We wish to acknowledge the labs in the C. elegans community who developed and shared the tools and whose work is cited in this manuscript. Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). This work was supported by a Canadian Institutes of Health Research (CIHR) Project grant to A.L.S. (PJT-175245). C.L. is supported by a Natural Sciences and Engineering Research Council of Canada (NSERC) postgraduate scholarship (PGS-D).

Epigenetic Inheritance and ChIP in Caenorhabditis elegans

<ol>
	<li>Alcazar, R. M., Lin, R., Fire, A. Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmission+dynamics+of+heritable+silencing+induced+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Transmission dynamics of heritable silencing induced by double-stranded RNA in Caenorhabditis elegans.</a> Genetics. 180 (3), 1275-1288 (2008).</li><li>Ashe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+can+trigger+a+multigenerational+epigenetic+memory+in+the+germline+of+C.+elegans.">piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans.</a> Cell. 150 (1), 88-99 (2012).</li><li>Buckley, B. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+nuclear+Argonaute+promotes+multigenerational+epigenetic+inheritance+and+germline+immortality.">A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality.</a> Nature. 489 (7416), 447-451 (2012).</li><li>Vastenhouw, N. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+gene+silencing+by+RNAi.">Long-term gene silencing by RNAi.</a> Nature. 442 (7105), 882 (2006).</li><li>Lee, H. -. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C.+elegans+piRNAs+mediate+the+genome-wide+surveillance+of+germline+transcripts.">C. elegans piRNAs mediate the genome-wide surveillance of germline transcripts.</a> Cell. 150 (1), 78-87 (2012).</li><li>Luteijn, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extremely+stable+Piwi-induced+gene+silencing+in+Caenorhabditis+elegans.">Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans.</a> The EMBO Journal. 31 (16), 3422-3430 (2012).</li><li>Sapetschnig, A., Sarkies, P., Lehrbach, N. J., Miska, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tertiary+siRNAs+mediate+paramutation+in+C.+elegans.">Tertiary siRNAs mediate paramutation in C. elegans.</a> PLoS Genetics. 11 (3), e1005078 (2015).</li><li>Shirayama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+initiate+an+epigenetic+memory+of+nonself+RNA+in+the+C.+elegans+germline.">piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.</a> Cell. 150 (1), 65-77 (2012).</li><li>Minkina, O., Hunter, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+heritable+germline+silencing+directs+somatic+silencing+at+an+endogenous+locus.">Stable heritable germline silencing directs somatic silencing at an endogenous locus.</a> Molecular Cell. 65 (4), 659-670 (2017).</li><li>Seroussi, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanisms+of+epigenetic+regulation+by+C.+elegans+nuclear+RNA+interference+pathways.">Mechanisms of epigenetic regulation by C. elegans nuclear RNA interference pathways.</a> Seminars in Cell &amp; Developmental Biology. 127, 142-154 (2022).</li><li>Lev, I., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=H3K9me3+is+required+for+inheritance+of+small+RNAs+that+target+a+unique+subset+of+newly+evolved+genes.">H3K9me3 is required for inheritance of small RNAs that target a unique subset of newly evolved genes.</a> eLife. 8, e40448 (2019).</li><li>Woodhouse, R. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+modifiers+SET-25+and+SET-32+are+required+for+establishment+but+not+long-term+maintenance+of+transgenerational+epigenetic+inheritance.">Chromatin modifiers SET-25 and SET-32 are required for establishment but not long-term maintenance of transgenerational epigenetic inheritance.</a> Cell Reports. 25 (8), 2259-2272 (2018).</li><li>Houri-Zeevi, L., Teichman, G., Gingold, H., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stress+resets+ancestral+heritable+small+RNA+responses.">Stress resets ancestral heritable small RNA responses.</a> eLife. 10, e65797 (2021).</li><li>Houri-Ze'evi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+tunable+mechanism+determines+the+duration+of+the+transgenerational+small+RNA+inheritance+in+C.+elegans.">A tunable mechanism determines the duration of the transgenerational small RNA inheritance in C. elegans.</a> Cell. 165 (1), 88-99 (2016).</li><li>Spracklin, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RNAi+inheritance+machinery+of+Caenorhabditis+elegans.">The RNAi inheritance machinery of Caenorhabditis elegans.</a> Genetics. 206 (3), 1403-1416 (2017).</li><li>Perales, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transgenerational+epigenetic+inheritance+is+negatively+regulated+by+the+HERI-1+chromodomain+protein.">Transgenerational epigenetic inheritance is negatively regulated by the HERI-1 chromodomain protein.</a> Genetics. 210 (4), 1287-1299 (2018).</li><li>Shukla, A., Perales, R., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=piRNAs+coordinate+poly(UG)+tailing+to+prevent+aberrant+and+perpetual+gene+silencing.">piRNAs coordinate poly(UG) tailing to prevent aberrant and perpetual gene silencing.</a> Current Biology. 31 (20), 4473-4485 (2021).</li><li>Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse+GeneticsWormBook:+the+Online+Review+of+C.+elegans+Biology.">Reverse GeneticsWormBook: the Online Review of C. elegans Biology.</a> WormBook. , (2006).</li><li>Rivera Gomez, K., Schvarzstein, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization+of+nematodes+for+live+imaging+using+an+agarose+pad+produced+with+a+Vinyl+Record.">Immobilization of nematodes for live imaging using an agarose pad produced with a Vinyl Record.</a> microPublication Biology. 2018, (2018).</li><li>Stiernagle, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maintenance+of+C.+elegans.">Maintenance of C. elegans.</a> WormBook: The Online Review of C. Elegans Biology. , 1-11 (2006).</li><li>Askjaer, P., Ercan, S., Meister, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modern+techniques+for+the+analysis+of+chromatin+and+nuclear+organization+in+C.+elegans.">Modern techniques for the analysis of chromatin and nuclear organization in C. elegans.</a> WormBook: the Online Review of C. elegans Biology. , 1-35 (2014).</li><li>Gu, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amplification+of+siRNA+in+Caenorhabditis+elegans+generates+a+transgenerational+sequence-targeted+histone+H3+lysine+9+methylation+footprint.">Amplification of siRNA in Caenorhabditis elegans generates a transgenerational sequence-targeted histone H3 lysine 9 methylation footprint.</a> Nature Genetics. 44 (2), 157-164 (2012).</li><li>Kalinava, N., Ni, J. Z., Peterman, K., Chen, E., Gu, S. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoupling+the+downstream+effects+of+germline+nuclear+RNAi+reveals+that+H3K9me3+is+dispensable+for+heritable+RNAi+and+the+maintenance+of+endogenous+siRNA-mediated+transcriptional+silencing+in+Caenorhabditis+elegans.">Decoupling the downstream effects of germline nuclear RNAi reveals that H3K9me3 is dispensable for heritable RNAi and the maintenance of endogenous siRNA-mediated transcriptional silencing in Caenorhabditis elegans.</a> Epigenetics &amp; Chromatin. 10, 6 (2017).</li><li>Kalinava, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=elegans+heterochromatin+factor+SET-32+plays+an+essential+role+in+transgenerational+establishment+of+nuclear+RNAi-mediated+epigenetic+silencing.">elegans heterochromatin factor SET-32 plays an essential role in transgenerational establishment of nuclear RNAi-mediated epigenetic silencing.</a> Cell Reports. 25 (8), 2273-2284 (2018).</li><li>Lev, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MET-2-dependent+H3K9+methylation+suppresses+transgenerational+small+RNA+inheritance.">MET-2-dependent H3K9 methylation suppresses transgenerational small RNA inheritance.</a> Current Biology. 27 (8), 1138-1147 (2017).</li><li>Kamath, R. S., Martinez-Campos, M., Zipperlen, P., Fraser, A. G., Ahringer, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effectiveness+of+specific+RNA-mediated+interference+through+ingested+double-stranded+RNA+in+Caenorhabditis+elegans.">Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans.</a> Genome Biology. 2 (1), (2001).</li><li>Xu, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cytoplasmic+Argonaute+protein+promotes+the+inheritance+of+RNAi.">A cytoplasmic Argonaute protein promotes the inheritance of RNAi.</a> Cell Reports. 23 (8), 2482-2494 (2018).</li><li>Grishok, A., Tabara, H., Mello, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+requirements+for+inheritance+of+RNAi+in+C.+elegans.">Genetic requirements for inheritance of RNAi in C. elegans.</a> Science. 287 (5462), 2494-2497 (2000).</li><li>Houri-Zeevi, L., Korem Kohanim, Y., Antonova, O., Rechavi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three+rules+explain+transgenerational+small+RNA+inheritance+in+C.+elegans.">Three rules explain transgenerational small RNA inheritance in C. elegans.</a> Cell. 182 (5), 1186-1197 (2020).</li><li>Burton, N. O., Burkhart, K. B., Kennedy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nuclear+RNAi+maintains+heritable+gene+silencing+in+Caenorhabditis+elegans.">Nuclear RNAi maintains heritable gene silencing in Caenorhabditis elegans.</a> Proceedings of the National Academy of Sciences. 108 (49), 19683-19688 (2011).</li><li>Mao, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Nrde+pathway+mediates+small-RNA-directed+histone+H3+lysine+27+trimethylation+in+Caenorhabditis+elegans.">The Nrde pathway mediates small-RNA-directed histone H3 lysine 27 trimethylation in Caenorhabditis elegans.</a> Current Biology. 25 (18), 2398-2403 (2015).</li><li>Landt, S. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+guidelines+and+practices+of+the+ENCODE+and+modENCODE+consortia.">ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia.</a> Genome Research. 22 (9), 1813-1831 (2012).</li><li>Mukhopadhyay, A., Deplancke, B., Walhout, A. J. M., Tissenbaum, H. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+(ChIP)+coupled+to+detection+by+quantitative+real-time+PCR+to+study+transcription+factor+binding+to+DNA+in+Caenorhabditis+elegans.">Chromatin immunoprecipitation (ChIP) coupled to detection by quantitative real-time PCR to study transcription factor binding to DNA in Caenorhabditis elegans.</a> Nature Protocols. 3 (4), 698-709 (2008).</li></ol>

