يتم دعم JLS من قبل مؤسسة الأبحاث الألمانية (DFG) في إطار استراتيجية التميز الألمانية (EXC2151-390873048) ، وكذلك بموجب SCHU 950 / 8-1 ؛ GRK 2168 ، TP11 ؛ CRC SFB 1454 Metaflammation ، IRTG GRK 2168 ، WGGC INST 216/981-1 ، CCU INST 217/988-1 ، مشروع التميز الممول من BMBF النظام الغذائي - الجسم - الدماغ (DietBB) ؛ ومشروع الاتحاد الأوروبي SYSCID بموجب المنحة رقم 733100. MBمدعوم من DFG (IRTG2168-272482170 ، SFB1454-432325352). L.B. مدعوم من DFG (ImmuDiet BO 6228 / 2-1 - رقم المشروع 513977171) واستراتيجية التميز الألمانية (EXC2151-390873048). الصور التي تم إنشاؤها باستخدام BioRender.com.

التنميط الترانسكريبتوم لفحص الأدوية عالية الإنتاجية

<ol>
	<li>Hughes, J. P., Rees, S., Kalindjian, S. B., Philpott, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Principles+of+early+drug+discovery.">Principles of early drug discovery.</a> Br J Pharmacol. 162 (6), 1239-1249 (2011).</li><li>Yang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+transcriptome+profiling+in+drug+and+biomarker+discovery.">High-throughput transcriptome profiling in drug and biomarker discovery.</a> Front Genet. 11, 19 (2020).</li><li>Bonaguro, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+guide+to+systems-level+immunomics.">A guide to systems-level immunomics.</a> Nat Immunol. 23 (10), 1412-1423 (2022).</li><li>Carraro, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decoding+mechanism+of+action+and+sensitivity+to+drug+candidates+from+integrated+transcriptome+and+chromatin+state.">Decoding mechanism of action and sensitivity to drug candidates from integrated transcriptome and chromatin state.</a> ELife. 11, 78012 (2022).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Smart-seq2+for+sensitive+full-length+transcriptome+profiling+in+single+cells.">Smart-seq2 for sensitive full-length transcriptome profiling in single cells.</a> Nat Methods. 10 (11), 1096-1098 (2013).</li><li>Picelli, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Full-length+RNA-seq+from+single+cells+using+Smart-seq2.">Full-length RNA-seq from single cells using Smart-seq2.</a> Nat Protoc. 9 (1), 171-181 (2014).</li><li>De Domenico, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+workflow+for+single-cell+transcriptomics+on+infectious+diseases+including+COVID-19.">Optimized workflow for single-cell transcriptomics on infectious diseases including COVID-19.</a> STAR Protoc. 1 (3), 100233 (2020).</li><li>Dobin, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ultrafast+universal+RNA-seq+aligner.">ultrafast universal RNA-seq aligner.</a> Bioinformatics. 29 (1), 15-21 (2013).</li><li>Patro, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Salmon+provides+fast+and+bias-aware+quantification+of+transcript+expression.">Salmon provides fast and bias-aware quantification of transcript expression.</a> Nat Methods. 14 (4), 417-419 (2017).</li><li>Love, M. I., Huber, W., Anders, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Moderated+estimation+of+fold+change+and+dispersion+for+RNA-seq+data+with+DESeq2.">Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.</a> Genome Biol. 15 (12), 550 (2014).</li><li>Frankish, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GENCODE+reference+annotation+for+the+human+and+mouse+genomes.">GENCODE reference annotation for the human and mouse genomes.</a> Nucleic Acids Res. 47, D766-D773 (2019).</li></ol>

يعلن المؤلفون عدم وجود مصالح متنافسة.

يمكن أن يستفيد اكتشاف الأدوية وتطوير الأدوية بشكل كبير من النظرة الشاملة للعمليات الخلوية التي يمكن أن توفرها النسخ السائبة. ومع ذلك ، غالبا ما يكون هذا النهج محدودا بسبب التكلفة العالية للتجربة مع بروتوكول RNA-seq القياسي السائب ، مما يحظر تطبيقه في البيئات الأكاديمية بالإضافة إلى إمكانية ...

