This work is supported by the National Natural Science Foundation of China (82060341,81560304) and by the Academician Innovation Platform Scientific Research Project of Hainan Province (YSPTZX202134).

NOTE: A total of five samples of C. megacephala samples were used in this protocol-three fresh samples (Fresh 1, Fresh 2, and Fresh 3), one sample stored in alcohol for 2 years (Old 1), and one sample stored in dry sealed storage for 2 years protected from light only (Old 2). Samples must be labeled according to the experimental requirements.
1. General sample storage and preparations
<ol>
	<li>Sample selection and preparation 
	NOTE: Be sure to work in the fume hood when applying ethyl acetate to execute necrophagous flies. Remove the liquid from the surface of the fly before weighing.
	<ol>
		<li>Fresh samples: Place three collected fly samples in gas vials after killing them with ethyl acetate. Weigh and name the samples as Fresh 1, Fresh 2, and Fresh 3 and use them immediately in experiments. 
		NOTE: The fresh fly samples in this protocol had masses of 56.8 mg, 49.3 mg, and 52.1 mg.</li>
		<li>Old sample 1: Take out fly samples killed by ethyl acetate and stored in alcohol-filled centrifuge tubes for 2 years in airtight containment, protected from light at room temperature. Weigh the sample after adsorbing the surface liquid with filter paper; call it Old 1. 
		NOTE: The mass of Old 1 was 42.3 mg in this protocol.</li>
		<li>Old sample 2: Take out the fly sample killed by ethyl acetate and stored in a centrifuge tube for 2 years in airtight containment, protected from light at room temperature. Weigh and call it Old 2.</li>
	</ol>
	</li>
	<li>Preparation before extraction
	<ol>
		<li>Add a small amount of liquid nitrogen to cool a stainless steel container; wait until all liquid nitrogen has evaporated.</li>
		<li>Put a fly sample in the container; pour in the liquid nitrogen slowly to prevent the liquid nitrogen from splashing and impacting the insect sample.</li>
		<li>Freeze the samples in liquid nitrogen. Remove samples after the liquid nitrogen evaporates.</li>
		<li>Separate the thorax individually, place in a 2 mL centrifuge tube, and cut into the smallest possible slices. 
		NOTE: Cut the sample into small pieces so that it can be fully cleaved, and DNA can be released in large quantities.</li>
		<li>Repeat the above steps for each fly, individually freeze, and then remove to a new centrifuge tube to prevent DNA cross-contamination.</li>
	</ol>
	</li>
</ol>
2. DNA extraction
NOTE: All centrifugation steps must be carried out at room temperature (15-25 &#176;C) in a microcentrifuge. All steps must be performed in strict adherence to the principles of asepsis and to avoid cross-contamination.
<ol>
	<li>Tissue lysis
	<ol>
		<li>Add 180 &#181;L of tissue lysis buffer to a 2 mL centrifuge tube containing a clipped sample.</li>
		<li>Add 20 &#181;L of proteinase K. Mix thoroughly by vortexing at 3 000 rpm for 10 s and incubate at 56 &#176;C until the insect tissues are completely lysed. 
		NOTE: Add more Proteinase K should be if the tissue is not fully digested. Lysis is usually complete in 1-3h, also can extend lysis time overnight.</li>
	</ol>
	</li>
	<li>DNA precipitation
	<ol>
		<li>Vortex at 3,000 rpm for 15 s. Add 200 &#181;L lysis buffer to the sample, and mix thoroughly by vortexing at 3,000 rpm for 15 s.</li>
		<li>Add 200 &#181;L of ethanol (96-100%) and mix again thoroughly by vortexing at 3,000 rpm for 15 s. 
		NOTE: Lysis buffer and ethanol can be preadded together in one step to save time. A white precipitate may form on the addition of lysis buffer and ethanol.</li>
	</ol>
	</li>
	<li>Pipet the mixture into the DNA adsorption column placed in a 2 mL collection tube. Centrifuge at 6,000 &#215; g for 1 min. Discard flowthrough and collection tube.</li>
	<li>Place the DNA adsorption column from the previous step in a new 2 mL collection tube, add 500 &#181;L of protein removal buffer, and centrifuge at 6,000 &#215; g for 1 min. Discard flowthrough and collection tube.</li>