All authors confirm that they do not have any conflicts to disclose.

In this protocol, dsRNA is introduced by feeding, which has become a standard method in C. elegans18. For RNAi inheritance assays, the feeding approach provides an easy method to obtain a large P0&#160;population2,11,12,22,23,24,25. However, the timing and duration of RNAi exposure affects the efficacy of transgene silencing26, and the concentration of RNAi bacteria affects the persistence of heritable RNAi silencing1. Therefore, standardized RNAi bacteria and worm growth are important to obtain a consistent level of GFP silencing and duration of inheritance. Here, embryos are plated on RNAi plates so that P0 animals are exposed to RNAi bacteria from hatching. Alternative approaches have plated synchronized L124,27 or L425 stage animals onto RNAi-NGM plates. In addition, since starvation and other stresses affect the maintenance of RNAi inheritance13, plates must be monitored to prevent overcrowding and exhaustion of the food supply. As an alternative to initiating RNAi by feeding, some of the pioneer C. elegans RNAi inheritance studies induced RNAi through gonad injection, which provides a greater control of dsRNA concentration1,28.
In this protocol, each generation is passaged as a population with alkaline hypochlorite treatment, as previously described16,22,23,24. Hypochlorite treatment ensures the F1 generation will not be contaminated with RNAi bacteria from the parental environment22 and prevents potential undesired population bottle-necking. However, bulk passaging may also be a limitation, since individual animals may have distinct inheritance patterns1,29. An alternative method to establish each generation is to select individual animals1,2,9,11,25. This approach allows for tracking phenotypes within lineages and the incorporation of genetic crosses. Lineage analysis may also be advantageous for low penetrance phenotypes12.
Fluorescent protein expression is a powerful and convenient readout of RNAi-induced silencing2,3,4,12,14,15,16,25,30. As described in this protocol, GFP expression can be manually scored as ON or OFF11,12,15,16,25. Manual scoring can be further refined by assigning qualitative intensity levels3,4,14. Alternatively, automated intensity scoring of microscopy images11,12,14,25,27 or flow cytometry fluorescence measurement of live animals2 can provide a quantitative and high-throughput readout. However, since the reporter expression is restricted to the germline, a caveat of automated approaches is that they must also differentiate between animals with silenced GFP expression versus animals with no germline, especially if the study incorporates mutants with abnormal germline development. As an alternative to GFP fluorescence, reverse transcription (RT)-qPCR can be used to quantify RNAi target pre-mRNA and mRNA levels2,16,23,24. This approach provides a more direct readout of silencing, which targets RNA, and is especially useful for other RNAi targets where silencing does not produce a visible phenotype. A limitation of using artificial GFP reporters is that exogenous and endogenous sequences are differentially regulated in transgenerational RNAi11. Studies with endogenous targets, such as the temperature-sensitive embryonic lethal allele oma-1(zu405)1,11,16,25, should therefore be considered as a complementary approach to fluorescent transgene reporters.
The analysis of ChIP in the context of RNAi inheritance assays requires comparison between treatments and replicates. First, to account for differences in starting material between samples, the ChIP signal is normalized to Input signal at the same locus as the &#39;percentage of Input&#39;. Processing a histone H3 ChIP in parallel will help to determine whether any histone modification alterations correspond with changes in nucleosome density. In addition, because ChIP is a multi-step process, the efficiency may vary between samples. The selection of appropriate positive and negative control loci is useful to evaluate and compare the signal-to-noise ratio among samples and experiments. In addition, to facilitate comparisons between samples, the ChIP DNA qPCR threshold cycle values at the RNAi target are often normalized to a control locus3,11,15,23,30,31. To evaluate the effects of the RNAi treatment, the ratio of the ChIP signal in treatment RNAi versus control or no RNAi conditions is also compared. A limitation of the current approach is that ChIP is performed with whole animals, while the response to RNAi treatment may be unique to the germline. An approach to overcome this caveat is to perform ChIP using isolated germline nuclei. Additional technical considerations for optimizing ChIP have also been discussed extensively elsewhere32,33.
Overall, this RNAi inheritance and ChIP protocol provides a detailed and easy-to-adapt foundation that can be integrated with other techniques to further explore transgenerational epigenetic regulation. For example, high throughput sequencing libraries can be constructed from the ChIP DNA (ChIP-seq) for a more detailed view of the chromatin landscape both proximal to the RNAi target and on a genome-wide scale.

