr><td>Gel Imaging System</td><td>BioRad Laboratories</td><td></td><td>ChemiDoc models</td></tr><tr><td>Incubator</td><td>ThermoFisher Scientific</td><td>--</td><td>Any CO&lt;sub&gt;2&lt;/sub&gt; Incubator (e.g. Thermo Forma model 3110)</td></tr><tr><td>Magnetic Rack</td><td>New England BioLabs</td><td>S15095</td><td>12-tube rack</td></tr><tr><td>MinION</td><td>Oxford Nanopore Technologies</td><td>--</td><td></td></tr><tr><td>Nanodrop</td><td>ThermoFisher Scientific</td><td>ND-ONE-W</td><td></td></tr><tr><td>NextSeq 500</td><td>Illumina</td><td>SY-415-1002</td><td>Other Illumina models are acceptable</td></tr><tr><td>Plate Reader</td><td>BioTek</td><td>--</td><td>Synergy H1</td></tr><tr><td>Qubit fluorometer</td><td>ThermoFisher Scientific</td><td>Q33238</td><td></td></tr><tr><td>Rotator</td><td>Benchmark Scientific</td><td>H2024</td><td></td></tr><tr><td>Thermocycler</td><td>ThermoFisher Scientific</td><td>--</td><td>Any thermocycler for PCR reactions (e.g. ProFlex PCR system)</td></tr><tr><td>&lt;strong&gt;Materials:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>10X Phosphate Buffered Saline (PBS)</td><td>Fisher Scientific</td><td>BP3991</td><td></td></tr><tr><td>10X TBE buffer</td><td>--</td><td>--</td><td>1M Tris,1M Boric Acid,0.2M EDTA (pH 8.0)</td></tr><tr><td>1429R primer</td><td>Sigma Aldrich (Custom oligos)</td><td>--</td><td>GGTTACCTTGTTACGACTT</td></tr><tr><td>1kb Ladder</td><td>VWR</td><td>101228-494</td><td></td></tr><tr><td>1M Tris-Cl (pH 7.5)</td><td>ThermoFisher Scientific</td><td>15567027</td><td></td></tr><tr><td>6x Loading dye</td><td>Fisher Scientific</td><td>NC0783588</td><td></td></tr><tr><td>8F primer</td><td>Sigma Aldrich (Custom oligos)</td><td>--</td><td>AGAGTTTGATCCTGGCTCAG</td></tr><tr><td>Agar</td><td>Fisher Scientific</td><td>BP1423-2</td><td></td></tr><tr><td>Agarose</td><td>BioRad Laboratories</td><td>63001</td><td></td></tr><tr><td>AMPure XP Beads</td><td>Beckman Coulter</td><td>A63880</td><td></td></tr><tr><td>Anaerobe Pouch System - GasPak EZ</td><td>BD Diagnostic Systems</td><td>B260683</td><td></td></tr><tr><td>Boric Acid</td><td>Fisher Scientific</td><td>A73-500</td><td></td></tr><tr><td>Brain Heart Infusion Broth</td><td>BD Diagnostic Systems</td><td>212304</td><td></td></tr><tr><td>CDC Anaerobe 5% Sheep Blood Agar</td><td>BD Diagnostic Systems</td><td>L007357</td><td></td></tr><tr><td>CHROMagar Orientation</td><td>BD Diagnostic Systems</td><td>PA-257481.04</td><td></td></tr><tr><td>DNeasy Blood &amp;amp; Tissue</td><td>QIAGEN</td><td>69504</td><td></td></tr><tr><td>DreamTaq Master Mix</td><td>ThermoFisher Scientific</td><td>K1081</td><td></td></tr><tr><td>Dry Anaerobic Indicator Strips</td><td>BD Diagnostic Systems</td><td>271051</td><td></td></tr><tr><td>EDTA</td><td>Fisher Scientific</td><td>S311-500</td><td></td></tr><tr><td>Ethanol 200 Proof</td><td>Sigma Aldrich</td><td>E7023</td><td>For molecular biology</td></tr><tr><td>Ethidium Bromide</td><td>ThermoFisher Scientific</td><td>BP130210</td><td></td></tr><tr><td>Flow cell priming kit</td><td>Oxford Nanopore Technologies</td><td>EXP-FLP002</td><td></td></tr><tr><td>Flow cell wash kit</td><td>Oxford Nanopore Technologies</td><td>EXP-WSH003</td><td></td></tr><tr><td>Gel Extraction Miniprep Kit</td><td>BioBasic</td><td>BS654</td><td></td></tr><tr><td>Ligation sequencing kit</td><td>Oxford Nanopore Technologies</td><td>SQK-LSK109</td><td></td></tr><tr><td>Lysozyme</td><td>Research Products International Corp</td><td>L381005.05</td><td></td></tr><tr><td>Mutanolysin</td><td>Sigma