	<li>Transfer the DNA adsorption column to a new 2 mL collection tube, add 500 &#181;L of desalination buffer, and centrifuge at 20,000 &#215; g for 3 min to dry the DNA adsorption column membrane. Discard flowthrough and collection tube. 
	NOTE: This centrifugation step ensures the removal of any residual ethanol before the following elution. If there is any carryover of ethanol, centrifuge again at 20,000 &#215; g for 1 min.</li>
	<li>Place the DNA adsorption column in a clean 2 mL microcentrifuge tube, directly pipet 100 &#181;L of DNA elution buffer onto the column membrane, incubate at room temperature for 1 min, and then centrifuge at 6,000 &#215; g for 1 min to elute. 
	NOTE: Elution with 100 &#181;L (instead of 200 &#181;L) increases the final DNA concentration in the eluate but also decreases the overall DNA yield. To maximize the DNA yield, repeat elution once as described in step 2.8.</li>
	<li>Store the DNA samples at 4 &#176;C (up to 1 week) or -80 &#176;C for long-term storage.</li>
</ol>
3. DNA concentration detection
<ol>
	<li>Determine the values of OD 260 and OD 280 to compare DNA purity and nucleic acid concentration by microplate reader. Repeat three times on each sample.</li>
	<li>Determine the concentration of the extracted DNA by fluorometer using its companion kit, with three replicates for each sample.
	<ol>
		<li>Take 190 &#181;L of working solution into two 0.5 mL centrifuge tubes, take 10 &#181;L each of Standard #1 and Standard #2, add them to the working solutions, and keep them away from light for not less than 15 min. 
		NOTE: Standard #1 and Standard #2 are accurately calibrated for a certain concentration of DNA. Standard solutions should be accurately configured to ensure the formation of an accurate standard curve. Standard #1 is a 0.2 ng/&#181;L double-stranded DNA (dsDNA) sample; standard #2 is 2,000 ng/&#181;L. The working solution is a dye that binds specifically to dsDNA.</li>
		<li>Take 2 &#181;L of test DNA and mix it with 198 &#181;L of working solution in a 0.5 mL centrifuge tube, and keep away from light for not less than 15 min. 
		NOTE: If the DNA concentration is low, add 5 &#181;L of test DNA with 195 &#181;L of working solution.</li>
		<li>After 15 min, turn on the instrument and select dsDNA Concentration Measurement | Long Range. First, test Standard #1, and then, Standard #2 to obtain the standard curve. 
		NOTE: The standard solution must be used on the same day after it is configured; leaving it for too long will result in a large error in the standard curve.</li>
		<li>Place the samples to be tested in the assay wells one by one, adjust the DNA spiking volume to 2 &#181;L, repeat the measurement three times, take the average value, and record.</li>
	</ol>
	</li>
</ol>
4. PCR and electrophoretic detection
NOTE: The mitochondrial CO <img alt="Equation 1" src="/files/ftp_upload/66737/66737eq01v2.jpg" style="margin: auto;" /> gene sequence with a length of 278 bp was taken for PCR amplification with forward primer C1-J-2495: CAGCTACTTTATGAGCTTTAGG, and reverse primer C1-N-2800: CATTTCAAGCTGTGTAAGCATC8, and then 2% agarose gel electrophoresis done to verify the amplification effect and amplification products&#39; length was verified.
<ol>
	<li>Set up 20 &#181;L of the PCR amplification system by adding 10 &#181;L of 2x Taq mix, 1 &#181;L of each primer, 5 &#181;L of ddH2O, and 3 &#181;L of template DNA; mix well for 10 s in a centrifuge.</li>
	<li>Use the following PCR cycling parameters: predenaturation 95 &#176;C for 10 min; denaturation 95 &#176;C for 30 s, annealing 48 &#176;C for 30 s, extension 72 &#176;C for 45 s for a total of 40 cycles; and final extension 72 &#176;C for 10 min.</li>
	<li>Subject the products after PCR to 2% agarose gel electrophoresis, and after electrophoresis, place them on a gel imaging system for photo analysis.</li>
</ol>