Epigenetic inheritance allows the transmission of gene regulatory information across generations and can therefore allow the environment or experiences of parents to affect their progeny. In C. elegans, germline gene silencing initiated by exogenous double-stranded RNA (dsRNA) can be inherited for multiple generations in progeny not exposed to the original trigger1,2,3,4. This process, termed RNA interference (RNAi) inheritance, is one of several related epigenetic silencing phenomena in C. elegans, including piRNA-initiated multigenerational silencing2,5, paramutation/RNAe (RNA-induced epigenetic silencing)6,7,8, and multicopy array-initiated silencing9, which have overlapping but distinct requirements for small RNA and chromatin regulation machinery. In C. elegans exogenous RNAi, dsRNA is processed into small interfering RNAs (siRNAs) that act in a complex with primary Argonaute proteins to recognize their target mRNA. This targeting leads to the amplification of secondary siRNAs that associate with secondary Argonautes to silence target mRNA through both cytoplasmic and nuclear silencing pathways. For germline-expressed RNAi targets, the nuclear secondary Argonaute HRDE-1 and additional nuclear RNAi factors target nascent transcripts, resulting in transcriptional repression and recruitment of histone methyltransferases to deposit repressive chromatin marks, including H3K9me310. Histone H3K9me3 promotes the establishment of heritable silencing of germline-expressed green fluorescent protein (GFP) transgenes by RNAi inheritance11,12.
The goal of this protocol is to use a transgene expressing a GFP-histone fusion protein in the germline as a reporter for RNAi inheritance and to assay changes in histone modifications at the reporter transgene locus using chromatin immunoprecipitation and quantitative polymerase chain reaction (ChIP-qPCR). This protocol describes a standardized plate-based RNAi feeding approach to initiate reporter silencing. It also provides a detailed timeline for passaging animals between generations by isolating in utero embryos from gravid adults by alkaline hypochlorite treatment (&#39;bleaching&#39;). Methods and representative data for monitoring the frequency of GFP silencing in a subset of the population by fluorescence microscopy and for histone H3K9me3 ChIP-qPCR are also described. Reporter-based RNAi inheritance assays provide a highly tractable system to functionally dissect the roles of genetic and environmental factors in epigenetic regulation13,14, and genetic screens using such reporters have identified both genes that are required for2,3,15 and genes that negatively regulate16,17 the duration of transgenerational epigenetic inheritance.