Aldrich</td><td>M9901-5KU</td><td></td></tr><tr><td>Native barcoding expansion 1-12</td><td>Oxford Nanopore Technologies</td><td>EXP-NBD104</td><td></td></tr><tr><td>NEB Blunt/TA Ligase Master Mix</td><td>New England BioLabs</td><td>M0367L</td><td></td></tr><tr><td>NEBNext FFPE DNA Repair Mix</td><td>New England BioLabs</td><td>M6630L</td><td></td></tr><tr><td>NEBNext quick ligation buffer</td><td>New England BioLabs</td><td>B6058S</td><td></td></tr><tr><td>NEBNext Ultra II End repair / dA-tailing module</td><td>New England BioLabs</td><td>E7546L</td><td></td></tr><tr><td>Nextera DNA CD Indexes</td><td>Illumina</td><td>20018708</td><td></td></tr><tr><td>Nextera DNA Flex Library Prep - (M) Tagmentation</td><td>Illumina</td><td>20018705</td><td></td></tr><tr><td>Nuclease-free water</td><td>Sigma Aldrich</td><td>W4502</td><td></td></tr><tr><td>Qubit 1X dsDNA HS Assay Kit</td><td>ThermoFisher Scientific</td><td>Q33230</td><td></td></tr><tr><td>Qubit Assay Tubes</td><td>ThermoFisher Scientific</td><td>Q32856</td><td></td></tr><tr><td>Quick T4 DNA Ligase</td><td>New England BioLabs</td><td>E6056L</td><td></td></tr><tr><td>R9 Flow cell</td><td>Oxford Nanopore Technologies</td><td>FLO-MIN106D</td><td></td></tr><tr><td>RNase A</td><td>ThermoFisher Scientific</td><td>EN0531</td><td></td></tr><tr><td>Sheep Blood</td><td>Hemostat Laboratories</td><td>DS13250</td><td></td></tr><tr><td>TE buffer</td><td>--</td><td>--</td><td>10mM Tris, 1mM EDTA (pH 8.0)</td></tr><tr><td>Triton X-100</td><td>Sigma Aldrich</td><td>T8787</td><td></td></tr><tr><td>Tryptic Soy Broth</td><td>BD Diagnostic Systems</td><td>211825</td><td></td></tr><tr><td>&lt;strong&gt;Software &amp;amp; Bioinformatic Tools:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Bandage</td><td>--</td><td>--</td><td>https://rrwick.github.io/Bandage/</td></tr><tr><td>Center for Genomic Epidemiology</td><td>--</td><td>--</td><td>http://www.genomicepidemiology.org/</td></tr><tr><td>CLC Genomics Workbench 12</td><td>QIAGEN</td><td>--</td><td></td></tr><tr><td>CRISPRcasFinder</td><td>--</td><td>--</td><td>https://crisprcas.i2bc.paris-saclay.fr/</td></tr><tr><td>FastQC</td><td>--</td><td>--</td><td>https://www.bioinformatics.babraham.ac.uk/projects/fastqc/</td></tr><tr><td>Geneious Prime</td><td>Geneious</td><td>--</td><td></td></tr><tr><td>gVolante (BUSCO)</td><td>--</td><td>--</td><td>https://gvolante.riken.jp/</td></tr><tr><td>Kbase Prokka Wrapper</td><td>--</td><td>--</td><td>https://kbase.us/applist/apps/ProkkaAnnotation/annotate_contigs/release</td></tr><tr><td>Minimap2</td><td>--</td><td>--</td><td>https://github.com/lh3/minimap2</td></tr><tr><td>MinKNOW</td><td>Oxford Nanopore Technologies</td><td>--</td><td></td></tr><tr><td>NanoFilt</td><td>--</td><td>--</td><td>https://github.com/wdecoster/nanofilt</td></tr><tr><td>NanoStat</td><td>--</td><td>--</td><td>https://github.com/wdecoster/nanostat</td></tr><tr><td>PHASTER</td><td>--</td><td>--</td><td>https://phaster.ca/</td></tr><tr><td>Prokka</td><td>--</td><td>--</td><td>https://github.com/tseemann/prokka</td></tr><tr><td>QUAST</td><td>--</td><td>--</td><td>http://quast.sourceforge.net/quast</td></tr><tr><td>Trim Galore</td><td>--</td><td>--</td><td>https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/</td></tr><tr><td>Trimmomatic</td><td>--</td><td>--</td><td>http://www.usadellab.org/cms/?page=trimmomatic</td></tr><tr><td>Unicycler</td><td>--</td><td>--</td><td>https://github.com/rrwick/Unicycler#necessary-read-length</td></tr></tbody></table>