يعد تطوير عقاقير جديدة عملية معقدة وتستغرق وقتا طويلا وتتضمن تحديد الأدوية المحتملة وأهدافها ، وتحسين وتوليف الأدوية المرشحة ، واختبار فعاليتها وسلامتها في التجارب قبل السريرية والسريرية1. تتضمن الطرق التقليدية لفحص الأدوية ، أي التقييم المنهجي لمكتبات المركبات المرشحة للأغراض العلاجية ، استخدام نماذج حيوانية أو مقايسات قائمة على الخلايا لاختبار التأثيرات على أهداف أو مسارات محددة. في حين أن هذه الطرق كانت ناجحة في تحديد الأدوية المرشحة ، إلا أنها في كثير من الأحيان لم تقدم رؤى كافية حول الآليات الجزيئية المعقدة الكامنة وراء فعالية الدواء وكذلك السمية وآليات الآثار الجانبية المحتملة.
يقدم تقييم حالات النسخ على مستوى الجينوم نهجا قويا للتغلب على القيود الحالية في فحص الأدوية ، لأنه يتيح إجراء تقييمات شاملة للتعبير الجيني استجابة للعلاجات الدوائية2. من خلال قياس نسخ الحمض النووي الريبي بطريقة على مستوى الجينوم يتم التعبير عنها في وقت معين ، يهدف علم النسخ إلى توفير نظرة شاملة للتغيرات النسخية التي تحدث استجابة للأدوية ، بما في ذلك التغيرات في أنماط التعبير الجيني ، والربط البديل ، وتعبير الحمض النووي الريبي غير المشفر3. يمكن استخدام هذه المعلومات لتحديد أهداف الأدوية ، والتنبؤ بفعالية الدواء وسميته ، وتحسين جرعات الأدوية وأنظمة العلاج.
تتمثل إحدى الفوائد الرئيسية للجمع بين علم النسخ وفحص الأدوية غير المتحيز في إمكانية تحديد أهداف دوائية جديدة لم يتم النظر فيها من قبل. غالبا ما تركز مناهج فحص الأدوية التقليدية على الجزيئات أو المسارات المستهدفة المحددة ، مما يعيق تحديد أهداف جديدة ويحتمل أن يؤدي إلى عقاقير ذات آثار جانبية غير متوقعة وفعالية محدودة. يمكن لعلم النسخ التغلب على هذه القيود من خلال تقديم نظرة ثاقبة للتغيرات الجزيئية التي تحدث استجابة للعلاج الدوائي ، والكشف عن الأهداف أو المسارات المحتملة التي ربما لم يتم النظر فيها سابقا2.
بالإضافة إلى تحديد أهداف دوائية جديدة ، يمكن أيضا استخدام علم النسخ للتنبؤ بفعالية الدواء وسميته. من خلال تحليل أنماط التعبير الجيني المرتبطة بالاستجابات الدوائية ، يمكن تطوير المؤشرات الحيوية التي يمكن استخدامها للتنبؤ باستجابة المريض لدواء معين أو نظام علاج. يمكن أن يساعد هذا أيضا في تحسين جرعات الدواء وتقليل مخاطر الآثار الجانبية الضارة4.
على الرغم من فوائدها المحتملة ، لا تزال تكلفة النسخ تشكل عائقا كبيرا أمام تطبيقها على نطاق واسع في فحص المخدرات. يتطلب تحليل النسخ معدات متخصصة وخبرة فنية وتحليل البيانات ، مما قد يجعل من الصعب على فرق البحث الأصغر أو المنظمات ذات التمويل المحدود استخدام علم النسخ في فحص الأدوية. ومع ذلك ، فإن تكلفة النسخ آخذة في الانخفاض بشكل مطرد ، مما يجعلها في متناول مجتمعات البحث. بالإضافة إلى ذلك ، جعلت التطورات في التكنولوجيا وطرق تحليل البيانات النسخ أكثر كفاءة وفعالية من حيث التكلفة ، مما زاد من إمكانية الوصول إليها2.
في هذا البروتوكول ، نصف نظاما استكشافيا عالي الأبعاد لفحص الأدوية القائم على النسخ ، ويجمع بين ثقافات الاضطراب المصغرة وتحليل النسخ السائبالمصغر 5,6. باستخدام هذا البروتوكول ، من الممكن تقليل تكلفة العينة إلى 1/6 من التكلفة الحالية للحلول التجارية لتسلسل mRNA كامل الطول. ولا يتطلب البروتوكول سوى معدات مختبرية قياسية، والاستثناء الوحيد هو استخدام تكنولوجيات تسلسل القراءة القصيرة، التي يمكن الاستعانة بمصادر خارجية إذا لم تكن أدوات التسلسل متاحة داخليا. يوفر بروتوكول الحجم الصغير المحسن إشارات بيولوجية غنية بالمعلومات على عمق تسلسل فعال من حيث التكلفة ، مما يتيح فحصا مكثفا للأدوية المعروفة والجزيئات الجديدة.
الهدف من التجربة هو فحص نشاط الدواء على PBMCs في سياقات بيولوجية مختلفة. يمكن تطبيق هذا البروتوكول على أي سؤال بيولوجي حيث يجب اختبار العديد من الأدوية باستخدام قراءة نسخية ، مما يعطي رؤية واسعة للنسخ للتأثير الخلوي للعلاج.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>50 mL conical tube</td>
			<td>fisher scientific</td>
			<td>10203001</td>
			<td></td>
		</tr>
		<tr>
			<td>Adhesive PCR Plate Seals</td>
			<td>Thermo Fisher Scientific</td>
			<td>AB0558</td>
			<td></td>
		</tr>
		<tr>
			<td>Amplicon Tagment Mix (ATM)</td>
			<td>Illumina</td>
			<td>FC-131-1096</td>
			<td>Nextera XT DNA Library Prep Kit (96 samples)</td>
		</tr>
		<tr>
			<td>AMPure XP beads</td>
			<td>Beckman Coulter</td>
			<td>A 63881</td>
			<td></td>
		</tr>
		<tr>
			<td>Betaine&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>61962</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture grade 96-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>260860</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture vacuum pump (VACUSAFE)</td>
			<td>Integra Bioscience</td>
			<td>158300</td>
			<td></td>
		</tr>