<table><tbody><tr><td>Agarose</td><td>Bioshop</td><td>AGA002</td><td></td></tr><tr><td>Ampicillin</td><td>Bioshop</td><td>AMP201</td><td>Make a 100 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &amp;deg;C.</td></tr><tr><td>Anti-H3K9me3 Rabbit Polyclonal Antibody</td><td>Abcam</td><td>ab8898</td><td>Concentration is batch-dependent (0.9 - 1 mg/mL).</td></tr><tr><td>Anti-Histone H3 Rabbit Polyclonal Antibody</td><td>Abcam</td><td>ab1791</td><td>Concentration is batch-dependent (0.7 - 1 mg/mL).</td></tr><tr><td>Bleach (6% Sodium hypochlorite)</td><td>Lavo</td><td>02358107</td><td></td></tr><tr><td>&lt;em&gt;C. elegans&lt;/em&gt; strain with GFP RNAi Reporter</td><td>NA</td><td>SX1263</td><td>Sapetschnig et al. 2015 (ref. 7). A gift from E. Miska lab, University of Cambridge.</td></tr><tr><td>Carbenicillin</td><td>BioShop</td><td>CAR544</td><td>Make a 25 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &amp;deg;C.</td></tr><tr><td>Dynabeads Protein G Magnetic Beads</td><td>Invitrogen</td><td>10003D</td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; strain HT115(DE3)</td><td>Caenorhabditis Genetics Center (CGC)</td><td>HT115(DE3)</td><td></td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; strain OP50-1</td><td>Caenorhabditis Genetics Center (CGC)</td><td>OP50-1</td><td></td></tr><tr><td>EDTA (0.5 M, pH 8.0)</td><td>Invitrogen</td><td>15575020</td><td></td></tr><tr><td>Fluorescence Stereoscope</td><td>Zeiss</td><td>Axio Zoom.V16</td><td></td></tr><tr><td>Formaldehyde (37%)</td><td>Sigma</td><td>F8775</td><td></td></tr><tr><td>Glycine</td><td>Sigma</td><td>50046</td><td>Make a 1.25 M solution and store at 4 &amp;deg;C.</td></tr><tr><td>HEPES-KOH (1 M, pH 7.5)</td><td>Teknova</td><td>H1035</td><td></td></tr><tr><td>Hydrophobic Printed Slides, 10 wells</td><td>VWR</td><td>100488-904</td><td></td></tr><tr><td>IGEPAL CA-630 (Octylphenol ethoxylate)</td><td>BioShop</td><td>NON999</td><td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td></tr><tr><td>IPTG (Isopropyl-&amp;beta;-D-thiogalactoside)</td><td>BioShop</td><td>IPT001</td><td>Make a 0.2 g/mL solution in ultrapure water. Filter-sterilize and store at -20 &amp;deg;C.</td></tr><tr><td>iTaq Universal SYBR Green Supermix</td><td>Bio-Rad</td><td>1725122</td><td></td></tr><tr><td>LB Agar Plates supplemented with 100 &amp;micro;g/mL Ampicillin</td><td>NA</td><td>NA</td><td>Standard lab recipe.</td></tr><tr><td>Levamisole (Tetramisole hydrochloride)</td><td>Sigma</td><td>L9756</td><td>Make a 200 mM solution in ultrapure water. Store at -20 &amp;deg;C.</td></tr><tr><td>LiCl (8 M)</td><td>Sigma</td><td>L7026</td><td></td></tr><tr><td>M9 Buffer</td><td>NA</td><td>NA</td><td>22 mM KH2PO4, 42 mM Na2HPO4, 86 mM NaCl, 1 mM MgSO4.</td></tr><tr><td>Magnetic Separator (1.5 mL tubes)</td><td>Applied Biosystems</td><td>A13346</td><td></td></tr><tr><td>Magnetic Separator (0.2 mL tubes)</td><td>Permagen</td><td>MSR812</td><td></td></tr><tr><td>Microscope Cover Glass</td><td>Fisher Scientific</td><td>12541B</td><td></td></tr><tr><td>Microscope Slide</td><td>Technologist Choice</td><td>LAB-037</td><td></td></tr><tr><td>NaCl (5 M)</td><td>Promega</td><td>V4221</td><td>For ChIP buffers.</td></tr><tr><td>NaOH&amp;nbsp;</td><td>Sigma</td><td>S5881</td><td>Make a 10 M solution and store at room temperature.</td></tr><tr><td>NGM Plates</td><td>NA</td><td>NA</td><td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &amp;mu;g/mL cholesterol, 25 mM Potassium phosphate pH 6.0, 1 mM MgSO4, 50 &amp;micro;g/mL streptomycin.</td></tr><tr><td>Normal Rabbit IgG (1 mg/mL)</td><td>Cell Signaling Technology</td><td>2729</td><td></td></tr><tr><td>Petri Dishes (35 mm x 10 mm)</td><td>Sarstedt</td><td>82.1135.500</td><td></td></tr><tr><td>Phosphate Buffered Saline (10X)</td><td>Fisher BioReagents</td><td>BP3991</td><td></td></tr><tr><td>Plasmid - Control RNAi&amp;nbsp;</td><td>Addgene</td><td>L4440 (Plasmid #1654)</td><td></td></tr><tr><td>Plasmid - GFP-targetting RNAi&amp;nbsp;</td><td>Addgene</td><td>L4417 (Plasmid #1649)</td><td>Note, alternative L4440-derived plasmids targeting GFP can be used.</td></tr><tr><td>Primer pair [-3.3 kb upstream of gfp]</td><td>Integrated DNA Technologies</td><td>NA</td><td>F: AAACCAAAGGACGAGAGATTCA, R: GGCTCGATCAAGTAAAATTTCG</td></tr><tr><td>Primer pair [+1.3 kb downstream of gfp]</td><td>Integrated DNA Technologies</td><td>NA</td><td>F: TCGACCAGTTCTAAAGTCACCG, R: ACGTGCGGGATCATTTCTTACT</td></tr><tr><td>Primer pair [clec-18]</td><td>Integrated DNA Technologies</td><td>NA</td><td>F: TGCTCCATGACCTCAACAACA, R: AGTACAGTTCACCGATCCAGA</td></tr><tr><td>Primer pair [gfp exon 1]</td><td>Integrated DNA Technologies</td><td>NA</td><td>F: CTGGAGTTGTCCCAATTCTTGT, R: GGGTAAGTTTTCCGTATGTTGC</td></tr><tr><td>Primer pair [gfp exon 4]</td><td>Integrated DNA Technologies</td><td>NA</td><td>F: GATGGCCCTGTCCTTTTACCA, R: ATGCCATGTGTAATCCCAGCA</td></tr><tr><td>Primer pair [hrp-2]</td><td>Integrated DNA Technologies</td><td>NA</td><td>F: CGTCAACAGGGAGCAGCTG, R: CCTCCGAACTTTCTCTGTCCA</td></tr><tr><td>Protease Inhibitor Cocktail Tablet</td><td>Roche</td><td>11836170001</td><td></td></tr><tr><td>Proteinase K&amp;nbsp;</td><td>Bioline</td><td>BIO-37084</td><td></td></tr><tr><td>QIAquick PCR Purification Kit&amp;nbsp;</td><td>Qiagen</td><td>28104</td><td></td></tr><tr><td>Real-Time PCR Detection System</td><td>Bio-Rad</td><td>CFX96&amp;nbsp;</td><td></td></tr><tr><td>RNAi-NGM plates</td><td>NA</td><td>NA</td><td>1.7% (w/v) agar, 0.3% (w/v) NaCl, 0.25% (w/v) peptone, 1 mM CaCl2, 5 &amp;micro;g/mL cholesterol, 25 mM Potassium phosphate buffer pH 6.0, 1 mM MgSO4, 25 &amp;micro;g/mL carbenicillin and 5 mM IPTG.</td></tr><tr><td>RNase A</td><td>Sigma</td><td>R4642</td><td></td></tr><tr><td>Sarkosyl (N-Lauroylsarcosine sodium salt)</td><td>Sigma</td><td>L5777</td><td>Make a 10% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td></tr><tr><td>SDS</td><td>Sigma</td><td>74255</td><td>Make a 10% (w/v) solution and store at room temperature.</td></tr><tr><td>Sodium deoxycholate</td><td>Sigma</td><td>30970</td><td>Make a 5% (w/v) solution and store at room temperature protected from light for a maximum of 1 month.</td></tr><tr><td>Sonication Tube</td><td>Evergreen</td><td>214-3721-010</td><td></td></tr><tr><td>Sonication Tube Cap</td><td>Evergreen</td><td>300-2911-020</td><td></td></tr><tr><td>Sonicator</td><td>Qsonica</td><td>Q800R3-110</td><td></td></tr><tr><td>Streptomycin sulfate</td><td>Bioshop</td><td>STP101</td><td>Make a 50 mg/mL solution in ultrapure water. Filter-sterilize and store at -20 &amp;deg;C.</td></tr><tr><td>TAE buffer (1X)</td><td>NA</td><td>NA</td><td>40 mM Tris, 20 mM acetate, 1 mM EDTA</td></tr><tr><td>Tally counter clicker</td><td>Uline</td><td>H-7350</td><td></td></tr><tr><td>Tetracycline</td><td>Bioshop</td><td>TET701</td><td>Make a 5 mg/mL solution in ethanol and store at -20 &amp;deg;C.</td></tr><tr><td>Thermomixer</td><td>Eppendorf</td><td>05-400-205</td><td></td></tr><tr><td>Tris-HCl (1 M, pH 8.0)</td><td>Invitrogen</td><td>15568025</td><td></td></tr><tr><td>Triton X-100</td><td>Sigma</td><td>T8787</td><td>Make a 10% (v/v) solution in ultrapure water and store at room temperature.</td></tr></tbody></table>