Assessing DNA Purity and Concentration in Fresh and Old Necrophilic Fly Samples

<ol>
	<li>Amendt, J., Richards, C. S., Campobasso, C. P., Zehner, R., Hall, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Forensic+entomology:+applications+and+limitations.">Forensic entomology: applications and limitations.</a> Forensic Sci Med Pathol. 7 (4), 379-392 (2011).</li><li>Wydra, J., Matuszewski, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+optimal+post-eclosion+interval+while+estimating+the+post-mortem+interval+based+on+an+empty+puparium.">The optimal post-eclosion interval while estimating the post-mortem interval based on an empty puparium.</a> Forensic Sci Med Pathol. 17 (2), 192-198 (2021).</li><li>Mazzanti, M., Alessandrini, F., Tagliabracci, A., Wells, J. D., Campobasso, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+degradation+and+genetic+analysis+of+empty+puparia:+genetic+identification+limits+in+forensic+entomology.">DNA degradation and genetic analysis of empty puparia: genetic identification limits in forensic entomology.</a> Forensic Sci Int. 195 (1-3), 99-102 (2010).</li><li>Odeniran, P. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=molecular+identification+and+distribution+of+Trypanosome-transmitting+Dipterans+from+cattle+settlements+in+Southwest+Nigeria.">molecular identification and distribution of Trypanosome-transmitting Dipterans from cattle settlements in Southwest Nigeria.</a> Acta Parasitol. 66 (1), 116-128 (2021).</li><li>Wells, J. D., Stevens, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+DNA-based+methods+in+forensic+entomology.">Application of DNA-based methods in forensic entomology.</a> Annu Rev Entomol. 53, 103-120 (2008).</li><li>Kotrba, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+barcoding+in+forensic+entomology-establishing+a+DNA+reference+library+of+potentially+forensic+relevant+arthropod+species.">DNA barcoding in forensic entomology-establishing a DNA reference library of potentially forensic relevant arthropod species.</a> J Forensic Sci. 64 (2), 593-601 (2019).</li><li>Weedon, M. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+SNP+chips+to+detect+rare+pathogenic+variants:+Retrospective,+population+based+diagnostic+evaluation.">Use of SNP chips to detect rare pathogenic variants: Retrospective, population based diagnostic evaluation.</a> BMJ. 372, 214 (2021).</li><li>Cai, J. -. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+availability+of+mitochondrial+DNA+cytochrome+oxidasegene+for+the+distinction+of+forensically+important+flies+in+China.">The availability of mitochondrial DNA cytochrome oxidasegene for the distinction of forensically important flies in China.</a> Acta Entomologica Sinica. 48 (3), 380-385 (2005).</li><li>Khayrova, A., Lopatin, S., Varlamov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obtaining+chitin,+chitosan+and+their+melanin+complexes+from+insects.">Obtaining chitin, chitosan and their melanin complexes from insects.</a> Int J Biol Macromol. 167, 1319-1328 (2021).</li><li>Guo, Y. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+DNA+extracting+methods+from+different+parts+of+common+necrophagous+flies.">Comparison of three DNA extracting methods from different parts of common necrophagous flies.</a> J Henan Univ Sci Tech (Med Sci). 36 (02), 130-133 (2018).</li><li>Du, H., Xie, H., Ma, M., Igarashi, Y., Luo, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modified+methods+obtain+high-quality+DNA+and+RNA+from+anaerobic+activated+sludge+at+a+wide+range+of+temperatures.">Modified methods obtain high-quality DNA and RNA from anaerobic activated sludge at a wide range of temperatures.</a> J Microbiol Methods. 199, 106532 (2022).</li><li>Sukumaran, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concentration+determination+of+nucleic+acids+and+proteins+using+the+micro-volume+BioSpec-nano-spectrophotometer.">Concentration determination of nucleic acids and proteins using the micro-volume BioSpec-nano-spectrophotometer.</a> J Vis Exp. (48), e2699 (2011).</li><li>Masago, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+between+fluorimetry+(Qubit)+and+spectrophotometry+(NanoDrop)+in+the+quantification+of+DNA+and+RNA+extracted+from+frozen+and+FFPE+tissues+from+lung+cancer+patients:+A+real-world+use+of+genomic+tests.">Comparison between fluorimetry (Qubit) and spectrophotometry (NanoDrop) in the quantification of DNA and RNA extracted from frozen and FFPE tissues from lung cancer patients: A real-world use of genomic tests.</a> Medicina (Kaunas). 57 (12), 1375 (2021).</li><li>Ponti, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+value+of+fluorimetry+(Qubit)+and+spectrophotometry+(NanoDrop)+in+the+quantification+of+cell-free+DNA+(cfDNA)+in+malignant+melanoma+and+prostate+cancer+patients.">The value of fluorimetry (Qubit) and spectrophotometry (NanoDrop) in the quantification of cell-free DNA (cfDNA) in malignant melanoma and prostate cancer patients.</a> Clin Chim Acta. 479, 14-19 (2018).</li><li>Adams, Z. J., Hall, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+used+for+the+killing+and+preservation+of+blowfly+larvae,+and+their+effect+on+post-mortem+larval+length.">Methods used for the killing and preservation of blowfly larvae, and their effect on post-mortem larval length.</a> Forensic Sci Int. 138 (1-3), 50-61 (2003).</li><li>Fliegerova, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+DNA+extraction+and+sample+preservation+method+on+rumen+bacterial+population.">Effect of DNA extraction and sample preservation method on rumen bacterial population.</a> Anaerobe. 29, 80-84 (2014).</li><li>Rodrigues, B. L., Galati, E. A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+taxonomy+of+phlebotomine+sand+flies+(Diptera,+Psychodidae)+with+emphasis+on+DNA+barcoding:+A+review.">Molecular taxonomy of phlebotomine sand flies (Diptera, Psychodidae) with emphasis on DNA barcoding: A review.</a> Acta Trop. 238, 106778 (2023).</li></ol>

The authors declare that they have no competing financial interests.

DNA extraction is the most critical link in the molecular identification of necrophilous flies, and its extraction method and the quality of the extracted DNA directly affect subsequent detection. In this experiment, we successfully extracted DNA from necrophilous flies by using a common blood kit, without the need to purchase a special insect DNA extraction kit, which makes insect DNA extraction easier to accomplish.
The surface of flies is rich in chitin, especially in the larval and pupal s...