		<tr>
			<td>Deoxynucleotide triphosphates (dNTPs) mix 10 mM each</td>
			<td>Fermentas</td>
			<td>R0192</td>
			<td></td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Sigma-Aldrich</td>
			<td>276855</td>
			<td></td>
		</tr>
		<tr>
			<td>DTT (100 mM)</td>
			<td>Invitrogen</td>
			<td>18064-014</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Sigma-Aldrich</td>
			<td>798681</td>
			<td>for adherent cells</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Sigma-Aldrich</td>
			<td>51976</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Thermo Fisher Scientific</td>
			<td>26140079</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter tips (10 &#181;L)</td>
			<td>Gilson&#160;</td>
			<td>F171203</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter tips (100 &#181;L)</td>
			<td>Gilson&#160;</td>
			<td>F171403</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter tips (20 &#181;L)</td>
			<td>Gilson&#160;</td>
			<td>F171303</td>
			<td></td>
		</tr>
		<tr>
			<td>Filter tips (200 &#181;L)</td>
			<td>Gilson&#160;</td>
			<td>F171503</td>
			<td></td>
		</tr>
		<tr>
			<td>Guanidine Hydrochloride</td>
			<td>Sigma-Aldrich</td>
			<td>G3272</td>
			<td></td>
		</tr>
		<tr>
			<td>ISPCR primer (10 &#181;M)</td>
			<td>Biomers.net GmbH</td>
			<td>SP10006</td>
			<td>5&#8242;-AAGCAGTGGTATCAACGCAGAG 
			T-3&#8242;</td>
		</tr>
		<tr>
			<td>KAPA HiFi HotStart ReadyMix (2X)</td>
			<td>KAPA Biosystems</td>
			<td>KK2601</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium chloride (MgCl2)&#160;</td>
			<td>Sigma-Aldrich</td>
			<td>M8266</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic stand 96</td>
			<td>Ambion</td>
			<td>AM10027</td>
			<td></td>
		</tr>
		<tr>
			<td>Neutralize Tagment (NT) Buffer&#160;</td>
			<td>Illumina</td>
			<td>FC-131-1096</td>
			<td>Nextera XT DNA Library Prep Kit (96 samples), alternatively 0.2 % SDS</td>
		</tr>
		<tr>
			<td>Nextera-compatible indexing primer</td>
			<td>Illumina</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>Invitrogen</td>
			<td>10977049</td>
			<td></td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>Thermo Fisher Scientific</td>
			<td>AM9624</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR 96-well plates</td>
			<td>Thermo Fisher Scientific</td>
			<td>AB0600</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR plate sealer</td>
			<td>Thermo Fisher Scientific</td>
			<td>HSF0031</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin / Streptomycin&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>15070063</td>
			<td></td>
		</tr>
		<tr>
			<td>Qubit 4 fluorometer</td>
			<td>Invitrogen</td>
			<td>15723679</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant RNase inhibitor (40 U/ul)</td>
			<td>TAKARA</td>
			<td>2313A</td>
			<td></td>
		</tr>
		<tr>
			<td>RPMI-1640 cell culture medium&#160;</td>
			<td>Gibco</td>
			<td>61870036</td>
			<td>If not working with PBMCs, adjust to cell type&#160;</td>
		</tr>
		<tr>
			<td>SMART dT30VN primer</td>
			<td>Sigma-Aldrich</td>
			<td></td>
			<td>5&#39; Bio-AAGCAGTGGTATCAACGCAGAG 
			TACT30VN-3</td>
		</tr>
		<tr>
			<td>Standard lab equipment</td>
			<td>various</td>
			<td>various</td>
			<td>e.g. centrifuge, ice machine, ice bucket, distilled water, water bath</td>
		</tr>
		<tr>
			<td>SuperScript II Reverse Transcriptase (SSRT II)</td>
			<td>Thermo Fisher Scientific</td>
			<td>18064-014</td>
			<td></td>
		</tr>
		<tr>
			<td>SuperScript II Reverse Transcriptase (SSRT II) buffer (5x)</td>
			<td>Thermo Fisher Scientific</td>
			<td>18064-014</td>
			<td></td>
		</tr>
		<tr>
			<td>Tagment DNA Buffer (TD)</td>
			<td>Illumina</td>
			<td>FC-131-1096</td>
			<td>Nextera XT DNA Library Prep Kit (96 samples)</td>
		</tr>
		<tr>
			<td>TapeStation system 4200</td>
			<td>Agilent</td>
			<td>G2991BA</td>
			<td></td>
		</tr>
		<tr>
			<td>Thermocycler (S1000)</td>
			<td>Bio-Rad</td>
			<td>1852148</td>
			<td></td>
		</tr>
		<tr>
			<td>TSO-LNA (100 uM)</td>
			<td>Eurogentec</td>
			<td></td>
			<td>5&#39; Biotin AAGCAGTGGTATCAACGCAGAG 
			TACAT(G)(G){G</td>
		</tr>
		<tr>
			<td>Vortex-Genie 2 Mixer</td>
			<td>Sigma-Aldrich</td>
			<td>Z258415</td>
			<td></td>
		</tr>
	</tbody>
</table>