hybrid de novo genome assembly for the generation of complete genomes of urinary bacteria using short- and long-read sequencing technologies

Complete genome sequences provide valuable data for the understanding of genetic diversity and unique colonization factors of urinary microbes. These data may include mobile genetic elements, such as plasmids and extrachromosomal phage, that contribute to the dissemination of antimicrobial resistance and further complicate treatment of urinary tract infection (UTI). In addition to providing fine resolution of genome structure, complete, closed genomes allow for the detailed comparative genomics and evolutionary analyses. The generation of complete genomes de novo has long been a challenging task due to limitations of available sequencing technology. Paired-end Next Generation Sequencing (NGS) produces high quality short reads often resulting in accurate but fragmented genome assemblies. On the contrary, Nanopore sequencing provides long reads of lower quality normally leading to error-prone complete assemblies. Such errors may hamper genome-wide association studies or provide misleading variant analysis results. Therefore, hybrid approaches combining both short and long reads have emerged as reliable methods to achieve highly accurate closed bacterial genomes. Reported herein is a comprehensive method for the culture of diverse urinary bacteria, species identification by 16S rRNA gene sequencing, extraction of genomic DNA (gDNA), and generation of short and long reads by NGS and Nanopore platforms, respectively. Additionally, this method describes a bioinformatic pipeline of quality control, assembly, and gene prediction algorithms for the generation of annotated complete genome sequences. Combination of bioinformatic tools enables the selection of high quality read data for hybrid genome assembly and downstream analysis. The streamlined approach for the hybrid de novo genome assembly described in this protocol may be adapted for the use in any culturable bacteria.

