J.L.S. is supported by the German Research Foundation (DFG) under Germany&#39;s Excellence Strategy (EXC2151-390873048), as well as under SCHU 950/8-1; GRK 2168, TP11; CRC SFB 1454 Metaflammation, IRTG GRK 2168, WGGC INST 216/981-1, CCU INST 217/988-1, the BMBF-funded excellence project Diet-Body-Brain (DietBB); and the EU project SYSCID under grant number 733100. M.B. is supported by DFG (IRTG2168-272482170, SFB1454-432325352). L.B. is supported by DFG (ImmuDiet BO 6228/2-1 - Project number 513977171) and Germany&#39;s Excellence Strategy (EXC2151-390873048). Images created with BioRender.com.

This protocol follows the guidelines of the local ethics committees of the University of Bonn.
1. Preparation of buffers, solutions, and equipment
<ol>
	<li>Prepare the solutions and gather the materials described in Table of Materials.</li>
	<li>Heat up the water bath to 37 &#176;C and warm up the complete growth medium (RPMI-1640 + 10% fetal calf serum (FCS) + 1% penicillin/streptomycin).</li>
	<li>For cell harvesting, use ice-cold phosphate-buffered saline (PBS). 
	&#8203;NOTE: Keep a clean environment while working with cells to maintain sterility.</li>
</ol>
2. Cell handling
NOTE: A detailed protocol for the cryopreservation of peripheral blood mononuclear cells (PBMC) from human blood can be found in7.
<ol>
	<li>Cell thawing and counting
	<ol>
		<li>Remove the cryovials from liquid nitrogen and thaw them in a water bath at 37 &#176;C for 2 - 3 min while gently inverting.</li>
		<li>Transfer the thawed cells into a 50 mL conical tube.</li>
		<li>Rinse the cryovial with 1 mL warm complete growth medium and add this solution dropwise to the cells in the tube (1st dilution step).</li>
		<li>Repeat the dilution 1:1 until reaching a volume of 32 mL (5 dilutions total with respectively 1, 2, 4, 8, and 16 mL of warm complete growth medium). Add the medium dropwise to reduce cell disturbance while slightly agitating the conical tube.</li>
		<li>Centrifuge the cell suspension for 5 min (300 x g, 20 &#176;C) and remove the supernatant by gently tipping the conical tube in one fluent motion.</li>
		<li>Resuspend the cells in 3 mL of warm complete growth medium and proceed with cell counting.</li>
		<li>For counting, mix 10 &#181;L of cell suspension with Trypan Blue (1:2 to 1:10 dilution depending on the density of the cell suspension) to distinguish living from dead cells while counting. Dead or damaged cells will appear blue due to the uptake of the dye, while vital cells are not stained. 
		NOTE: Trypan Blue is slightly cytotoxic, stained cells should not be stored for more than 5 min.</li>
		<li>Count the cells with either an automated cell counter or counting chamber by using 10 &#181;L of stained cell solution.
		<ol>
			<li>When using the Neubauer-improved cell chamber, count all cells within the four large squares located at the corners and use the following equation to calculate the concentration of the cell suspension. 
			<img alt="Equation 1" src="/files/ftp_upload/65930/65930eq01.jpg" style="margin: auto;" /></li>
		</ol>
		</li>
		<li>Dilute the cells to a final concentration of 1 x 106 cells/mL with warm complete growth medium. Centrifuge only if the required volume is lower than 3 mL and resuspend the cell pellet to the right volume.</li>
	</ol>
	</li>
	<li>Cell seeding and treatment
	<ol>
		<li>Seed 100 &#181;L of cell suspension per well in a 96-well cell culture plate (1 x 105 cells / well). 
		NOTE: The cell number for seeding was optimized for PBMC cultures. While low cell concentrations will not yield a sufficient amount of RNA for sequencing, an excessive number of cells will increase the risk of suboptimal cell lysis and inhibition of the reverse transcription reaction.</li>
		<li>Prepare drug dilutions at a concentration two times the one used for treatment (2x). Choose the solvent according to the solubility of the compound, preferably complete growth medium. 
		NOTE: PBS or dimethyl sulfoxide (DMSO) can be used if sufficient solubility cannot be reached otherwise. The maximum concentration of DMSO in the resulting incubation volume should not exceed 0.5 % to prevent cytotoxicity induced by the solvent.</li>
		<li>Add 100 &#181;L of the 2x drug dilution (final concentration in well 1X) and incubate at 37 &#176;C for the defined time. 
		NOTE: Complementary investigations should be carried out in order to establish the optimal drug incubation time and to exclude potential mechanisms of cytotoxicity.</li>
	</ol>
	</li>
	<li>Cell harvesting and lysis
	<ol>
		<li>Centrifuge the cell culture plate for 10 min (300 x g, 20 &#176;C). Gently remove the supernatant with a vacuum pump keeping the plate at an angle (30&#176;-45&#176;) while aiming the tip at the low corner of the well to remove as little cells as possible.</li>
		<li>Wash the cells by adding 200 &#181;L of ice-cold PBS to each well and centrifuge the plate for 5 min (300 x g, 4 &#176;C). Remove the supernatant with a vacuum pump, again, keeping the plate at a sharp angle to remove as much PBS as possible.</li>
		<li>Prepare the lysis buffer as described in Table 1 for the number of reactions (rxn) needed, adding 10% overage.</li>
		<li>Add 15 &#181;L of lysis buffer to each well and seal the plate with adhesive sealing film to protect the samples against contamination. Vortex the plate before centrifuging for 1 min (1000 x g, 4 &#176;C) and incubate for 5 min on ice.</li>
		<li>Collect 6 &#181;L of lysed cell solution in a PCR plate and shortly freeze the cell lysate at -80 &#176;C to ensure optimal cell lysis. Be sure to avoid multiple freezing cycles of the plates. 
		&#8203;NOTE: STOPPING POINT: If cDNA production is not carried out subsequently, the cell lysate can be stored at -80 &#176;C for up to several months without considerable decrease of RNA quality.</li>
	</ol>
	</li>
</ol>
3. Library preparation for sequencing
<ol>
	<li>Reverse transcriptase (RT) reaction 
	NOTE: When working with RNA, place all samples on ice and be sure to use nuclease-free equipment (sterile, disposable plasticware) and water.
	<ol>
		<li>Prepare the RT reaction mix as described in Table 2 for the number of reactions needed, adding 10% overage. Briefly vortex the mix and shortly spin it down. Keep the mix on ice until use.</li>
		<li>Thaw the cell lysate at room temperature (RT) and briefly spin it down to collect all cell lysate at the bottom of the plate.</li>
		<li>Perform mRNA denaturation on a thermocycler as per Table 3.</li>
		<li>Take the plate out of the thermocycler and shortly spin it down to collect potential condensate. Add 6 &#181;L of RT reaction mix into each well for a final volume of 12 &#181;L. Seal the plate to protect the plate and to avoid evaporation, vortex, and spin it down.</li>
		<li>Place the plate on the thermocycler and start the RT reaction program as per Table 3.</li>
	</ol>
	</li>
	<li>Pre-amplification
	<ol>
		<li>Thaw the high-fidelity DNA polymerase and in-situ PCR (ISPCR) primer at room temperature.</li>
		<li>Prepare the pre-amplification mix as per Table 4 for the number of reactions needed, adding 10% overage. Briefly vortex the mix and spin it down. 
		NOTE: The enzyme mix is stable at room temperature for hours.</li>
		<li>Spin down the PCR plate, add 15 &#181;L of the pre-amplification mix to each well and seal the plate.</li>
		<li>Place it on the thermocycler and start the pre-amplification reaction as per Table 5.
		<ol>
			<li>Adjust the number of cycles due to RNA content. Start with a lower number and increase if cDNA yield is not sufficient. 