<a href="https://app.jove.com/t/6604">This corrects</a> the article <a href="https://dx.doi.org/10.3791/66737">10.3791/66737</a>

An erratum was issued for:&#160;<a href="https://www.jove.com/t/66737">DNA Extraction and Comparison Between Old and Fresh Necrophilic Fly Samples</a>. The Authors section was updated.

Erratum: DNA Extraction and Comparison Between Old and Fresh Necrophilic Fly Samples

The inference of the time of death has always been one of the key and difficult issues to be resolved in judicial practice. In the practice of forensic science, for a criminal case, determining postmortem interval plays a crucial role in deducing the time of the crime, locking in the suspect, and narrowing the scope of the investigation. Traditional methods of inferring the time of death are based primarily on early postmortem phenomena, which can generally only be used to infer the time of death within 24 h. However, the long time of death cannot be determined by postmortem phenomena. It is now generally recognized in the forensic science community that forensic entomology has the potential to be an effective method of inferring a longer time of death.
Necrophagous insects are named for their larvae that feed on corpses. Among them, whenever a corpse is present, the adult necrophilous flies will be the first to reach the corpse and lay their eggs or larvae. The larvae feed on corpse tissue and mature into pupae, which fledge into adults. Necrophilic flies play a huge role in the practice of forensic science because of their regular life cycle and geographic distribution, for example, deducting the time of death and determining the place of death1,2. However, the barrier to the use of necrophilous flies in forensic practice is species identification. Morphological methods are still used as the authoritative method for species identification of necrophilous flies. However, morphological species identification requires a high degree of insect integrity. If the flies were in different developmental stages, or due to morphological changes caused by environmental choices, those all make morphological examination more difficult. In particular, the morphology of pupae and pupal shells, which are most often found at the crime scene, is barely recognizable. This, together with the scarcity of morphological experts, makes huge difficulty to the identification of species morphologically. Therefore, the application of molecular biology methods for species identification of flies has emerged, which reduces the difficulty of morphological identification and is independent of developmental stage3,4,5,6,7.
The first step in species identification of necrophilous flies based on molecular biology methods is the efficient extraction of DNA, while specialized kits for insect DNA extraction are not commonly available currently. And how to use common blood kits for DNA extraction of necrophilic flies becomes more forensically relevant. Necrophilic flies found at crime scenes are often mutilated or have undergone decay and DNA degradation. Fly samples are not immediately available for DNA extraction after acquisition, or if possible, complete samples need to be retained due to evidence preservation requirements. Based on the above requirements, in this study, we applied the blood DNA kit based on proteinase K digestion, and selected three fresh Chrysomya megacephala (Diptera, Lepidoptera) samples (Figure 1), one old C. megacephala sample placed in alcohol for two years, and one C. megacephala sample placed in light-protected storage for two years, weighed each of the five samples, elected the insect thorax tissue for DNA extraction. Comparing the quality and purity of DNA extracted from the old and new samples, PCR amplification and electrophoresis of the extracted DNA were performed with necrophilic fly-specific primers located in the mitochondrial CO <img alt="Equation 1" src="/files/ftp_upload/66737/66737eq01v2.jpg" style="margin: auto;" /> gene sequence.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Buffer AE</td>
			<td>Qiagen</td>
			<td>172026832</td>
			<td>DNA elution buffer</td>
		</tr>
		<tr>
			<td>Buffer AL</td>
			<td>Qiagen</td>
			<td>172028374</td>
			<td>lysis buffer</td>
		</tr>
		<tr>
			<td>Buffer ATL</td>
			<td>Qiagen</td>
			<td>172028162</td>
			<td>tissue lysis buffer</td>
		</tr>
		<tr>
			<td>Buffer AW1</td>
			<td>Qiagen</td>
			<td>172028760</td>
			<td>protein removal buffer</td>
		</tr>
		<tr>
			<td>Buffer AW2</td>
			<td>Qiagen</td>
			<td>57203108</td>
			<td>desalination buffer</td>
		</tr>
		<tr>
			<td>C1-J-2495</td>
			<td>Taihe Biotechnology</td>
			<td>TW21109216</td>
			<td>forword primer</td>
		</tr>
		<tr>
			<td>C1-N-2800</td>
			<td>Taihe Biotechnology</td>
			<td>TW21109217</td>
			<td>reverse primer</td>
		</tr>
		<tr>
			<td>D2000 DNA ladder</td>
			<td>Real-Times(Beijing) Biotechnology</td>
			<td>RTM415</td>
			<td>Measure the position of electrophoretic bands</td>
		</tr>
		<tr>
			<td>DNeasy Mini spin column</td>
			<td>Qiagen</td>
			<td>166050343</td>
			<td>DNA adsorption column</td>
		</tr>
		<tr>
			<td>Dry Bath Incubator</td>
			<td>Miulab</td>
			<td>DKT200-2D</td>
			<td>used for heating</td>
		</tr>
		<tr>
			<td>MIX-30S Mini Mixer</td>
			<td>Miulab</td>
			<td>MUC881206</td>
			<td>oscillatory action</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Qiagen</td>
			<td>172026218</td>
			<td>Inactivation of intracellular nucleases and other proteins</td>
		</tr>
		<tr>
			<td>Qubit 3.0 Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>2321611188</td>
			<td></td>
		</tr>
		<tr>
			<td>Speed Micro-Centrifuge</td>
			<td>Scilogex</td>
			<td>9013001121</td>
			<td>centrifuge</td>
		</tr>
		<tr>
			<td>Standard#1</td>
			<td>Thermo Fisher Scientific</td>
			<td>2342797</td>
			<td></td>
		</tr>
		<tr>
			<td>Standard#2</td>
			<td>Thermo Fisher Scientific</td>
			<td>2342797</td>
			<td></td>
		</tr>
		<tr>
			<td>Tanon 3500R Gel Imager</td>
			<td>Tanon</td>
			<td>16T5553R-455</td>
			<td>gel imaging</td>
		</tr>
		<tr>
			<td>Taq Mix Pro</td>
			<td>Monad</td>
			<td>00007808-140534</td>
			<td>PCR Mix</td>
		</tr>
		<tr>
			<td>Taq Mix Pro</td>
			<td>Monad</td>
			<td>00007808-140534</td>
			<td>PCR Mix</td>
		</tr>
		<tr>
			<td>Thermo Cycler</td>
			<td>Zhuhai Hema</td>
			<td>VRB020A</td>
			<td>ordinary PCR</td>
		</tr>
		<tr>
			<td>Working Solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>2342797</td>
			<td></td>
		</tr>
	</tbody>
</table>