This protocol has been optimized for the culture and sequencing of urinary bacteria belonging to the genera listed in Figure 1. Not all urinary bacteria are culturable by this method. Culture media and conditions are specified by the genus in Figure 1. Exemplary gel electrophoresis assessments of gDNA integrity are depicted in Figure 2. An overview of the bioinformatics pipeline for sequencing read processing, genome assembly, and annotation is described in Figure 3. A guide for computational directory structure is provided in Figure 4 to both simplify protocol understanding and provide framework for successful organization. Furthermore, included are representative complete genomes of two Klebsiella spp., K. pneumoniae and K. oxytoca, that were generated by this protocol. A representation of these assemblies is provided in Figure 5 and also includes an additional incomplete example K. pneumoniae genome. A detailed overview of each fully annotated complete genome is shown in Figure 6. Finally, a summary of sequencing read statistics is provided in Table 1 to offer a broad understanding of raw and trimmed data sufficient for the generation of high-quality closed genome assemblies. Additionally, key parameters of the two representative complete Klebsiella spp. genomes are listed. Genomes and raw data were deposited in Genbank under the BioProject PRJNA683049.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/62872/62872fig01.jpg" /> 
Figure 1: Modified enhanced urine culture of diverse urinary genera. Chart for the agar and liquid broth that may be used to culture diverse urinary genera. All culturing is suggested to be performed at 35 &#176;C as described in subsection 1.1. Circles represent media appropriate for culturing a particular genus, colors were arbitrarily selected to distinguish one media type from another. CDC-AN BAP (red), CDC Anaerobe Sheep Blood Agar; 5% Sheep-BAP (orange), Sheep Blood Agar; BHI (green), Brain Heart Infusion; TSB (yellow), Tryptic Soy Broth; CHROMagar Orientation (blue). aGardnerella vaginalis should be cultured on HBT Bilayer G. vaginalis Selective agar in microaerophilic atmosphere and under special broth culture requirements44. bLactobacillus iners should be cultured on 5% Rabbit-BAP plates and NYCIII broth in microaerophilic atmosphere. cLactobacillus spp. may be cultured on MRS in microaerophilic conditions. <a href="https://www.jove.com/files/ftp_upload/62872/62872fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/62872/62872fig02.jpg" /> 
Figure 2: Genomic DNA extraction agarose gel images. Representative gel images depicting gDNA extraction outcomes. (A) Lane 1: 1 kb ladder, Lane 2: intact gDNA representing successful extraction, Lane 3: smearing indicating fragmented gDNA. (B) Lane 1: 1 kb ladder, Lanes 2 &#38; 3: rRNA contamination denoted by two bands between 1.5 kb and 3 kb. <a href="https://www.jove.com/files/ftp_upload/62872/62872fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62872/62872fig03.jpg" /> 
Figure 3: Hybrid genome assembly workflow. Schematic of steps from read quality control and pre-processing to assembly annotation. Read trimming removes ambiguous and low-quality reads. Q-score and length parameters are indicated and represent the reads that are retained. Assembly utilizes both short and long reads to generate a hybrid de novo genome assembly. Assembly quality is evaluated based on completeness and correctness using specified tools and parameters. The final genome assembly is annotated for all genes and specific loci of interest. <a href="https://www.jove.com/files/ftp_upload/62872/62872fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/62872/62872fig4v2.jpg" /> 
Figure 4: Bioinformatics directory structure guide. A schematic of recommended directory and file organization for the processing of short and long reads, hybrid assembly, and genome annotation and QC. Key command-line data processing steps are highlighted next to corresponding files and directories. Eliciting commands and flags (bold), input files (blue), output files or directories (red), user input such as file naming convention (magenta). <a href="https://www.jove.com/files/ftp_upload/62872/62872fig4v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/62872/62872fig05.jpg" /> 
Figure 5: Genome assembly graphs by Bandage. Representative complete genome assembly graphs of (A) Klebsiella oxytoca KoPF10 and (B) Klebsiella pneumoniae KpPF25 and incomplete genome assembly of (C) Klebsiella pneumoniae KpPF46. The complete genome of KoPF10 demonstrates a single closed chromosome and the complete genome of KpPF25 consists of a closed chromosome and five closed plasmids. The incomplete chromosome of KpPF46 consists of two interconnected contigs. Unicycler hybrid de novo assembly generates an assembly graph that is visualized by Bandage. The assembly graph provides a simplistic schematic of the genome, indicating closed chromosome or plasmids by a linker connecting two ends of a single contig. The presence of more than one interconnected contig indicates incomplete assembly. Contig size and depth can be noted in Bandage as well. <a href="https://www.jove.com/files/ftp_upload/62872/62872fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/62872/62872fig06.jpg" /> 
Figure 6: Complete genome maps of annotated hybrid assemblies. Assembly maps generated by Geneious Prime for the complete genome of (A) K. oxytoca KoPF10 and (B) K. pneumoniae KpPF25 showing annotated genes denoted by colored arrows along plasmid backbones. Chromosomes only show rRNA and tRNA genes for simplicity. Genome annotations were performed using Prokka as indicated in section 10 of this protocol. <a href="https://www.jove.com/files/ftp_upload/62872/62872fig06large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Table 1" class="xfigimg" src="/files/ftp_upload/62872/62872table1.jpg" /> 
Table 1: Representative Klebsiella spp. complete assembly characteristics. Assembly parameters of K. oxytoca strain KoPF10 and K. pneumoniae strain KpPF25. Accession numbers for the deposited data on NCBI are provided. Number of reads both prior to and after trimming are specified for both sequencing technologies. N50 is provided for long reads only since short reads are of a controlled length. Plasmid replicon predicted using PlasmidFinder v2.1 Enteroebacteriaceae database with parameters set to 80% identity and 60% length.&#160;a MLST, Multilocus Sequence Type. b CDS, Coding Sequences. c Plasmid replicon predicted using PlasmidFinder v2.1 Enterobacteriaceae database with parameters set to 80% identity and 60% length. d Oxford Nanopore Technologies (ONT) deposited read data. e Illumina deposited read data.&#160;<a href="https://www.jove.com/files/ftp_upload/62872/Table 1_Sharon_JoVE_Revised.xlsx" target="_blank">Please click here to download this Table.</a>