			NOTE: In our experience, optimal number of cycles should be established for each cell type, experimental condition and treatment will not influence the optimal number of cycles. We, therefore, recommend establishing the optimal number of cycles experimentally when establishing this protocol for a new cell type. In general, primary cells will require a higher number of cycles compared to cell lines. STOPPING POINT: The pre-amplification product can be stored at - 20 &#176;C.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>cDNA clean-up and quality control (QC) 
	NOTE: Sample clean-up can be performed sequentially for each plate as the samples are rather stable at this stage. Increasing the number of samples will lead to a longer duration of the protocol but will not limit the number of samples that can be processed simultaneously.
	<ol>
		<li>Before starting, bring the magnetic purification beads to room temperature and vortex on high speed for 1 min to fully resuspend the beads.</li>
		<li>Add 0.8x v/v (20 &#181;L) magnetic purification beads to each well and incubate at room temperature for 5 min.</li>
		<li>Place the PCR plate on a magnetic rack for 5 min until the beads are fully separated. Remove the supernatant carefully.</li>
		<li>Keeping the plate on the magnetic rack, gently add 100 &#181;L of freshly prepared 80% ethanol to wash the beads and incubate for 30 s. Use a small volume pipette to remove the supernatant. Repeat for an additional washing step. Be sure to remove as much ethanol as possible.</li>
		<li>Air-dry the beads on the magnetic rack at room temperature for up to 5 min until the ethanol is fully evaporated and the beads no longer look shiny.</li>
		<li>Remove the plate from the magnetic rack, resuspend the beads in 20 &#181;L of nuclease-free water and incubate for 2 min.</li>
		<li>Place the plate again on the magnetic rack until the beads are separated.</li>
		<li>Recover the eluate in a new PCR plate for cDNA QC and tagmentation.</li>
		<li>Perform a TapeStation or FragmentAnalyser assay to evaluate the size distribution and concentration of the cDNA library (Recommended: TapeStation D5000 assay). For details, see manufacturer instructions. A typical yield of 20 ng is to be expected.</li>
	</ol>
	</li>
	<li>Tagmentation with kit 
	NOTE: Other Tagmentation protocols can be used if already established.
	<ol>
		<li>Dilute the cDNA to a final concentration of 150 - 300 pg/&#181;L using nuclease-free water.</li>
		<li>Preprogram the thermocycler as per Table 6 to ensure an immediate start of the tagmentation reaction after adding the cDNA to the enzyme mix.</li>
		<li>Prepare the tagmentation mix as per Table 7 for the number of reactions needed, adding 10% overage.</li>
		<li>Dispense 3 &#181;L of the tagmentation mix per reaction onto a new PCR plate and add 1 &#181;L of cDNA to each reaction.</li>
		<li>Start the tagmentation reaction immediately after adding the cDNA.</li>
		<li>Inactivate the reaction by adding 1 &#181;L of neutralize tagment buffer (NT; alternatively, 0.2% sodium dodecyl sulfate (SDS) can be used).</li>
	</ol>
	</li>
	<li>Enrichment PCR
	<ol>
		<li>Prepare the enrichment PCR mix Table 7 for the number of reactions, adding 10% overage. (Recommended: Nextera UDI set to prevent index hopping on patterned flow cells (e.g., Illumina NovaSeq 6000)).</li>
		<li>Add 9 &#181;L of the enrichment PCR mix to each reaction for a total volume of 14 &#181;L.</li>
		<li>Run the enrichment PCR program as per Table 8. 
		NOTE: For the enrichment PCR, 16 cycles are standard. If the cDNA quality is poor, additional cycles can be added.</li>
	</ol>
	</li>
	<li>Clean-up and QC
	<ol>
		<li>Before starting, bring magnetic purification beads to room temperature and vortex on high speed for 1 min to fully resuspend the beads.</li>
		<li>Add 1.0x v/v (14 &#181;L) magnetic purification beads and incubate at room temperature for 5 min.</li>
		<li>Place the plate on a magnetic rack and wait for 5 min until the beads are fully separated. Remove the supernatant carefully.</li>
		<li>Keeping the plate on the magnetic rack, gently add 100 &#181;L of freshly prepared 80% ethanol to wash the beads and incubate for 30 s. Use a small volume pipette to remove the supernatant. Repeat for an additional washing step. Be sure to remove as much ethanol as possible.</li>
		<li>Air-dry the beads at room temperature for 3 min or until they no longer look shiny.</li>
		<li>Remove the plate from the magnetic rack, resuspend the beads in 20 &#181;L of nuclease-free water and incubate for 2 min.</li>
		<li>Place the plate again on the magnetic rack until the beads separate and recover the eluate in a new PCR plate for library QC.</li>
		<li>Perform a TapeStation or Fragment Analyzer assay to evaluate the size distribution and concentration of the cDNA library (Recommended: TapeStation D1000 high-sensitivity assay). For details, see manufacturer instructions. On average, a yield of 10 ng is to be expected. 
		&#8203;NOTE: STOPPING POINT: The PCR product can be stored at - 20 &#176;C.</li>
	</ol>
	</li>
</ol>
4. Sequencing and data pre-processing
<ol>
	<li>Sequencing 
	NOTE: The following guideline will be applicable to all Illumina instruments for short-read sequencing. If the instrumentation is not available, the sequencing can be performed by an external sequencing facility. Other sequencing approaches could also be used. For simplicity, we chose to report on the most widely used sequencing technology only. 
	NOTE: The following steps related to software usage describe the procedure on an Illumina NovaSeq6000 sequencer.
	<ol>
		<li>Pool uniquely indexed libraries in an equimolar ratio according to the results obtained in step 3.6.8.</li>
		<li>Measure the concentration of the final pool with a high-sensitivity assay to calculate the sample molarity as follows: 
		<img alt="Equation 2" src="/files/ftp_upload/65930/65930eq02.jpg" style="margin: auto;" /></li>
		<li>Load the flow cell according to the instrument&#39;s specification and to experimental optimization. Examples for loading concentrations of common instruments are shown in Table 9.</li>
		<li>By touching the screen select Sequence to initiate the run setup.</li>
		<li>Follow the instructions on screen and load flow cell, sequence-by-synthesis cartridge, clustering cartridge, buffer cartridge and ensure the waste containers are empty.</li>
		<li>Once all reagents have been recognized by the instrument click on Run Setup. Define here the run name and the output folder to store the data.</li>
		<li>Define the sequencing details as paired-end with both reads of 51 bp. Two index reads are also sequenced with 8 bp each.</li>
		<li>Press Review and after checking if all sequencing details are correct press Start Run. 
		NOTE: The recommended sequencing depth is 5 x 106 reads/sample, with a minimum 1 x 106 reads/sample.</li>
	</ol>
	</li>
	<li>Data pre-processing
	<ol>
		<li>Transform raw sequencing data to FASTQ format and demultiplex according to the sample indexes with the tool Bcl2Fastq2. Perform demultiplexing with default settings. For detailed instructions on Bcl2Fastq2, see the reference manual. 
		NOTE: FASTQ conversion and demultiplexing are usually performed by the sequencing facility if sequencing is not performed in-house. Sequencing facilities will usually provide demultiplexed FASTQ for further processing.</li>
		<li>Several options are available for data alignment and abundance quantification of sequencing reads (Recommended: nf-core RNA-seq pipeline (https://nf-co.re/rnaseq)). The pipeline provides several options, use the default setting with STAR8 as aligned and Salmon9 to quantify the transcript abundance.</li>
		<li>NOTE: For further bioinformatics analysis, several methods are available. It is not in the scope of this protocol to cover all (Recommended: DEseq2 pipeline10). A standard script based on the DEseq2 workflow developed by us can be found on GitHub (https://github.com/jsschrepping/RNA-DESeq2).</li>
	</ol>
	</li>
</ol>