cost-efficient transcriptomic-based drug screening

يسمح Transcriptomics بالحصول على رؤى شاملة حول البرامج الخلوية واستجاباتها للاضطرابات. على الرغم من الانخفاض الكبير في تكاليف إنتاج المكتبات وتسلسلها في العقد الماضي ، فإن تطبيق هذه التقنيات على النطاق اللازم لفحص المخدرات لا يزال مكلفا للغاية ، مما يعيق الإمكانات الهائلة لهذه الأساليب. تقدم دراستنا نظاما فعالا من حيث التكلفة لفحص الأدوية القائم على النسخ ، ويجمع بين ثقافات الاضطراب المصغرة والنسخ السائبة الصغيرة. يوفر بروتوكول السائبة الصغيرة المحسن إشارات بيولوجية إعلامية على عمق تسلسل فعال من حيث التكلفة ، مما يتيح فحصا مكثفا للأدوية المعروفة والجزيئات الجديدة. اعتمادا على العلاج المختار ووقت الحضانة ، سيؤدي هذا البروتوكول إلى تسلسل المكتبات في غضون أيام 2 تقريبا. نظرا للعديد من نقاط التوقف داخل هذا البروتوكول ، يمكن إجراء إعداد المكتبة ، وكذلك التسلسل ، بشكل مستقل عن الوقت. معالجة عدد كبير من العينات في وقت واحد ممكن ؛ تم اختبار قياس ما يصل إلى 384 عينة دون فقدان جودة البيانات. لا توجد أيضا قيود معروفة على عدد الحالات و / أو الأدوية ، على الرغم من مراعاة التباين في أوقات حضانة الدواء المثلى.