Watch this Scientific Journal Video about Hybrid De Novo Genome Assembly for the Generation of Complete Genomes of Urinary Bacteria using Short- and Long-read Sequencing Technologies at JoVE.com

Hybrid De Novo Genome Assembly for the Generation of Complete Genomes of Urinary Bacteria using Short- and Long-read Sequencing Technologies

This protocol details a comprehensive approach for the culturing, sequencing, and de novo hybrid genome assembly of urinary bacteria. It provides a reproducible procedure for the generation of complete, circular genome sequences useful in studying both chromosomal and extrachromosomal genetic elements contributing to urinary colonization, pathogenesis, and antimicrobial resistance dissemination.

Hybrid De Novo Genome Assembly for the Generation of Complete Genomes of Urinary Bacteria using Short- and Long-read Sequencing Technologies

Complete genome sequences provide valuable data for the understanding of genetic diversity and unique colonization factors of urinary microbes. These data ...

hybrid-de-novo-genome-assembly-for-generation-complete-genomes

Research

JoVE Journal

Genetics

5.0K Views.  University of Texas at Dallas. Dit uitgebreide protocol instrueert hoe nauwe genomen van diverse urinebacteriën kunnen worden gegenereerd en stelt lezers zonder codeerervaring in staat om terminalgebaseerde genoomassemblage- en analysepijplijnen met succes te implementeren. Complete genoomassemblages maken de ontdekking mogelijk van genen die bijdragen aan kolonisatie en virulentie bij commensale en uropathogene bacteriën. Close genomes geven inzicht in genoomarchitectuur en mobiele genetische elementen.De hybride...

Video: Hybrid De Novo Genome Assembly for the Generation of Complete Genomes of Urinary Bacteria using Short- and Long-read Sequencing Technologies

Ultralow Input Genome Sequencing Library Preparation from a Single Tardigrade Specimen

Tardigrades are microscopic animals that enter an ametabolic state called anhydrobiosis when facing desiccation and can return to their original state when water is supplied. The genomic sequencing of microscopic animals such as tardigrades risks bacterial contamination that sometimes leads to erroneous interpretations, for example, regarding the extent of horizontal gene transfer in these animals. Here, we provide an ultralow input method to sequence the genome of the tardigrade, Hypsibius dujardini, from a single specimen. By employing rigorous washing and contaminant exclusion along with an efficient extraction of the 50 ~ 200 pg genomic DNA from a single individual, we constructed a library sequenced with a DNA sequencing instrument. These libraries were highly reproducible and unbiased, and an informatics analysis of the sequenced reads with other H. dujardini genomes showed a minimal amount of contamination. This method can be applied to unculturable tardigrades that could not be sequenced using previous methods.