dna extraction and comparison between old and fresh necrophilic fly samples

A total of five samples of Chrysomya megacephala samples - three fresh samples, one sample stored in alcohol for 2 years, and one sample stored in dry sealed storage for 2 years protected from light only - were selected to investigate whether a blood DNA extraction kit could extract DNA from necrophilous flies and to determine whether alcohol could prolong the preservation of necrophilous flies&#39; DNA. First, the blood DNA extraction kit was used to extract DNA from their thorax tissues. Then, the DNA purity and concentration were examined using a microplate reader and a fluorometer. Finally, PCR amplification and electrophoresis of the extracted DNA were done with necrophilic fly-specific primers located in the mitochondrial CO I gene sequence. The results showed that the DNA purity of all samples was greater than 2.0. The DNA concentration was observed to be of the following order: fresh samples &#62; alcohol-preserved old samples &#62; untreated, old samples. All samples had specific electrophoretic bands after PCR amplification. In conclusion, a blood DNA extraction kit can be used to extract DNA from necrophilic flies successfully, and the DNA concentration of fresh fly samples is greater than that of old fly samples. The flies can be stored in alcohol for a long time.

We used a microplate reader to measure the values of OD260 and OD280 of the extracted DNA solution and then obtained the OD260/OD280 values to evaluate the purity of the DNA. The OD260/OD280 of all fresh samples and old sample 1 was greater than 2. The OD260/OD280 of old sample 2 had a maximum value of 2.187 although the average was 1.753, and its three measurements fluctuated greatly due to the small (&#8804;0.01) values of both its OD280 and OD280 (Table 1). Based on the value of OD260 obtained, we est...

Read this Scientific Article Protocol about DNA Extraction and Comparison between Old and Fresh Necrophilic Fly Samples at JoVE.com

Author Spotlight: Advancing DNA Extraction from Necrophilic Fly Samples using Simple Technique

This article describes a protocol for fresh and old necrophilic fly DNA extraction using a modified common DNA extraction kit.

DNA Extraction and Comparison Between Old and Fresh Necrophilic Fly Samples

A total of five samples of Chrysomya megacephala samples - three fresh samples, one sample stored in alcohol for 2 years, and one sample stored in dry ...

dna-extraction-comparison-between-old-fresh-necrophilic-fly

Research

JoVE Journal

Medicine

330 Views.  Hainan Medical University, Hainan Provincial Academician Workstation (tropical forensic medicine). This article describes a protocol for fresh and old necrophilic fly DNA extraction using a modified common DNA extraction kit.

Video: Author Spotlight: Advancing DNA Extraction from Necrophilic Fly Samples using Simple Technique

Isolation and Functional Characterization of Human Ventricular Cardiomyocytes from Fresh Surgical Samples

Cardiomyocytes from diseased hearts are subjected to complex remodeling processes involving changes in cell structure, excitation contraction coupling and membrane ion currents. Those changes are likely&#160;to be responsible for the increased arrhythmogenic risk and the contractile alterations leading to systolic and diastolic dysfunction in cardiac patients. However, most information on the alterations of myocyte function in cardiac diseases has come from animal models.
Here we describe and validate a protocol to isolate viable myocytes from small surgical samples of ventricular myocardium from patients undergoing cardiac surgery operations. The protocol is described in detail. Electrophysiological and intracellular calcium measurements are reported to demonstrate the feasibility of a number of single cell measurements in human ventricular cardiomyocytes obtained with this method.
The protocol reported here can be useful for future investigations of the cellular and molecular basis of functional alterations of the human heart in the presence of different cardiac diseases. Further, this method can be used to identify novel therapeutic targets at cellular level and to test the effectiveness of new compounds on human cardiomyocytes, with direct translational value.