Transcriptome Profiling for High-Throughput Drug Screening

<ol>
	<li>Hughes, J. P., Rees, S., Kalindjian, S. B., Philpott, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Principles+of+early+drug+discovery.">Principles of early drug discovery.</a> Br J Pharmacol. 162 (6), 1239-1249 (2011).</li><li>Yang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+transcriptome+profiling+in+drug+and+biomarker+discovery.">High-throughput transcriptome profiling in drug and biomarker discovery.</a> Front Genet. 11, 19 (2020).</li><li>Bonaguro, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+guide+to+systems-level+immunomics.">A guide to systems-level immunomics.</a> Nat Immunol. 23 (10), 1412-1423 (2022).</li><li>Carraro, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoding+mechanism+of+action+and+sensitivity+to+drug+candidates+from+integrated+transcriptome+and+chromatin+state.">Decoding mechanism of action and sensitivity to drug candidates from integrated transcriptome and chromatin state.</a> ELife. 11, 78012 (2022).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart-seq2+for+sensitive+full-length+transcriptome+profiling+in+single+cells.">Smart-seq2 for sensitive full-length transcriptome profiling in single cells.</a> Nat Methods. 10 (11), 1096-1098 (2013).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-length+RNA-seq+from+single+cells+using+Smart-seq2.">Full-length RNA-seq from single cells using Smart-seq2.</a> Nat Protoc. 9 (1), 171-181 (2014).</li><li>De Domenico, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+workflow+for+single-cell+transcriptomics+on+infectious+diseases+including+COVID-19.">Optimized workflow for single-cell transcriptomics on infectious diseases including COVID-19.</a> STAR Protoc. 1 (3), 100233 (2020).</li><li>Dobin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ultrafast+universal+RNA-seq+aligner.">ultrafast universal RNA-seq aligner.</a> Bioinformatics. 29 (1), 15-21 (2013).</li><li>Patro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salmon+provides+fast+and+bias-aware+quantification+of+transcript+expression.">Salmon provides fast and bias-aware quantification of transcript expression.</a> Nat Methods. 14 (4), 417-419 (2017).</li><li>Love, M. I., Huber, W., Anders, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Moderated+estimation+of+fold+change+and+dispersion+for+RNA-seq+data+with+DESeq2.">Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.</a> Genome Biol. 15 (12), 550 (2014).</li><li>Frankish, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GENCODE+reference+annotation+for+the+human+and+mouse+genomes.">GENCODE reference annotation for the human and mouse genomes.</a> Nucleic Acids Res. 47, D766-D773 (2019).</li></ol>

The authors declare no competing interests.