Contamination during the genomic sequencing of microscopic organisms remains a large problem. Here, we show a method to sequence the genome of a tardigrade from a single specimen with as little as 50 pg of genomic DNA without whole genome amplification to minimize the risk of contamination.

Tardigrades are microscopic animals that enter an ametabolic state called anhydrobiosis when facing desiccation and can return to their original state ...

Novel Sequence Discovery by Subtractive Genomics

Subtractive genomics can be used in any research where the goal is to identify the sequence of a gene, protein, or general region that is embedded in a larger genomic context. Subtractive genomics enables a researcher to isolate a target sequence of interest (T) by comprehensive sequencing and subtracting out known genetic elements (reference, R). The method can be used to identify novel sequences such as mitochondria, chloroplasts, viruses, or germline restricted chromosomes, and is particularly useful when T cannot be easily isolated from R. Beginning with the comprehensive genomic data (R + T), the method uses Basic Local Alignment Search Tool (BLAST) against a reference sequence, or sequences, to remove the matching known sequences (R), leaving behind the target (T). For subtraction to work best, R should be a relatively complete draft that is missing T. Since sequences remaining after subtraction are tested through quantitative Polymerase Chain Reaction (qPCR), R does not need to be complete for the method to work. Here we link computational steps with experimental steps into a cycle that can be iterated as needed, sequentially removing multiple reference sequences and refining the search for T. The advantage of subtractive genomics is that a completely novel target sequence can be identified even in cases in which physical purification is difficult, impossible, or expensive. A drawback of the method is finding a suitable reference for subtraction and obtaining T-positive and negative samples for qPCR testing. We describe our implementation of the method in the identification of the first gene from the germline-restricted chromosome of zebra finch. In that case computational filtering involved three references (R), sequentially removed over three cycles: an incomplete genomic assembly, raw genomic data, and transcriptomic data.

The purpose of this protocol is to use a combination of computational and bench research to find novel sequences that cannot be easily separated from a co-purifying sequence, which may be only partially known.

Subtractive genomics can be used in any research where the goal is to identify the sequence of a gene, protein, or general region that is embedded in a ...

Forward Genetic Approaches in Chlamydia trachomatis

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its intractability to experimental transformation with recombinant DNA. We developed an approach to perform genetic analysis in C. trachomatis&#160;despite the lack of molecular genetic tools. Our method involves: i.) chemical mutagenesis to rapidly generate comprehensive libraries of genetically-defined mutants with distinct phenotypes; ii.) whole-genome sequencing (WGS) to map the underlying genetic lesions and to find associations between mutated gene(s) and a common phenotype; iii.) generation of recombinant strains through co-infection of mammalian cells with mutant and wild type bacteria. Accordingly, we were able to establish causal relationships between genotypes and phenotypes. The coupling of chemically-induced gene variation and WGS to establish correlative genotype&#8211;phenotype associations should be broadly applicable to the large list of medically and environmentally important microorganisms currently intractable to genetic analysis.

Forward Genetic Approaches in Chlamydia trachomatis

We describe a methodology to perform genetic analysis in Chlamydia based on chemical mutagenesis and whole genome sequencing. In addition, a system for DNA exchange within infected cells is described that can be used for genetic mapping. This method may be broadly applicable to microbial systems lacking transformation systems and molecular genetic tools.

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its ...

Immunology and Infection

Validating Whole Genome Nanopore Sequencing, using Usutu Virus as an Example

Whole genome sequencing can be used to characterize and to trace viral outbreaks. Nanopore-based whole genome sequencing protocols have been described for several different viruses. These approaches utilize an overlapping amplicon-based approach which can be used to target a specific virus or group of genetically related viruses. In addition to confirmation of the virus presence, sequencing can be used for genomic epidemiology studies, to track viruses and unravel origins, reservoirs and modes of transmission. For such applications, it is crucial to understand possible effects of the error rate associated with the platform used. Routine application in clinical and public health settings require that this is documented with every important change in the protocol. Previously, a protocol for whole genome Usutu virus sequencing on the nanopore sequencing platform was validated (R9.4 flowcell) by direct comparison to Illumina sequencing. Here, we describe the method used to determine the required read coverage, using the comparison between the R10 flow cell and Illumina sequencing as an example.