analysis of transgenerational epigenetic inheritance in c. elegans using a fluorescent reporter and chromatin immunoprecipitation (chip)

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through factors such as non-coding RNAs and chromatin modifications. The phenomenon of RNA interference (RNAi) inheritance in the nematode Caenorhabditis elegans is an effective model to investigate TEI that takes advantage of this model organism's short life cycle, self-propagation, and transparency. In RNAi inheritance, exposure of animals to RNAi leads to gene silencing and altered chromatin signatures at the target locus that persist for multiple generations in the absence of the initial trigger. This protocol describes the analysis of RNAi inheritance in C. elegans using a germline-expressed nuclear green fluorescent protein (GFP) reporter. Reporter silencing is initiated by feeding the animals bacteria expressing double-stranded RNA targeting GFP. At each generation, animals are passaged to maintain synchronized development, and reporter gene silencing is determined by microscopy. At select generations, populations are collected and processed for chromatin immunoprecipitation (ChIP)-quantitative polymerase chain reaction (qPCR) to measure histone modification enrichment at the GFP reporter locus. This protocol for studying RNAi inheritance can be easily modified and combined with other analyses to further investigate TEI factors in small RNA and chromatin pathways.

Animals carrying the germline-expressed GFP-histone H2B [mex-5p::gfp-h2b::tbb-2 3&#39;UTR]7 reporter (Figure 2A) were exposed to GFP RNAi or control RNAi by feeding, and passaged as described in the protocol and Figure 1. Nuclear GFP signal in the germline was manually scored using a fluorescence dissecting microscope for a sample of the population at each generation. Silencing of the transgene was fully penetrant in the scored P0 and F1 animals treated with GFP RNAi (Figure 2B). In the F2 generation, the proportion of the population exhibiting inheritance of GFP silencing was approximately 50%. By the F5 generation, the majority of the population did not show inheritance of silencing, and by the F10 generation, no inheritance was detected, as all the animals expressed GFP.
To determine the change in histone H3K9me3 enrichment corresponding to RNAi-induced silencing, ChIP-qPCR was performed on F1 generation animals following either GFP RNAi or control RNAi treatment. As expected, the GFP RNAi-treated population displayed higher histone H3K9me3 levels at the GFP target and at the 1.3 kb downstream region compared to control RNAi-treated animals (Figure 2C). The specificity of the histone H3K9me3 ChIP is supported by the enrichment at a positive control locus (clec-18) known to be enriched in this mark, but not at a nearby negative control locus (hrp-2). Histone H3 enrichment and near-background enrichment in the IgG control immunoprecipitations were also detected at all qPCR loci, as expected. When ChIP enrichment at the reporter is normalized to the clec-18 positive control locus, higher histone H3K9me3 enrichment upon GFP RNAi is shown, whereas histone H3 enrichment is similar between the control and GFP RNAi treatments (Figure 2D). Since GFP RNAi is not expected to affect histone H3K9me3 or total histone H3 occupancy at the clec-18 locus, this normalization mitigates against technical variation, such as differences in ChIP efficiency between the GFP RNAi and control RNAi samples. The fold-change of histone H3K9me3 and histone H3 levels between RNAi treatments shows GFP reporter-specific histone H3K9me3 enrichment, independent of histone occupancy, upon GFP RNAi-induced silencing (Figure 2E).
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/65285/65285fig02.jpg" /> 
Figure 2: GFP RNAi-induced silencing corresponds to elevated H3K9me3 enrichment at the RNAi target. (A) Diagram of the germline-expressed GFP RNAi reporter mjIs134[mex-5p::gfp-h2b::tbb-2 3&#39;UTR] with qPCR amplicon regions labelled. (B) GFP expression scored across generations after RNAi treatments at 21 &#176;C. Error bars represent the standard deviation from two biological replicates. (C) ChIP-qPCR of H3K9me3, histone H3, and IgG control in F1 young adults from two biological replicates. clec-18 and hrp-2 are the positive and negative control loci for H3K9me3 enrichment, respectively. (D) H3K9me3 and histone H3 enrichment at the GFP RNAi reporter normalized to the clec-18 positive control locus. (E) Change in H3K9me3 and histone H3 enrichment between GFP RNAi- and control RNAi-treated animals, with normalization to clec-18. Dotted line represents a fold-change of 1. <a href="https://www.jove.com/files/ftp_upload/65285/65285fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about RNAi Inheritance and ChIP in C. elegans at JoVE.com

Author Spotlight: RNAi Inheritance and ChIP in C. elegans 

This protocol describes an RNA interference and ChIP assay to study the epigenetic inheritance of RNAi-induced silencing and associated chromatin modifications in C. elegans.