The development of new drugs is a complex and time-consuming process that involves identifying potential drugs and their targets, optimizing and synthesizing drug candidates, and testing their efficacy and safety in preclinical and clinical trials1. Traditional methods for drug screening, i.e., the systematic assessment of libraries of candidate compounds for therapeutic purposes, involve the use of animal models or cell-based assays to test the effects on specific targets or pathways. While these methods have been successful in identifying drug candidates, they often did not provide sufficient insights into the complex molecular mechanisms underlying drug efficacy and also toxicity and mechanisms of potential side effects.
Assessing genome-wide transcriptional states presents a powerful approach to overcome current limitations in drug screening, as it enables comprehensive assessments of gene expression in response to drug treatments2. By measuring RNA transcripts in a genome-wide fashion expressed at a given time, transcriptomics aims to provide a holistic view of the transcriptional changes that occur in response to drugs, including changes in gene expression patterns, alternative splicing, and non-coding RNA expression3. This information can be used to determine drug targets, predict drug efficacy and toxicity, and optimize drug dosing and treatment regimens.
One of the key benefits of combining transcriptomics with unbiased drug screening is the potential to identify new drug targets that have not been previously considered. Conventional drug screening approaches often focus on established target molecules or pathways, hindering the identification of new targets and potentially resulting in drugs with unforeseen side effects and restricted effectiveness. Transcriptomics can overcome these limitations by providing insights into the molecular changes that occur in response to drug treatment, uncovering potential targets or pathways that may not have been previously considered2.
In addition to the identification of new drug targets, transcriptomics can also be used to predict drug efficacy and toxicity. By analyzing the gene expression patterns associated with drug responses, biomarkers can be developed that can be used to predict a patient's response to a particular drug or treatment regimen. This can also help to optimize drug dosing and reduce the risk of adverse side effects4.
Despite its potential benefits, the cost of transcriptomics remains a significant barrier to its widespread application in drug screening. Transcriptomic analysis requires specialized equipment, technical expertise, and data analysis, which can make it challenging for smaller research teams or organizations with limited funding to utilize transcriptomics in drug screening. However, the cost of transcriptomics has been steadily decreasing, making it more accessible to the research communities. Additionally, advancements in technology and data analysis methods have made transcriptomics more efficient and cost-effective, further increasing its accessibility2.
In this protocol, we describe a high-dimensional and explorative system for transcriptome-based drug screening, combining miniaturized perturbation cultures with mini-bulk transcriptomics analysis5,6. With this protocol, it is possible to reduce the cost per sample to 1/6th of the current cost of commercial solutions for full-length mRNA sequencing. The protocol requires only standard laboratory equipment, the only exception being the use of short-read sequencing technologies, which can be outsourced if sequencing instruments are not available in-house. The optimized mini-bulk protocol provides information-rich biological signals at cost-effective sequencing depth, enabling extensive screening of known drugs and new molecules.
The aim of the experiment is to screen for drug activity on PBMCs in different biological contexts. This protocol can be applied to any biological question where several drugs should be tested with a transcriptomic readout, giving a transcriptome-wide view of the cellular effect of the treatment.

تسليط الضوء على المؤلف: فحص الأدوية النسخي الفعال من حيث التكلفة - فتح أهداف جديدة 

فحص الأدوية القائم على النسخ الفعال من حيث التكلفة

Transcriptomics enable us to gain a deep understanding of cellular program and their reaction towards external changes. However, despite a considerable reduction in library production and sequencing costs over the last decades, the application of this technology, at the scale needed for drug screening, is still unaffordable, hindering the great potential of these methods. Our study present a cost-effective system for transcriptome-based drug screening, combining miniaturized perturbation cultures with mini-bulk transcriptomics.The optimized mini-bulk protocol provides informative biological signal at cost-effective sequencing depth, enabling extensive screening of known drugs and new molecules. One of the key benefits of combining transcriptomics with unbiased drug screening is the potential to identify new drug targets that have not been previously considered. Conventional drug screening approaches often focus on established target molecules or pathways, hindering the identification of new targets, and potentially resulting in drugs with unforeseen side effects and restricted effectiveness.