We previously validated a protocol for amplicon-based whole genome Usutu virus (USUV) sequencing on a nanopore sequencing platform. Here, we describe the methods used in more detail and determine the error rate of the nanopore R10 flow cell.

Whole genome sequencing can be used to characterize and to trace viral outbreaks. Nanopore-based whole genome sequencing protocols have been described for ...

An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of cellular heterogeneity in biological systems. However, single-cell sequencing of large populations has been hampered by limitations in processing genomes for sequencing. In this paper, we describe a method for single-cell genome sequencing (SiC-seq) which uses droplet microfluidics to isolate, amplify, and barcode the genomes of single cells. Cell encapsulation in microgels allows the compartmentalized purification and tagmentation of DNA, while a microfluidic merger efficiently pairs each genome with a unique single-cell oligonucleotide barcode, allowing &gt;50,000 single cells to be sequenced per run. The sequencing data is demultiplexed by barcode, generating groups of reads originating from single cells. As a high-throughput and low-bias method of single-cell sequencing, SiC-seq will enable a broader range of genomic studies targeted at diverse cell populations.

Single-cell sequencing reveals genotypic heterogeneity in biological systems, but current technologies lack the throughput necessary for the deep profiling of community composition and function. Here, we describe a microfluidic workflow for sequencing &gt;50,000 single-cell genomes from diverse cell populations.

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of ...

Bioengineering

Ultra-long Read Sequencing for Whole Genomic DNA Analysis

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes and analysis of complex structural variants. Nanopore platforms perform single-molecule sequencing by directly measuring the current changes mediated by DNA passage through the pores and can generate hundreds of kilobase (kb) reads with minimal capital cost. This platform has been adopted by many researchers for a variety of applications. Achieving longer sequencing read lengths is the most critical factor to leverage the value of nanopore sequencing platforms. To generate ultra-long reads, special consideration is required to avoid DNA breakages and gain efficiency to generate productive sequencing templates. Here, we provide the detailed protocol of ultra-long DNA sequencing including high molecular weight (HMW) DNA extraction from fresh or frozen cells, library construction by mechanical shearing or transposase fragmentation, and sequencing on a nanopore device. From 20-25 &#181;g of HMW DNA, the method can achieve N50 read length of 50-70 kb with mechanical shearing and N50 of 90-100 kb read length with transposase mediated fragmentation. The protocol can be applied to DNA extracted from mammalian cells to perform whole genome sequencing for the detection of structural variants and genome assembly. Additional improvements on the DNA extraction and enzymatic reactions will further increase the read length and expand its utility.

Long-read sequences greatly facilitate the assembly of complex genomes and characterization of structural variation. We describe a method to generate ultra-long sequences by nanopore-based sequencing platforms. The approach adopts an optimized DNA extraction followed by modified library preparations to generate hundreds of kilobase reads with moderate coverage from human cells.

Third generation single-molecule DNA sequencing technologies offer significantly longer read length that can facilitate the assembly of complex genomes ...

Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

Here we outline a next-generation RNA sequencing protocol that enables de novo assemblies and intra-host variant calls of viral genomes collected from clinical and biological sources. The method is unbiased and universal; it uses random primers for cDNA synthesis and requires no prior knowledge of the viral sequence content. Before library construction, selective RNase H-based digestion is used to deplete unwanted RNA &#8212; including poly(rA) carrier and ribosomal RNA &#8212; from the viral RNA sample. Selective depletion improves both the data quality and the number of unique reads in viral RNA sequencing libraries. Moreover, a transposase-based &#39;tagmentation&#39; step is used in the protocol as it reduces overall library construction time. The protocol has enabled rapid deep sequencing of over 600 Lassa and Ebola virus samples-including collections from both blood and tissue isolates-and is broadly applicable to other microbial genomics studies.