Drug discovery and drug development can greatly benefit from the holistic view of cellular processes that bulk transcriptomics can provide. Nevertheless, this approach is often limited by the high cost of the experiment with standard bulk RNA-seq protocol, prohibiting its application in academic settings as well as its potential for industrial scalability.
The most critical steps of the protocol are cell thawing and the initial steps of library preparation. Ensuring high viability of the cells...

The development of new drugs is a complex and time-consuming process that involves identifying potential drugs and their targets, optimizing and synthesizing drug candidates, and testing their efficacy and safety in preclinical and clinical trials1. Traditional methods for drug screening, i.e., the systematic assessment of libraries of candidate compounds for therapeutic purposes, involve the use of animal models or cell-based assays to test the effects on specific targets or pathways. While these methods have been successful in identifying drug candidates, they often did not provide sufficient insights into the complex molecular mechanisms underlying drug efficacy and also toxicity and mechanisms of potential side effects.
Assessing genome-wide transcriptional states presents a powerful approach to overcome current limitations in drug screening, as it enables comprehensive assessments of gene expression in response to drug treatments2. By measuring RNA transcripts in a genome-wide fashion expressed at a given time, transcriptomics aims to provide a holistic view of the transcriptional changes that occur in response to drugs, including changes in gene expression patterns, alternative splicing, and non-coding RNA expression3. This information can be used to determine drug targets, predict drug efficacy and toxicity, and optimize drug dosing and treatment regimens.
One of the key benefits of combining transcriptomics with unbiased drug screening is the potential to identify new drug targets that have not been previously considered. Conventional drug screening approaches often focus on established target molecules or pathways, hindering the identification of new targets and potentially resulting in drugs with unforeseen side effects and restricted effectiveness. Transcriptomics can overcome these limitations by providing insights into the molecular changes that occur in response to drug treatment, uncovering potential targets or pathways that may not have been previously considered2.
In addition to the identification of new drug targets, transcriptomics can also be used to predict drug efficacy and toxicity. By analyzing the gene expression patterns associated with drug responses, biomarkers can be developed that can be used to predict a patient's response to a particular drug or treatment regimen. This can also help to optimize drug dosing and reduce the risk of adverse side effects4.
Despite its potential benefits, the cost of transcriptomics remains a significant barrier to its widespread application in drug screening. Transcriptomic analysis requires specialized equipment, technical expertise, and data analysis, which can make it challenging for smaller research teams or organizations with limited funding to utilize transcriptomics in drug screening. However, the cost of transcriptomics has been steadily decreasing, making it more accessible to the research communities. Additionally, advancements in technology and data analysis methods have made transcriptomics more efficient and cost-effective, further increasing its accessibility2.
In this protocol, we describe a high-dimensional and explorative system for transcriptome-based drug screening, combining miniaturized perturbation cultures with mini-bulk transcriptomics analysis5,6. With this protocol, it is possible to reduce the cost per sample to 1/6th of the current cost of commercial solutions for full-length mRNA sequencing. The protocol requires only standard laboratory equipment, the only exception being the use of short-read sequencing technologies, which can be outsourced if sequencing instruments are not available in-house. The optimized mini-bulk protocol provides information-rich biological signals at cost-effective sequencing depth, enabling extensive screening of known drugs and new molecules.
The aim of the experiment is to screen for drug activity on PBMCs in different biological contexts. This protocol can be applied to any biological question where several drugs should be tested with a transcriptomic readout, giving a transcriptome-wide view of the cellular effect of the treatment.