Current knowledge on the cellular basis of cardiac diseases mostly relies on studies on animal models. Here we describe and validate a novel method to obtain single viable cardiomyocytes from small surgical samples of human ventricular myocardium. Human ventricular myocytes can be used for electrophysiological studies and drug testing.

Cardiomyocytes from diseased hearts are subjected to complex remodeling processes involving changes in cell structure, excitation contraction coupling and ...

Collection and Extraction of Saliva DNA for Next Generation Sequencing

The preferred source of DNA in human genetics research is blood, or cell lines derived from blood, as these sources yield large quantities of high quality DNA. However, DNA extraction from saliva can yield high quality DNA with little to no degradation/fragmentation that is suitable for a variety of DNA assays without the expense of a phlebotomist and can even be acquired through the mail. However, at present, no saliva DNA collection/extraction protocols for next generation sequencing have been presented in the literature. This protocol optimizes parameters of saliva collection/storage and DNA extraction to be of sufficient quality and quantity for DNA assays with the highest standards, including microarray genotyping and next generation sequencing.

DNA extraction from saliva can provide a readily available source of high molecular weight DNA, with little to no degradation/fragmentation. This protocol provides optimized parameters for saliva collection/storage and DNA extraction to be of sufficient quality and quantity for downstream DNA assays with high quality requirements.

The preferred source of DNA in human genetics research is blood, or cell lines derived from blood, as these sources yield large quantities of high quality ...

Collection, Isolation, and Flow Cytometric Analysis of Human Endocervical Samples

Despite the public health importance of mucosal pathogens (including HIV), relatively little is known about mucosal immunity, particularly at the female genital tract (FGT). Because heterosexual transmission now represents the dominant mechanism of HIV transmission, and given the continual spread of sexually transmitted infections (STIs), it is critical to understand the interplay between host and pathogen at the genital mucosa. The substantial gaps in knowledge around FGT immunity are partially due to the difficulty in successfully collecting and processing mucosal samples. In order to facilitate studies with sufficient sample size, collection techniques must be minimally invasive and efficient. To this end, a protocol for the collection of cervical cytobrush samples and subsequent isolation of cervical mononuclear cells (CMC) has been optimized. Using ex vivo flow cytometry-based immunophenotyping, it is possible to accurately and reliably quantify CMC lymphocyte/monocyte population frequencies and phenotypes. This technique can be coupled with the collection of cervical-vaginal lavage (CVL), which contains soluble immune mediators including cytokines, chemokines and anti-proteases, all of which can be used to determine the anti- or pro-inflammatory environment in the vagina.

The use of cytobrush sampling to collect lymphocytes and monocytes from the endocervix is a minimally invasive technique that provides samples for analysis of female genital tract immunity. In this protocol, we describe the collection of cytobrush samples and immune cell isolation for flow cytometry assays.

Despite the public health importance of mucosal pathogens (including HIV), relatively little is known about mucosal immunity, particularly at the female ...

Sampling Strategies and Processing of Biobank Tissue Samples from Porcine Biomedical Models

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of genetically modified pig models, and the often-limited number of available animals of these models, establishment of (biobank) collections of adequately processed tissue samples suited for a broad spectrum of subsequent analyses methods, including analyses not specified at the time point of sampling, represent meaningful approaches to take full advantage of the translational value of the model. With respect to the peculiarities of porcine anatomy, comprehensive guidelines have recently been established for standardized generation of representative, high-quality samples from different porcine organs and tissues. These guidelines are essential prerequisites for the reproducibility of results and their comparability between different studies and investigators. The recording of basic data, such as organ weights and volumes, the determination of the sampling locations and of the numbers of tissue samples to be generated, as well as their orientation, size, processing and trimming directions, are relevant factors determining the generalizability and usability of the specimen for molecular, qualitative, and quantitative morphological analyses. Here, an illustrative, practical, step-by-step demonstration of the most important techniques for generation of representative, multi-purpose biobank specimen from porcine tissues is presented. The methods described here include determination of organ/tissue volumes and densities, the application of a volume-weighted systematic random sampling procedure for parenchymal organs by point-counting, determination of the extent of tissue shrinkage related to histological embedding of samples, and generation of randomly oriented samples for quantitative stereological analyses, such as isotropic uniform random (IUR) sections generated by the &#34;Orientator&#34; and &#34;Isector&#34; methods, and vertical uniform random (VUR) sections.