This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

Here we outline a next-generation RNA sequencing protocol that enables de novo assemblies and intra-host variant calls of viral genomes collected from ...

Medicine

Isolation of Single Intracellular Bacterial Communities Generated from a Murine Model of Urinary Tract Infection for Downstream Single-cell Analysis

In this article, we outline a procedure used to isolate individual intracellular bacterial communities from a mouse that has been experimentally infected in the urinary tract. The protocol can be broadly divided into three sections: the infection, bladder epithelial cell harvesting, and mouth micropipetting to isolate individual infected epithelial cells. The isolated epithelial cell contains viable bacterial cells and is nearly free of contaminating extracellular bacteria, making it ideal for downstream single-cell analysis. The time taken from the start of infection to obtaining a single intracellular bacterial community is about 8 h. This protocol is inexpensive to deploy and uses widely available materials, and we anticipate that it can also be utilized in other infection models to isolate single infected cells from cell mixtures even if those infected cells are rare. However, due to a potential risk in mouth micropipetting, this procedure is not recommended for highly infectious agents.

This protocol describes a simple method of isolating single, infected-bladder epithelial cells from a murine model of urinary tract infection.

In this article, we outline a procedure used to isolate individual intracellular bacterial communities from a mouse that has been experimentally infected ...

Purifying the Impure: Sequencing Metagenomes and Metatranscriptomes from Complex Animal-associated Samples

The accessibility of high-throughput sequencing has revolutionized many fields of biology. In order to better understand host-associated viral and microbial communities, a comprehensive workflow for DNA and RNA extraction was developed. The workflow concurrently generates viral and microbial metagenomes, as well as metatranscriptomes, from a single sample for next-generation sequencing. The coupling of these approaches provides an overview of both the taxonomical characteristics and the community encoded functions. The presented methods use Cystic Fibrosis (CF) sputum, a problematic sample type, because it is exceptionally viscous and contains high amount of mucins, free neutrophil DNA, and other unknown contaminants. The protocols described here target these problems and successfully recover viral and microbial DNA with minimal human DNA contamination. To complement the metagenomics studies, a metatranscriptomics protocol was optimized to recover both microbial and host mRNA that contains relatively few ribosomal RNA (rRNA) sequences. An overview of the data characteristics is presented to serve as a reference for assessing the success of the methods. Additional CF sputum samples were also collected to (i) evaluate the consistency of the microbiome profiles across seven consecutive days within a single patient, and (ii) compare the consistency of metagenomic approach to a 16S ribosomal RNA gene-based sequencing. The results showed that daily fluctuation of microbial profiles without antibiotic perturbation was minimal and the taxonomy profiles of the common CF-associated bacteria were highly similar between the 16S rDNA libraries and metagenomes generated from the hypotonic lysis (HL)-derived DNA. However, the differences between 16S rDNA taxonomical profiles generated from total DNA and HL-derived DNA suggest that hypotonic lysis and the washing steps benefit in not only removing the human-derived DNA, but also microbial-derived extracellular DNA that may misrepresent the actual microbial profiles.

Using the cystic fibrosis airway as an example, the manuscript presents a comprehensive workflow comprising a combination of metagenomic and metatranscriptomic approaches to characterize the microbial and viral communities in animal-associated samples.

The accessibility of high-throughput sequencing has revolutionized many fields of biology. In order to better understand host-associated viral and ...

Biology

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information.

We describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs for characterization of bacterial communities using 16S rRNA gene amplicon sequencing. The method allows for a common processing approach for multiple sample types and accommodates a number of downstream analytic processes.

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...

Hybrid De Novo Genome Assembly for the Generation of Complete Genomes of Urinary Bacteria using Short- and Long-read Sequencing Technologies

Samenvatting

Meer video's verkennen