<table><tbody><tr><td>50 mL conical tube</td><td>fisher scientific</td><td>10203001</td><td></td></tr><tr><td>Adhesive PCR Plate Seals</td><td>Thermo Fisher Scientific</td><td>AB0558</td><td></td></tr><tr><td>Amplicon Tagment Mix (ATM)</td><td>Illumina</td><td>FC-131-1096</td><td>Nextera XT DNA Library Prep Kit (96 samples)</td></tr><tr><td>AMPure XP beads</td><td>Beckman Coulter</td><td>A 63881</td><td></td></tr><tr><td>Betaine&amp;nbsp;</td><td>Sigma-Aldrich</td><td>61962</td><td></td></tr><tr><td>Cell culture grade 96-well plates</td><td>Thermo Fisher Scientific</td><td>260860</td><td></td></tr><tr><td>Cell culture vacuum pump (VACUSAFE)</td><td>Integra Bioscience</td><td>158300</td><td></td></tr><tr><td>Deoxynucleotide triphosphates (dNTPs) mix 10 mM each</td><td>Fermentas</td><td>R0192</td><td></td></tr><tr><td>DMSO</td><td>Sigma-Aldrich</td><td>276855</td><td></td></tr><tr><td>DTT (100 mM)</td><td>Invitrogen</td><td>18064-014</td><td></td></tr><tr><td>EDTA</td><td>Sigma-Aldrich</td><td>798681</td><td>for adherent cells</td></tr><tr><td>Ethanol</td><td>Sigma-Aldrich</td><td>51976</td><td></td></tr><tr><td>Fetal Bovine Serum</td><td>Thermo Fisher Scientific</td><td>26140079</td><td></td></tr><tr><td>Filter tips (10 &amp;micro;L)</td><td>Gilson&amp;nbsp;</td><td>F171203</td><td></td></tr><tr><td>Filter tips (100 &amp;micro;L)</td><td>Gilson&amp;nbsp;</td><td>F171403</td><td></td></tr><tr><td>Filter tips (20 &amp;micro;L)</td><td>Gilson&amp;nbsp;</td><td>F171303</td><td></td></tr><tr><td>Filter tips (200 &amp;micro;L)</td><td>Gilson&amp;nbsp;</td><td>F171503</td><td></td></tr><tr><td>Guanidine Hydrochloride</td><td>Sigma-Aldrich</td><td>G3272</td><td></td></tr><tr><td>ISPCR primer (10 &amp;micro;M)</td><td>Biomers.net GmbH</td><td>SP10006</td><td>5&amp;prime;-AAGCAGTGGTATCAACGCAGAG&lt;br/&gt; T-3&amp;prime;</td></tr><tr><td>KAPA HiFi HotStart ReadyMix (2X)</td><td>KAPA Biosystems</td><td>KK2601</td><td></td></tr><tr><td>Magnesium chloride (MgCl2)&amp;nbsp;</td><td>Sigma-Aldrich</td><td>M8266</td><td></td></tr><tr><td>Magnetic stand 96</td><td>Ambion</td><td>AM10027</td><td></td></tr><tr><td>Neutralize Tagment (NT) Buffer&amp;nbsp;</td><td>Illumina</td><td>FC-131-1096</td><td>Nextera XT DNA Library Prep Kit (96 samples), alternatively 0.2 % SDS</td></tr><tr><td>Nextera-compatible indexing primer</td><td>Illumina</td><td></td><td></td></tr><tr><td>Nuclease-free water</td><td>Invitrogen</td><td>10977049</td><td></td></tr><tr><td>PBS</td><td>Thermo Fisher Scientific</td><td>AM9624</td><td></td></tr><tr><td>PCR 96-well plates</td><td>Thermo Fisher Scientific</td><td>AB0600</td><td></td></tr><tr><td>PCR plate sealer</td><td>Thermo Fisher Scientific</td><td>HSF0031</td><td></td></tr><tr><td>Penicillin / Streptomycin&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>15070063</td><td></td></tr><tr><td>Qubit 4 fluorometer</td><td>Invitrogen</td><td>15723679</td><td></td></tr><tr><td>Recombinant RNase inhibitor (40 U/ul)</td><td>TAKARA</td><td>2313A</td><td></td></tr><tr><td>RPMI-1640 cell culture medium&amp;nbsp;</td><td>Gibco</td><td>61870036</td><td>If not working with PBMCs, adjust to cell type&amp;nbsp;</td></tr><tr><td>SMART dT30VN primer</td><td>Sigma-Aldrich</td><td></td><td>5&#039; Bio-AAGCAGTGGTATCAACGCAGAG&lt;br/&gt; TACT30VN-3</td></tr><tr><td>Standard lab equipment</td><td>various</td><td>various</td><td>e.g. centrifuge, ice machine, ice bucket, distilled water, water bath</td></tr><tr><td>SuperScript II Reverse Transcriptase (SSRT II)</td><td>Thermo Fisher Scientific</td><td>18064-014</td><td></td></tr><tr><td>SuperScript II Reverse Transcriptase (SSRT II) buffer (5x)</td><td>Thermo Fisher Scientific</td><td>18064-014</td><td></td></tr><tr><td>Tagment DNA Buffer (TD)</td><td>Illumina</td><td>FC-131-1096</td><td>Nextera XT DNA Library Prep Kit (96 samples)</td></tr><tr><td>TapeStation system 4200</td><td>Agilent</td><td>G2991BA</td><td></td></tr><tr><td>Thermocycler (S1000)</td><td>Bio-Rad</td><td>1852148</td><td></td></tr><tr><td>TSO-LNA (100 uM)</td><td>Eurogentec</td><td></td><td>5&#039; Biotin AAGCAGTGGTATCAACGCAGAG&lt;br/&gt; TACAT(G)(G){G</td></tr><tr><td>Vortex-Genie 2 Mixer</td><td>Sigma-Aldrich</td><td>Z258415</td><td></td></tr></tbody></table>

cost-efficient transcriptomic-based drug screening

Transcriptomics allows&#160;to obtain comprehensive insights into cellular programs and their responses to perturbations. Despite a significant decrease in the costs of library production and sequencing in the last decade, applying these technologies at the scale necessary for drug screening remains prohibitively expensive, obstructing the immense potential of these methods. Our study presents a cost-effective system for transcriptome-based drug screening, combining miniaturized perturbation cultures with mini-bulk transcriptomics. The optimized mini-bulk protocol provides informative biological signals at cost-effective sequencing depth, enabling extensive screening of known drugs and new molecules. Depending on the chosen treatment and incubation time, this protocol will result in sequencing libraries within approximately 2 days. Due to several stopping points within this protocol, the library preparation, as well as the sequencing, can be performed time-independently. Processing simultaneously a high number of samples is possible; measurement of up to 384 samples was tested without loss of data quality. There are also no known limitations to the number of conditions and/or drugs, despite considering variability in optimal drug incubation times.

Following the reported protocol, human PBMCs were seeded, treated with different immunomodulatory drugs and, after different incubation times, harvested for bulk transcriptomic analysis using the sequencing protocol (Figure 1).
Ideal drug concentrations and incubation times for test compounds should be identified upstream this protocol with the help of complementary experimental strategies and based on the specific scientific question. In most cases, 2 - 4 h and 2...

Watch this Scientific Journal Video about Cost-Effective Transcriptomic Drug Screening — Unlocking New Targets at JoVE.com

Author Spotlight: Cost-Effective Transcriptomic Drug Screening - Unlocking New Targets 

This protocol describes a workflow from ex vivo or in vitro cell cultures to transcriptomic data pre-processing for cost-effective transcriptome-based drug screening.