Analysis of Transgenerational Epigenetic Inheritance in C. elegans Using a Fluorescent Reporter and Chromatin Immunoprecipitation (ChIP)

Transgenerational epigenetic inheritance (TEI) allows the transmission of information through the germline without changing the genome sequence, through ...

analysis-transgenerational-epigenetic-inheritance-c-elegans-using

Research

JoVE Journal

Genetics

3.7K Views.  University of Toronto. Onderzoek in ons lab onderzoekt hoe chromatine-geassocieerde eiwitten, histonmodificaties en kleine RNA-pathway-factoren samenwerken in de context van ontwikkeling en transgenerationele epigenetische overerving. De RNA-overervingstest, met behulp van een GFP-reporter, is een zeer krachtig hulpmiddel geworden. Dit protocol beschrijft hoe de bereiding, het scoren en het passeren van wormen en de bereiding van ChIP-monsters kunnen worden gestandaardiseerd, wat kan helpen om reproduceerbare resul...

Video: Auteur in de schijnwerpers: RNAi-overerving en ChIP in C. elegans 

Comprehensive Assessment of Germline Chemical Toxicity Using the Nematode Caenorhabditis elegans

Identifying the reproductive toxicity of the thousands of chemicals present in our environment has been one of the most tantalizing challenges in the field of environmental health. This is due in part to the paucity of model systems that can (1) accurately recapitulate keys features of reproductive processes and (2) do so in a medium- to high-throughput fashion, without the need for a high number of vertebrate animals.
We describe here an assay in the nematode C. elegans that allows the rapid identification of germline toxicants by monitoring the induction of aneuploid embryos. By making use of a GFP reporter line, errors in chromosome segregation resulting from germline disruption are easily visualized and quantified by automated fluorescence microscopy. Thus the screening of a particular set of compounds for its toxicity can be performed in a 96- to 384-well plate format in a matter of days. Secondary analysis of positive hits can be performed to determine whether the chromosome abnormalities originated from meiotic disruption or from early embryonic chromosome segregation errors. Altogether, this assay represents a fast first-pass strategy for the rapid assessment of germline dysfunction following chemical exposure.

Comprehensive Assessment of Germline Chemical Toxicity Using the Nematode Caenorhabditis elegans

We describe the detailed steps of a high-throughput chemical assay in the nematode Caenorhabditis elegans used to assess germline toxicity. In this assay, disruption of germline function following chemical exposure is monitored using a fluorescent reporter specific to aneuploid embryos.

Identifying the reproductive toxicity of the thousands of chemicals present in our environment has been one of the most tantalizing challenges in the ...

Developmental Biology

Generation of Stable Transgenic C. elegans Using Microinjection

Transgenic Caenorhabditis elegans can be readily created via microinjection of a DNA plasmid solution into the gonad 1. The plasmid DNA rearranges to form extrachromosomal concatamers that are stably inherited, though not with the same efficiency as actual chromosomes 2. A gene of interest is co-injected with an obvious phenotypic marker, such as rol-6 or GFP, to allow selection of transgenic animals under a dissecting microscope. The exogenous gene may be expressed from its native promoter for cellular localization studies. Alternatively, the transgene can be driven by a different tissue-specific promoter to assess the role of the gene product in that particular cell or tissue. This technique efficiently drives gene expression in all tissues of C. elegans except for the germline or early embryo 3. Creation of transgenic animals is widely utilized for a range of experimental paradigms. This video demonstrates the microinjection procedure to generate transgenic worms. Furthermore, selection and maintenance of stable transgenic C. elegans lines is described.

This video demonstrates the technique of microinjection into the gonad of C. elegans to create transgenic animals.

Transgenic Caenorhabditis elegans can be readily created via microinjection of a DNA plasmid solution into the gonad 1.  The plasmid DNA rearranges to ...

Biology

Using Caenorhabditis elegans for Studying Trans- and Multi-Generational Effects of Toxicants

Information about toxicities of chemicals are essential in their application and waste management. For chemicals at low concentrations, the long-term effects are very important in judging their consequences in the environment and on human health. In demonstrating long-term influences, effects of chemicals over generations in recent studies provide new insight. Here, we describe protocols for studying effects of chemicals over multiple generations using free-living nematode Caenorhabditis elegans. Two aspects are presented: (1) trans-generational (TG) and (2) multi-generational effect studies, the latter of which is separated to multi-generational exposure (MGE) and multi-generational residual (MGR) effect studies. The TG effect study is robust with a simple purpose to determine whether chemical exposure to parents can result in any residual consequences on offspring. After the effects are measured on parents, sodium hypochlorite solutions are used to kill the parents and keep the offspring so as to facilitate effect measurement on the offspring. The TG effect study is used to determine whether the offspring are affected when their parent is exposed to the pollutants. The MGE and MGR effect study is systematical used to determine whether continuous generational exposure can result in adaptive responses in offspring over generations. Careful pick-up and transfer are used to distinguish generations to facilitate effect measurement on each generation. We also combined protocols to measure locomotion behavior, reproduction, lifespan, biochemical and gene expression changes. Some example experiments are also presented to illustrate the trans- and multi-generational effect studies.

Using Caenorhabditis elegans for Studying Trans- and Multi-Generational Effects of Toxicants

Trans- and multi-generational effects of persistent chemicals are essential in judging their long-term consequences in the environment and on the human health. We provide novel detailed methods for studying trans- and multi-generational effects using free-living nematode Caenorhabditis elegans.

Information about toxicities of chemicals are essential in their application and waste management. For chemicals at low concentrations, the long-term ...

Environment

C. elegans Gonad Dissection and Freeze Crack for Immunofluorescence and DAPI Staining

The C. elegans germline makes an excellent model for studying meiosis, in part due to the ease of conducting cytological analyses on dissected animals. Whole mount preparations preserve the structure of meiotic nuclei, and importantly, each gonad arm contains all stages of meiosis, organized in a temporal-spatial progression that makes it easy to identify nuclei at different stages. Adult hermaphrodites have two gonad arms, each organized as a closed tube with proliferating germline stem cells at the distal closed end and cellularized oocytes at the proximal open end, which join in the center at the uterus. Dissection releases one or both gonad arms from the body cavity, allowing the entirety of meiosis to be visualized. Here, a common protocol for immunofluorescence against a protein of interest is presented, followed by DAPI staining to mark all chromosomes. Young adults are immobilized in levamisole and quickly dissected using two syringe needles. After germline extrusion, the sample is fixed before undergoing a freeze crack in liquid nitrogen, which helps permeabilize the cuticle and other tissues. The sample can then be dehydrated in ethanol, rehydrated, and incubated with primary and secondary antibodies. DAPI is added to the sample in the mounting medium, which allows reliable visualization of DNA and makes it easy to find animals to image under a fluorescent microscope. This technique is readily adopted by those familiar with handling C. elegans after a few hours spent practicing the dissection method itself. This protocol has been taught to high-schoolers and undergraduates working in a research lab and incorporated into a course-based undergraduate research experience at a liberal arts college.