The practical application and performance of methods for generation of representative tissue samples of porcine animal models for a broad spectrum of downstream analyses in biobank projects are demonstrated, including volumetry, systematic random sampling, and differential processing of tissue samples for qualitative and quantitative morphologic and molecular analyses types.

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of ...

Absorbent Microbiopsy Sampling and RNA Extraction for Minimally Invasive, Simultaneous Blood and Skin Analysis

Conventional skin biopsy limits the clinical research that involves cosmetically sensitive areas or pediatric applications due to its invasiveness. Here, we describe the protocol for using&#160;an absorbent microneedle-based device, absorbent microbiopsy, for minimally invasive sampling of skin and blood mixture. Our goal is to help facilitate rapid progress in clinical research, the establishment of biomarkers for skin disease and reducing the risk for clinical research participants. In contrast to conventional skin biopsy techniques, the absorbent microbiopsy can be performed within seconds and does not require intensive training due to its simple design. In this report, we describe the use of absorbent microbiopsy, including loading and application, on a&#160;volunteer. Then, we show how to isolate RNA from the absorbed sample. Finally, we demonstrate the use of quantitative reverse transcription PCR (RT-qPCR) to quantify mRNA expression levels of both blood (CD3E and CD19) and skin (KRT14 and TYR). The methods that we describe utilize off the shelf kits and reagents. This protocol offers a minimally invasive approach for simultaneous sampling of skin and blood within the same absorbent microbiopsy matrix. We have found human ethics committees, clinicians and volunteers to be supportive of this approach to dermatological research.

In this article, we demonstrate how the absorbent microbiopsy technique is performed and how the sample can be used for RNA extraction for simple and simultaneous sampling of skin and blood in a minimally invasive manner.

Conventional skin biopsy limits the clinical research that involves cosmetically sensitive areas or pediatric applications due to its invasiveness. Here, ...

Model of Ischemic Heart Disease and Video-Based Comparison of Cardiomyocyte Contraction Using hiPSC-Derived Cardiomyocytes

Ischemic heart disease is a significant cause of death worldwide. It has therefore been the subject of a tremendous amount of research, often with small-animal models such as rodents. However, the physiology of the human heart differs significantly from that of the rodent heart, underscoring the need for clinically relevant models to study heart disease. Here, we present a protocol to model ischemic heart disease using cardiomyocytes differentiated from human induced pluripotent stem cells (hiPS-CMs) and to quantify the damage and functional impairment of the ischemic cardiomyocytes. Exposure to 2% oxygen without glucose and serum increases the percentage of injured cells, which is indicated by staining of the nucleus with propidium iodide, and decreases cellular viability. These conditions also decrease the contractility of hiPS-CMs as confirmed by displacement vector field analysis of microscopic video images. This protocol may furthermore provide a convenient method for personalized drug screening by facilitating the use of hiPS cells from individual patients. Therefore, this model of ischemic heart disease, based on iPS-CMs of human origin, can provide a useful platform for drug screening and further research on ischemic heart disease.

We present a model of ischemic heart disease using cardiomyocytes derived from human induced pluripotent stem cells, together with a method for quantitative evaluation of tissue damage caused by ischemia. This model can provide a useful platform for drug screening and further research on ischemic heart disease.

Ischemic heart disease is a significant cause of death worldwide. It has therefore been the subject of a tremendous amount of research, often with ...

On-Site Sampling and Extraction of Brain Tumors for Metabolomics and Lipidomics Analysis

Despite the variety of tools available for cancer diagnosis and classification, methods that enable fast and simple characterization of tumors are still in need. In recent years, mass spectrometry has become a method of choice for untargeted profiling of discriminatory compound as potential biomarkers of a disease. Biofluids are generally considered as preferable matrices given their accessibility and easier sample processing while direct tissue profiling provides more selective information about a given cancer. Preparation of tissues for the analysis via traditional methods is much more complex and time-consuming, and, therefore, not suitable for fast on-site analysis. The current work presents a protocol combining sample preparation and extraction of small molecules on-site, immediately after tumor resection. The sampling device, which is of the size of an acupuncture needle, can be inserted directly into the tissue and then transported to the nearby laboratory for instrumental analysis. The results of metabolomics and lipidomics analyses demonstrate the capability of the approach for the establishment of phenotypes of tumors related to the histological origin of the tumor, malignancy, and genetic mutations, as well as for the selection of discriminating compounds or potential biomarkers. The non-destructive nature of the technique permits subsequent performance of routinely used tests e.g., histological tests, on the same samples used for SPME analysis, thus enabling attainment of more comprehensive information to support personalized diagnostics.

The manuscript presents on-site sampling of human brain tumors with solid phase microextraction followed by their biochemical profiling towards the discovery of biomarkers.

Despite the variety of tools available for cancer diagnosis and classification, methods that enable fast and simple characterization of tumors are still ...