Cost-Efficient Transcriptomic-Based Drug Screening

Transcriptomics allows&#160;to obtain comprehensive insights into cellular programs and their responses to perturbations. Despite a significant decrease ...

cost-efficient-transcriptomic-based-drug-screening

Research

JoVE Journal

Biology

1.2K Views.  German Center for Neurodegenerative Diseases (DZNE) eV.. Transcriptomics stelt ons in staat om een diepgaand begrip te krijgen van cellulaire programma's en hun reactie op externe veranderingen. Ondanks een aanzienlijke vermindering van de productie- en sequencingkosten van bibliotheken in de afgelopen decennia, is de toepassing van deze technologie, op de schaal die nodig is voor het screenen van geneesmiddelen, nog steeds onbetaalbaar, waardoor het grote potentieel van deze methoden wordt belemmerd. Onze studie presenteert een kosteneffectief sys...

Video: Auteur in de schijnwerpers: Kosteneffectieve transcriptomische screening van geneesmiddelen - Nieuwe doelen ontgrendelen 

Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact&#160;virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.

Here we describe a protocol for employing high-throughput RNAi screening to uncover host targets that can be manipulated to enhance oncolytic virus therapy, specifically rhabodvirus and vaccinia virus therapy, but it can be readily adapted to other oncolytic virus platforms or for discovering host genes that modulate virus replication generally.

High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact&#160;virus ...

Cancer Research

High Content Screening in Neurodegenerative Diseases

The functional annotation of genomes, construction of molecular networks and novel drug target identification, are important challenges that need to be addressed as a matter of great urgency1-4. Multiple complementary 'omics' approaches have provided clues as to the genetic risk factors and pathogenic mechanisms underlying numerous neurodegenerative diseases, but most findings still require functional validation5. For example, a recent genome wide association study for Parkinson's Disease (PD), identified many new loci as risk factors for the disease, but the underlying causative variant(s) or pathogenic mechanism is not known6, 7. As each associated region can contain several genes, the functional evaluation of each of the genes on phenotypes associated with the disease, using traditional cell biology techniques would take too long. 
	There is also a need to understand the molecular networks that link genetic mutations to the phenotypes they cause. It is expected that disease phenotypes are the result of multiple interactions that have been disrupted. Reconstruction of these networks using traditional molecular methods would be time consuming. Moreover, network predictions from independent studies of individual components, the reductionism approach, will probably underestimate the network complexity8. This underestimation could, in part, explain the low success rate of drug approval due to undesirable or toxic side effects. Gaining a network perspective of disease related pathways using HT/HC cellular screening approaches, and identifying key nodes within these pathways, could lead to the identification of targets that are more suited for therapeutic intervention.
	High-throughput screening (HTS) is an ideal methodology to address these issues9-12. but traditional methods were one dimensional whole-well cell assays, that used simplistic readouts for complex biological processes. They were unable to simultaneously quantify the many phenotypes observed in neurodegenerative diseases such as axonal transport deficits or alterations in morphology properties13, 14. This approach could not be used to investigate the dynamic nature of cellular processes or pathogenic events that occur in a subset of cells. To quantify such features one has to move to multi-dimensional phenotypes termed high-content screening (HCS)4, 15-17. HCS is the cell-based quantification of several processes simultaneously, which provides a more detailed representation of the cellular response to various perturbations compared to HTS. 
	HCS has many advantages over HTS18, 19, but conducting a high-throughput (HT)-high-content (HC) screen in neuronal models is problematic due to high cost, environmental variation and human error. In order to detect cellular responses on a 'phenomics' scale using HC imaging one has to reduce variation and error, while increasing sensitivity and reproducibility. 
	Herein we describe a method to accurately and reliably conduct shRNA screens using automated cell culturing20 and HC imaging in neuronal cellular models. We describe how we have used this methodology to identify modulators for one particular protein, DJ1, which when mutated causes autosomal recessive parkinsonism21. 
	Combining the versatility of HC imaging with HT methods, it is possible to accurately quantify a plethora of phenotypes. This could subsequently be utilized to advance our understanding of the genome, the pathways involved in disease pathogenesis as well as identify potential therapeutic targets.

We describe a methodology combining automated cell culturing with high-content imaging to visualize and quantify multiple cellular processes and structures, in a high-throughput manner. Such methods can aid in the further functional annotation of genomes as well as identify disease gene networks and potential drug targets.

The functional annotation of genomes, construction of molecular networks and novel drug target identification, are important challenges that need to be ...

Medicine

Pooled CRISPR-Based Genetic Screens in Mammalian Cells

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian cells, this technology represents a novel means to perform genome-wide genetic screens for functional genomics studies. Libraries of guide RNAs (sgRNA) targeting all open reading frames permit the facile generation of thousands of genetic perturbations in a single pool of cells that can be screened for specific phenotypes to implicate gene function and cellular processes in an unbiased and systematic way. CRISPR-Cas screens provide researchers with a simple, efficient, and inexpensive method to uncover the genetic blueprints for cellular phenotypes. Furthermore, differential analysis of screens performed in various cell lines and from different cancer types can identify genes that are contextually essential in tumor cells, revealing potential targets for specific anticancer therapies. Performing genome-wide screens in human cells can be daunting, as this involves the handling of tens of millions of cells and requires analysis of large sets of data. The details of these screens, such as cell line characterization, CRISPR library considerations, and understanding the limitations and capabilities of CRISPR technology during analysis, are often overlooked. Provided here is a detailed protocol for the successful performance of pooled genome-wide CRISPR-Cas9 based screens.

CRISPR-Cas9 technology provides an efficient method to precisely edit the mammalian genome in any cell type and represents a novel means to perform genome-wide genetic screens. A detailed protocol discussing the steps required for the successful performance of pooled genome-wide CRISPR-Cas9 screens is provided here.

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian ...