C. elegans Gonad Dissection and Freeze Crack for Immunofluorescence and DAPI Staining

This is a commonly used method for C. elegans gonad dissection followed by freeze crack, which produces germline samples for immunofluorescence via antibody staining, or for simple DAPI staining to visualize DNA. This protocol has been successful for undergraduates in a research lab and in a course-based undergraduate research experience.

The C. elegans germline makes an excellent model for studying meiosis, in part due to the ease of conducting cytological analyses on dissected animals. ...

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and chromosome dynamics. While the germline is an excellent model, the analysis is often two dimensional due to the time and labor required for three-dimensional analysis. Major readouts in such studies are the number/position of nuclei and protein distribution within the germline. Here, we present a method to perform automated analysis of the germline using confocal microscopy and computational approaches to determine the number and position of nuclei in each region of the germline. Our method also analyzes germline protein distribution that enables the three-dimensional examination of protein expression in different genetic backgrounds. Further, our study shows variations in cytoskeletal architecture in distinct regions of the germline that may accommodate specific spatial developmental requirements. Finally, our method enables automated counting of the sperm in the spermatheca of each germline. Taken together, our method enables rapid and reproducible phenotypic analysis of the C. elegans germline.

Computational Analysis of the Caenorhabditis elegans Germline to Study the Distribution of Nuclei, Proteins, and the Cytoskeleton

We present an automated method for three-dimensional reconstruction of the Caenorhabditis elegans germline. Our method determines the number and position of each nucleus within the germline and analyses germline protein distribution and cytoskeletal structure.

The Caenorhabditis elegans (C. elegans) germline is used to study several biologically important processes including stem cell development, apoptosis, and ...

Imaging C. elegans Embryos using an Epifluorescent Microscope and Open Source Software

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using fluorescent-labeled reporter proteins or differential interference contrast (DIC) microscopy, allows for the examination of the temporal progression of these dynamic events which is otherwise inferred from analysis of fixed samples1,2. Moreover, the study of the developmental regulations of cellular processes necessitates conducting time-lapse experiments on an intact organism during development. The Caenorhabiditis elegans embryo is light-transparent and has a rapid, invariant developmental program with a known cell lineage3, thus providing an ideal experiment model for studying questions in cell biology4,5and development6-9. C. elegans is amendable to genetic manipulation by forward genetics (based on random mutagenesis10,11) and reverse genetics to target specific genes (based on RNAi-mediated interference and targeted mutagenesis12-15). In addition, transgenic animals can be readily created to express fluorescently tagged proteins or reporters16,17. These traits combine to make it easy to identify the genetic pathways regulating fundamental cellular and developmental processes in vivo18-21. In this protocol we present methods for live imaging of C. elegans embryos using DIC optics or GFP fluorescence on a compound epifluorescent microscope. We demonstrate the ease with which readily available microscopes, typically used for fixed sample imaging, can also be applied for time-lapse analysis using open-source software to automate the imaging process.

Imaging C. elegans Embryos using an Epifluorescent Microscope and Open Source Software

The C. elegans embryo is a powerful system for studying cell biology and development. We present a protocol for live imaging of C. elegans embryos utilizing DIC optics or fluorescence using readily available epifluorescent microscopes and open-source software.

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using ...

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes. However, many compounds identified in screens using cell culture models are often found to be toxic or pharmacologically inactive in vivo1-2. Screening in whole animal models can help avoid these pitfalls and streamline the path to drug development.
C. elegans is a multicellular model organism well suited for HTS. It is small (&lt;1 mm) and can be economically cultured and dispensed in liquids. C. elegans is also one of the most experimentally tractable animal models permitting rapid and detailed identification of drug mode-of-action3.
We describe a protocol for culturing and dispensing fluorescent strains of C. elegans for high-throughput screening of chemical libraries or detection of environmental contaminants that alter the expression of a specific gene. Large numbers of developmentally synchronized worms are grown in liquid culture, harvested, washed, and suspended at a defined density. Worms are then added to black, flat-bottomed 384-well plates using a peristaltic liquid dispenser. Small molecules from a chemical library or test samples (e.g., water, food, or soil) can be added to wells with worms. In vivo, real-time fluorescence intensity is measured with a fluorescence microplate reader. This method can be adapted to any inducible gene in C. elegans for which a suitable reporter is available. Many inducible stress and developmental transcriptional pathways are well defined in C. elegans and GFP transgenic reporter strains already exist for many of them4. When combined with the appropriate transgenic reporters, our method can be used to screen for pathway modulators or to develop robust biosensor assays for environmental contaminants. 
We demonstrate our C. elegans culture and dispensing protocol with an HTS assay we developed to monitor the C. elegans cap &#x2018;n&#x2019; collar transcription factor SKN-1. SKN-1 and its mammalian homologue Nrf2 activate cytoprotective genes during oxidative and xenobiotic stress5-10. Nrf2 protects mammals from numerous age-related disorders such as cancer, neurodegeneration, and chronic inflammation and has become a major chemotherapeutic target11-13.Our assay is based on a GFP transgenic reporter for the SKN-1 target gene gst-414, which encodes a glutathione-s transferase6. The gst-4 reporter is also a biosensor for xenobiotic and oxidative chemicals that activate SKN-1 and can be used to detect low levels of contaminants such as acrylamide and methyl-mercury15-16.

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

A procedure for liquid-based culturing and dispensing of C. elegans strains expressing fluorescent reporter proteins is described that does not require expensive sorting equipment. This approach can be applied to numerous inducible C. elegans genes for drug discovery or biosensing of contaminants.