باتباع البروتوكول المبلغ عنه ، تم زرع PBMCs البشرية ، ومعالجتها بأدوية مناعية مختلفة ، وبعد أوقات حضانة مختلفة ، تم حصادها لتحليل النسخ السائب باستخدام بروتوكول التسلسل (الشكل 1).
يجب تحديد تركيزات الدواء المثالية وأوقات الحضانة لمركبات الاختبار قبل هذا البرو...

Watch this Scientific Journal Video about Cost-Effective Transcriptomic Drug Screening — Unlocking New Targets at JoVE.com

يصف هذا البروتوكول سير العمل من مزارع الخلايا خارج الجسم الحي أو في المختبر إلى المعالجة المسبقة للبيانات النسخية لفحص الأدوية القائم على النسخ الفعال من حيث التكلفة.

Transcriptomics allows&#160;to obtain comprehensive insights into cellular programs and their responses to perturbations. Despite a significant decrease ...

تمكننا Transcriptomics من اكتساب فهم عميق للبرنامج الخلوي ورد فعله تجاه التغيرات الخارجية. ومع ذلك ، على الرغم من الانخفاض الكبير في تكاليف إنتاج المكتبات وتسلسلها على مدى العقود الماضية ، فإن تطبيق هذه التكنولوجيا ، على النطاق اللازم لفحص الأدوية ، لا يزال لا يمكن تحمله ، مما يعوق الإمكانات الكبيرة لهذه الأساليب. تقدم دراستنا نظاما فعالا من حيث التكلفة لفحص الأدوية القائم على النسخ ، ويجمع بين ثقافات الاضطراب المصغرة والنسخ السائبة الصغيرة.يوفر بروتوكول السائبة الصغيرة المحسن إشارة بيولوجية مفيدة على عمق تسلسل فعال من حيث التكلفة ، مما يتيح فحصا مكثفا للأدوية المعروفة والجزيئات الجديدة. تتمثل إحدى الفوائد الرئيسية للجمع بين علم النسخ وفحص الأدوية غير المتحيز في إمكانية تحديد أهداف دوائية جديدة لم يتم النظر فيها من قبل. غالبا ما تركز مناهج فحص الأدوية التقليدية على الجزيئات أو المسارات المستهدفة المحددة ، مما يعيق تحديد أهداف جديدة ، ويحتمل أن يؤدي إلى أدوية ذات آثار جانبية غير متوقعة وفعالية محدودة.

cost-efficient-transcriptomic-based-drug-screening

Research

JoVE Journal

Biology

Cost-Efficient Transcriptomic-Based Drug Screening

866 Views.  German Center for Neurodegenerative Diseases (DZNE) eV.. تمكننا Transcriptomics من اكتساب فهم عميق للبرنامج الخلوي ورد فعله تجاه التغيرات الخارجية. ومع ذلك ، على الرغم من الانخفاض الكبير في تكاليف إنتاج المكتبات وتسلسلها على مدى العقود الماضية ، فإن تطبيق هذه التكنولوجيا ، على النطاق اللازم لفحص الأدوية ، لا يزال لا يمكن تحمله ، مما يعو...

Video: تسليط الضوء على المؤلف: فحص الأدوية النسخي الفعال من حيث التكلفة - فتح أهداف جديدة 

Transcriptomics allows&#160;to obtain comprehensive insights into cellular programs and their responses to perturbations. Despite a significant decrease in the costs of library production and sequencing in the last decade, applying these technologies at the scale necessary for drug screening remains prohibitively expensive, obstructing the immense potential of these methods. Our study presents a cost-effective system for transcriptome-based drug screening, combining miniaturized perturbation cultures with mini-bulk transcriptomics. The optimized mini-bulk protocol provides informative biological signals at cost-effective sequencing depth, enabling extensive screening of known drugs and new molecules. Depending on the chosen treatment and incubation time, this protocol will result in sequencing libraries within approximately 2 days. Due to several stopping points within this protocol, the library preparation, as well as the sequencing, can be performed time-independently. Processing simultaneously a high number of samples is possible; measurement of up to 384 samples was tested without loss of data quality. There are also no known limitations to the number of conditions and/or drugs, despite considering variability in optimal drug incubation times.

This protocol describes a workflow from ex vivo or in vitro cell cultures to transcriptomic data pre-processing for cost-effective transcriptome-based drug screening.