Genetics

Drug-induced Sensitization of Adenylyl Cyclase: Assay Streamlining and Miniaturization for Small Molecule and siRNA Screening Applications

Sensitization of adenylyl cyclase (AC) signaling has been implicated in a variety of neuropsychiatric and neurologic disorders including substance abuse and Parkinson&#39;s disease. Acute activation of G&#945;i/o-linked receptors inhibits AC activity, whereas persistent activation of these receptors results in heterologous sensitization of AC and increased levels of intracellular cAMP. Previous studies have demonstrated that this enhancement of AC responsiveness is observed both in vitro and in vivo following the chronic activation of several types of G&#945;i/o-linked receptors including D2 dopamine and &#956; opioid receptors. Although heterologous sensitization of AC was first reported four decades ago, the mechanism(s) that underlie this phenomenon remain largely unknown. The lack of mechanistic data presumably reflects the complexity involved with this adaptive response, suggesting that nonbiased approaches could aid in identifying the molecular pathways involved in heterologous sensitization of AC. Previous studies have implicated kinase and Gb&#947; signaling as overlapping components that regulate the heterologous sensitization of AC. To identify unique and additional overlapping targets associated with sensitization of AC, the development and validation of a scalable cAMP sensitization assay is required for greater throughput. Previous approaches to study sensitization are generally cumbersome involving continuous cell culture maintenance as well as a complex methodology for measuring cAMP accumulation that involves multiple wash steps. Thus, the development of a robust cell-based assay that can be used for high throughput screening (HTS) in a 384&#160;well format would facilitate future studies. Using two D2 dopamine receptor cellular models (i.e.&#160;CHO-D2L and HEK-AC6/D2L), we have converted our 48-well sensitization assay (&#62;20 steps 4-5 days) to a five-step, single day assay in 384-well format. This new format is amenable to small molecule screening, and we demonstrate that this assay design can also be readily used for reverse transfection of siRNA in anticipation of targeted siRNA library screening.

Persistent activation of inhibitory G protein-coupled receptors results in sensitization of adenylyl cyclase signaling. To identify the essential molecular pathways, nonbiased approaches are necessary; however, this strategy requires the development of a scalable cell-based cAMP sensitization assay. Herein, we describe a sensitization assay for small molecule and siRNA screening.

Sensitization of adenylyl cyclase (AC) signaling has been implicated in a variety of neuropsychiatric and neurologic disorders including substance abuse ...

Bioengineering

Identification of Transcription Factor Regulators using Medium-Throughput Screening of Arrayed Libraries and a Dual-Luciferase-Based Reporter

Transcription factors can alter the expression of numerous target genes that influence a variety of downstream processes making them good targets for anti-cancer therapies. However, directly targeting transcription factors is often difficult and can cause adverse side effects if the transcription factor is necessary in one or more adult tissues. Identifying upstream regulators that aberrantly activate transcription factors in cancer cells offers a more feasible alternative, particularly if these proteins are easy to drug. Here, we describe a protocol that can be used to combine arrayed medium-scale lentiviral libraries and a dual-luciferase-based transcriptional reporter assay to identify novel regulators of transcription factors in cancer cells. Our approach offers a quick, easy, and inexpensive way to test hundreds of genes in a single experiment. To demonstrate the use of this approach, we performed a screen of an arrayed lentiviral RNAi library containing several regulators of Yes-associated protein (YAP) and transcriptional co-activator with PDZ-binding motif (TAZ), two transcriptional co-activators that are the downstream effectors of the Hippo pathway. However, this approach could be modified to screen for regulators of virtually any transcription factor or co-factor and could also be used to screen CRISPR/CAS9, cDNA, or ORF libraries.

To identify novel regulators of transcription factors, we developed an approach to screen arrayed lentiviral or retroviral RNAi libraries using a dual-luciferase-based transcriptional reporter assay. This approach offers a quick and relatively inexpensive way to screen hundreds of candidates in a single experiment.

Transcription factors can alter the expression of numerous target genes that influence a variety of downstream processes making them good targets for ...

A Multiplexed Luciferase-based Screening Platform for Interrogating Cancer-associated Signal Transduction in Cultured Cells

Genome-scale interrogation of gene function using RNA interference (RNAi) holds tremendous promise for the rapid identification of chemically tractable cancer cell vulnerabilities. Limiting the potential of this technology is the inability to rapidly delineate the mechanistic basis of phenotypic outcomes and thus inform the development of molecularly targeted therapeutic strategies. We outline here methods to deconstruct cellular phenotypes induced by RNAi-mediated gene targeting using multiplexed reporter systems that allow monitoring of key cancer cell-associated processes. This high-content screening methodology is versatile and can be readily adapted for the screening of other types of large molecular libraries.

Achieving a systems level understanding of cellular processes is a goal of modern-day cell biology. We describe here strategies for multiplexing luciferase reporters of various cellular function end-points to interrogate gene function using genome-scale RNAi libraries.

Genome-scale interrogation of gene function using RNA interference (RNAi)  holds tremendous promise for the rapid identification of chemically tractable  ...

A Microscopic Phenotypic Assay for the Quantification of Intracellular Mycobacteria Adapted for High-throughput/High-content Screening

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since several decades, the sudden burst of multi- and extensively-drug resistant strains is a serious threat for the control of tuberculosis. Therefore, it is essential to identify new targets and pathways critical for the causative agent of the tuberculosis, Mycobacterium tuberculosis (Mtb) and to search for novel chemicals that could become TB drugs. One approach is to set&#160;up methods suitable for the genetic and chemical screens of large scale libraries enabling the search of a needle in a haystack. To this end, we developed a phenotypic assay relying on the detection of fluorescently labeled Mtb within fluorescently labeled host&#160;cells using automated confocal microscopy. This in vitro assay allows an image based quantification of the colonization process of Mtb&#160;into the host and was optimized for the 384-well microplate format, which is proper for screens of siRNA-, chemical compound- or Mtb mutant-libraries. The images are then processed for multiparametric analysis, which provides read&#160;out inferring on the pathogenesis of Mtb&#160;within host cells.