Extrahepatic Bile Duct and Gall Bladder Dissection in Nine-Day-Old Mouse Neonates

The dissection of murine neonatal bile ducts has been described as difficult. The main aim of the described standard operating procedure is the isolation of the extrahepatic bile duct (EBD) in mouse neonates without damaging the bile duct during preparation. Because of its exceptionally close preparation compared to the cholangiocytes cell line and harvesting of the entire extrahepatic bile duct system (EBDS), the described approach is extremely useful in researching animal models of newborn bile duct disorders, such as biliary atresia. After euthanasia, the peritoneal cavity was accessed, and the bile duct system, duodenum, and liver were extracted with the unique En-bloc-Resection (EbR). The extracted sample is placed on a foam mat, and the EBD is dissected from contaminating cells atraumatically without necessary touch. The dissection of the entire EBDS is a significant advantage of this method. Caution must be taken due to the small size and amount of bile duct tissue. Using the described technique, there is no damage to the cholangiocytes. Further, the purity of the technique is reproducible (n = 10). Therefore, optimally comparable samples can be harvested. Furthermore, no bile duct tissue is harmed, because any contact with the bile duct system can be avoided during preparation, leaving the bile fluid inside the gall bladder. Most importantly, while performing the final gall bladder and bile duct dissection, atraumatic microinstruments were used only slightly lateral of the bile duct without squeezing it. This is the key to a clean and intact sample, and essential for further histological investigation or the isolation of cholangiocytes. To summarize, the described innovative dissection technique enables especially inexperienced operators with the necessary equipment to isolate the EBDS as cleanly as possible.

For the observation of murine neonatal bile duct disorders, an intact bile duct and efficient preparation are required. Therefore, a new approach for isolating the entire extrahepatic bile duct system in murine neonates was successfully developed while maintaining the integrity of the bile duct.

The dissection of murine neonatal bile ducts has been described as difficult. The main aim of the described standard operating procedure is the isolation ...

Lumican Extraction from Amniotic Membrane and Determination of its Storage Temperature

Lumican is a small leucine-rich proteoglycan in the human amniotic membrane (AM) that promotes corneal epithelialization and the organization of collagen fibers, maintaining corneal transparency. In the present work, a method for protein extraction from AM to obtain lumican is proposed. Additionally, the stability of lumican in the AM extract (AME) stored at different temperatures and time periods is evaluated. 100 mg of AM were thawed and mechanical de-epithelialized. The de-epithelialized AM was frozen and crushed until a fine powder was obtained, which was solubilized with 2.5 mL of saline buffer with protease inhibitors and centrifuged for protein extraction. The supernatant was collected and stored at -20 &#176;C, 4 &#176;C, and room temperature (RT) for 6, 12, 20, and 32 days. Afterward, lumican was quantified in each AME. This technique allows an accessible and acquirable protocol for lumican extraction from AM. Lumican concentration was affected by storage time and temperature conditions. Lumican in the AME of 12 days stored at -20 &#176;C and 4 &#176;C was significantly higher than other AME. This lumican extraction could be useful for developing treatments and pharmaceutical solutions. Further studies are needed to determine the uses of AME lumican in re-epithelialization and wound healing process.

The present protocol describes the extraction of lumican from the amniotic membrane (AM) and their storing conditions as AM extract (AME) at -20 &#176;C, 4 &#176;C, and room temperature (RT) for 6, 12, 20, and 32 days to quantify its proteins and lumican concentration.

Lumican is a small leucine-rich proteoglycan in the human amniotic membrane (AM) that promotes corneal epithelialization and the organization of collagen ...

Enhancing Radiotherapy with Web-Based Radiation Planning Assistant

Radiation Planning Assistant - A Web-based Tool to Support High-quality Radiotherapy in Clinics with Limited Resources

Access to radiotherapy worldwide is limited. The Radiation Planning Assistant (RPA) is a fully automated, web-based tool that is being developed to offer fully automated radiotherapy treatment planning tools to clinics with limited resources. The goal is to help clinical teams scale their efforts, thus reaching more patients with cancer. The user connects to the RPA via a webpage, completes a Service Request (prescription and information about the radiotherapy targets), and uploads the patient&#39;s CT image set. The RPA offers two approaches to automated planning. In one-step planning, the system uses the Service Request and CT scan to automatically generate the necessary contours and treatment plan. In two-step planning, the user reviews and edits the automatically generated contours before the RPA continues to generate a volume-modulated arc therapy plan. The final plan is downloaded from the RPA website and imported into the user&#39;s local treatment planning system, where the dose is recalculated for the locally commissioned linac; if necessary, the plan is edited prior to approval for clinical use.

Author Spotlight: Improving Radiation Therapy Access with Radiation Planning Assistant

This protocol describes a series of automated tools designed for high-quality radiotherapy autocontouring and autoplanning that are being packaged into a web-based service to maximize robustness and scalability while minimizing operational costs.

Access to radiotherapy worldwide is limited. The Radiation Planning Assistant (RPA) is a fully automated, web-based tool that is being developed to offer ...