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

Time-lapse Microscopy of Early Embryogenesis in Caenorhabditis elegans

Caenorhabditis elegans has often been used as a model system in studies of early developmental processes. The transparency of the 
embryos, the genetic resources, and the relative ease of transformation are qualities that make C. elegans an excellent model for early embryogenesis. Laser-based 
confocal microscopy and fluorescently labeled tags allow researchers to follow specific cellular structures and proteins in the developing embryo. For example, 
one can follow specific organelles, such as lysosomes or mitochondria, using fluorescently labeled dyes. These dyes can be delivered to the early embryo by means 
of microinjection into the adult gonad. Also, the localization of specific proteins can be followed using fluorescent protein tags. Examples are presented here 
demonstrating the use of a fluorescent lysosomal dye as well as fluorescently tagged histone and ubiquitin proteins. The labeled histone is used to visualize 
the DNA and thus identify the stage of the cell cycle. GFP-tagged ubiquitin reveals the dynamics of ubiquitinated vesicles in the early embryo. Observations 
of labeled lysosomes and GFP:: ubiquitin can be used to determine if there is colocalization between ubiquitinated vesicles and lysosomes. A technique for 
the microinjection of the lysosomal dye is presented. Techniques for generating transgenenic strains are presented elsewhere (1, 2). For imaging, embryos 
are cut out of adult hermaphrodite nematodes and mounted onto 2% agarose pads followed by time-lapse microscopy on a standard laser scanning confocal 
microscope or a spinning disk confocal microscope. This methodology provides for the high resolution visualization of early embryogenesis.

Time-lapse Microscopy of Early Embryogenesis in Caenorhabditis elegans

This article describes a technique for the visualization of the early events of embryogenesis in the nematode Caenorhabditis elegans.

Caenorhabditis elegans has often been used as a model system in studies of early developmental processes.  The transparency of the 
embryos, the genetic ...

Tracking Calcium in the Early Developmental Phases of C. elegans

In Vivo Visualization of Calcium Transients during Fertilization and Early Development in C. elegans

Calcium is an important signaling molecule during the oocyte-to-embryo transition (OET) and early embryogenesis. The hermaphroditic nematode Caenorhabditis elegans provides several unique advantages for the study of the OET as it is transparent and has an ordered gonad that produces one mature oocyte every ~23 min at 20 &#176;C. We have modified the genetically encoded calcium indicator jGCaMP7s to fluorescently indicate the moment of fertilization within a living organism. We have termed this reporter &#34;CaFE&#34; for Calcium during Fertilization in C. elegans. The CaFE reporter was&#160;engineered into a safe harbor locus in single copy, has no significant impact on physiology or fecundity, and produces a robust signal upon fertilization. Here, a series of protocols is presented for utilizing the CaFE reporter as an in vivo tool for dissecting the OET and embryogenesis. We include methods to synchronize worms, examine the effects of RNAi knockdown, mount worms for imaging, and to visualize calcium in oocytes and embryos. Additionally, we present the generation of additional worm strains to aid in this type of analysis. Demonstrating the utility of the CaFE reporter to visualize the timing of fertilization, we report that double ovulation occurs when ipp-5 is targeted by RNAi and that only the first oocyte undergoes immediate fertilization. Furthermore, the discovery of single-cell calcium transients during early embryogenesis is reported here, demonstrating that the CaFE reporter persists into early development. Importantly, the CaFE reporter in worms is simple enough to use for incorporation into course-based undergraduate research (CURE) laboratory classes. The CaFE reporter, coupled with the ordered gonad and ease of RNAi in worms, facilitates inquiry into the cell-cell dynamics required to regulate internal fertilization and early embryogenesis.

Here, we present protocols and tools for visualizing calcium during fertilization and early embryogenesis using a genetically encoded calcium reporter expressed in the germline of the model nematode C. elegans.

Calcium is an important signaling molecule during the oocyte-to-embryo transition (OET) and early embryogenesis. The hermaphroditic nematode ...

A Rapid Protocol for Integrating Extrachromosomal Arrays With High Transmission Rate into the C. elegans Genome

Microinjecting DNA into the cytoplasm of the syncytial gonad of Caenorhabditis elegans is the main technique used to establish transgenic lines that exhibit partial and variable transmission rates of extrachromosomal arrays to the next generation. In addition, transgenic animals are mosaic and express the transgene in a variable number of cells. Extrachromosomal arrays can be integrated into the C. elegans genome using UV irradiation to establish nonmosaic transgenic strains with 100% transmission rate of the transgene. To that extent, F1 progenies of UV irradiated transgenic animals are screened for animals carrying a heterozygous integration of the transgene, which leads to a 75% Mendelian transmission rate to the F2 progeny. One of the challenges of this method is to distinguish between the percentage of transgene transmission in a population before (X% transgenic animals) and after integration (&#8805;75% transgenic F2 animals). Thus, this method requires choosing a nonintegrated transgenic line with a percentage of transgenic animals that is significantly lower than the Mendelian segregation of 75%. Consequently, nonintegrated transgenic lines with an extrachromosomal array transmission rate to the next generation &#8804;60% are usually preferred for integration, and transgene integration in highly transmitting strains is difficult. Here we show that the efficiency of extrachromosomal arrays integration into the genome is increased when using highly transmitting transgenic lines (&#8805;80%). The described protocol allows for easy selection of several independent lines with homozygous transgene integration into the genome after UV irradiation of transgenic worms exhibiting a high rate of extrachromosomal array transmission. Furthermore, this method is quite fast and low material consuming. The possibility of rapidly generating different lines that express a particular integrated transgene is of great interest for studies focusing on gene expression pattern and regulation, protein localization, and overexpression, as well as for the development of subcellular markers.

A Rapid Protocol for Integrating Extrachromosomal Arrays With High Transmission Rate into the C. elegans Genome

This protocol describes a rapid and low material consuming procedure for the integration of transgenic extrachromosomal arrays into the Caenorhabditis elegans genome using ultra violet (UV) irradiation. Furthermore, this protocol is particularly well suited for transgenic lines that transmit extrachromosomal arrays at a high rate.

Microinjecting DNA into the cytoplasm of the syncytial gonad of Caenorhabditis elegans is the main technique used to establish transgenic lines that ...

Analysis of Transgenerational Epigenetic Inheritance in C. elegans Using a Fluorescent Reporter and Chromatin Immunoprecipitation (ChIP)

Samenvatting

Meer video's verkennen