Here, we describe a phenotypic assay applicable to the High-throughput/High-content screens of small-interfering synthetic RNA (siRNA), chemical compound, and Mycobacterium tuberculosis mutant libraries. This method relies on the detection of fluorescently labeled Mycobacterium tuberculosis within fluorescently labeled host&#160;cell using automated confocal microscopy.

Despite the availability of therapy and vaccine, tuberculosis (TB) remains one of the most deadly and widespread bacterial infections in the world. Since ...

Immunology and Infection

Pooled shRNA Library Screening to Identify Factors that Modulate a Drug Resistance Phenotype

Understanding clinically relevant driver mechanisms of acquired chemo-resistance is crucial for elucidating ways to circumvent resistance and improve survival in patients with acute myeloid leukemia (AML). A small fraction of leukemic cells that survive chemotherapy have a poised epigenetic state to tolerate chemotherapeutic insult. Further exposure to chemotherapy allows these drug persister cells to attain a fixed epigenetic state, which leads to altered gene expression, resulting in the proliferation of these drug-resistant populations and eventually relapse or refractory disease. Therefore, identifying epigenetic modulations that necessitate the survival of drug-resistant leukemic cells is critical. We detail a protocol to identify epigenetic modulators that mediate resistance to the nucleoside analog cytarabine (AraC) using pooled shRNA library screening in an acquired cytarabine-resistant AML cell line. The library consists of 5,485 shRNA constructs targeting 407 human epigenetic factors, which allows high-throughput epigenetic factor screening.

High-throughput RNA interference (RNAi) screening using a pool of lentiviral shRNAs can be a tool to detect therapeutically relevant synthetic lethal targets in malignancies. We provide a pooled shRNA screening approach to investigate the epigenetic effectors in acute myeloid leukemia (AML).

Understanding clinically relevant driver mechanisms of acquired chemo-resistance is crucial for elucidating ways to circumvent resistance and improve ...

Genome-Scale Screening to Identify and Compare Therapeutic Targets in Tumors

Genetic Profiling and Genome-Scale Dropout Screening to Identify Therapeutic Targets in Mouse Models of Malignant Peripheral Nerve Sheath Tumor

Malignant Peripheral Nerve Sheath Tumors (MPNSTs) are derived from Schwann cells or their precursors. In patients with the tumor susceptibility syndrome neurofibromatosis type 1 (NF1), MPNSTs are the most common malignancy and the leading cause of death. These rare and aggressive soft-tissue sarcomas offer a stark future, with 5-year disease-free survival rates of 34-60%. Treatment options for individuals with MPNSTs are disappointingly limited, with disfiguring surgery being the foremost treatment option. Many once-promising therapies such as tipifarnib, an inhibitor of Ras signaling, have failed clinically. Likewise, phase II clinical trials with erlotinib, which targets the epidermal growth factor (EFGR), and sorafenib, which targets the vascular endothelial growth factor receptor (VEGF), platelet-derived growth factor receptor (PDGF), and Raf, in combination with standard chemotherapy, have also failed to produce a response in patients. 
In recent years, functional genomic screening methods combined with genetic profiling of cancer cell lines have proven useful for identifying essential cytoplasmic signaling pathways and the development of target-specific therapies. In the case of rare tumor types, a variation of this approach known as cross-species comparative oncogenomics is increasingly being used to identify novel therapeutic targets. In cross-species comparative oncogenomics, genetic profiling and functional genomics are performed in genetically engineered mouse (GEM) models and the results are then validated in the rare human specimens and cell lines that are available. 
This paper describes how to identify candidate driver gene mutations in human and mouse MPNST cells using whole exome sequencing (WES). We then describe how to perform genome-scale shRNA screens to identify and compare critical signaling pathways in mouse and human MPNST cells and identify druggable targets in these pathways. These methodologies provide an effective approach to identifying new therapeutic targets in a variety of human cancer types.

Author Spotlight: Finding New Therapeutic Targets for Malignant Peripheral Nerve Sheath Tumor Through Genome-Scale shRNA Screens 

We have developed a cross-species comparative oncogenomics approach utilizing genomic analyses and functional genomic screens to identify and compare therapeutic targets in tumors arising in genetically engineered mouse models and the corresponding human tumor type.

Malignant Peripheral Nerve Sheath Tumors (MPNSTs) are derived from Schwann cells or their precursors. In patients with the tumor susceptibility syndrome ...

A Fluorescence-based Lymphocyte Assay Suitable for High-throughput Screening of Small Molecules

High-throughput screening (HTS) is currently the mainstay for the identification of chemical entities capable of modulating biochemical reactions or cellular processes. With the advancement of biotechnologies and the high translational potential of small molecules, a number of innovative approaches in drug discovery have evolved, which explains the resurgent interest in the use of HTS. The oncology field is currently the most active research area for drug screening, with no major breakthrough made for the identification of new immunomodulatory compounds targeting transplantation-related complications or autoimmune ailments. Here, we present a novel in vitro murine fluorescent-based lymphocyte assay easily adapted for the identification of new immunomodulatory compounds. This assay uses T or B cells derived from a transgenic mouse, in which the Nur77 promoter drives GFP expression upon T- or B-cell receptor stimulation. As the GFP intensity reflects the activation/transcriptional activity of the target cell, our assay defines a novel tool to study the effect of given compound(s) on cellular/biological responses. For instance, a primary screening was performed using 4,398 compounds in the absence of a &#34;target hypothesis&#34;, which led to the identification of 160 potential hits displaying immunomodulatory activities. Thus, the use of this assay is suitable for drug discovery programs exploring large chemical libraries prior to further in vitro/in vivo validation studies.

We present in the current study a novel fluorescence-based assay using lymphocytes derived from a transgenic mouse. This assay is suitable for high-throughput screening (HTS) of small molecules endowed with the capacity of either inhibiting or promoting lymphocyte activation.

High-throughput screening (HTS) is currently the mainstay for the identification of chemical entities capable of modulating biochemical reactions or ...

Cost-Efficient Transcriptomic-Based Drug Screening

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video