עבודה זו נתמכת על ידי הקרן הלאומית למדעי הטבע של סין (82060341,81560304) ועל ידי פרויקט המחקר המדעי של פלטפורמת החדשנות האקדמית של מחוז האינאן (YSPTZX202134).

הערה: בפרוטוקול זה נעשה שימוש בסך הכל בחמש דגימות של C. megacephala – שלוש דגימות טריות (Fresh 1, Fresh 2 ו-Fresh 3), דגימה אחת שאוחסנה באלכוהול במשך שנתיים (Old 1), ודגימה אחת שאוחסנה באחסון יבש אטום למשך שנתיים כשהיא מוגנת מפני אור בלבד (Old 2). הדגימות חייבות להיות מסומנות בהתאם לדרישות הניסוי.
1. אחסון דגימות כללי והכנות
<ol><li>בחירת דוגמאות והכנתן הערה: הקפד לעבוד במכסה האדים בעת מריחת אתיל אצטט לביצוע זבובים נקרופגיים. הסר את הנוזל מפני השטח של הזבוב לפני השקילה.<ol><li>דגימות טריות: הניחו שלוש דגימות זבובים שנאספו בבקבוקוני גז לאחר שהרגו אותן עם אתיל אצטט. שקלו וקראו לדגימות בשם Fresh 1, Fresh 2 ו-Fresh 3 והשתמשו בהן מיד בניסויים. הערה: דגימות הזבוב הטרי בפרוטוקול זה היו בעלות מסות של 56.8 מ"ג, 49.3 מ"ג ו-52.1 מ"ג.</li>
		<li>דוגמה ישנה 1: הוציאו דגימות זבובים שנהרגו על ידי אתיל אצטט ואוחסנו בצינורות צנטריפוגות מלאות אלכוהול במשך שנתיים בהכלה אטומה, מוגנות מפני אור בטמפרטורת החדר. לשקול את המדגם לאחר ספיגת נוזל פני השטח עם נייר מסנן; תקראו לזה ישן 1. הערה: המסה של Old 1 הייתה 42.3 מ"ג בפרוטוקול זה.</li>
		<li>דגימה ישנה 2: הוציאו את דגימת הזבוב שנהרגה על ידי אתיל אצטט ואוחסנו בצינור צנטריפוגה במשך שנתיים בהכלה אטומה, מוגנת מפני אור בטמפרטורת החדר. לשקול ולקרוא לזה ישן 2.</li>
	</ol></li>
	<li>הכנה לפני מיצוי<ol><li>מוסיפים כמות קטנה של חנקן נוזלי כדי לקרר מיכל נירוסטה; המתן עד שכל החנקן הנוזלי יתאדה.</li>
		<li>שים מדגם זבוב במיכל; שפכו פנימה את החנקן הנוזלי באיטיות כדי למנוע מהחנקן הנוזלי להתיז ולהשפיע על דגימת החרק.</li>
		<li>מקפיאים את הדגימות בחנקן נוזלי. הסר דגימות לאחר שהחנקן הנוזלי מתאדה.</li>
		<li>מפרידים את בית החזה בנפרד, מניחים בצינור צנטריפוגה של 2 מ"ל וחותכים לפרוסות הקטנות ביותר האפשריות. הערה: חתכו את הדגימה לחתיכות קטנות כדי שניתן יהיה לבקע אותה במלואה, וניתן יהיה לשחרר דנ"א בכמויות גדולות.</li>
		<li>חזור על השלבים לעיל עבור כל זבוב, הקפא בנפרד, ולאחר מכן הסר לצינור צנטריפוגה חדש כדי למנוע זיהום צולב DNA.</li>
	</ol></li>
</ol>2. מיצוי DNA
הערה: כל שלבי הצנטריפוגה חייבים להתבצע בטמפרטורת החדר (15-25 מעלות צלזיוס) במיקרוצנטריפוגה. כל השלבים חייבים להתבצע תוך הקפדה על עקרונות האספסיס וכדי למנוע זיהום צולב.
<ol><li>ליזה רקמתית<ol><li>הוסף 180 μL של חיץ ליזה רקמות לצינור צנטריפוגה 2 מ"ל המכיל דגימה חתוכה.</li>
		<li>מוסיפים 20 μL של פרוטאינאז K. מערבבים היטב על ידי ערבול ב 3,000 סל"ד במשך 10 שניות ודגרים ב 56 ° C עד רקמות החרק הם lysed לחלוטין. הערה: להוסיף עוד פרוטאינאז K צריך להיות אם הרקמה אינה מתעכלת במלואה. ליזיס הוא בדרך כלל להשלים בתוך 1-3 שעות, גם יכול להאריך את זמן ליזה בן לילה.</li>
	</ol></li>
	<li>משקעים DNA<ol><li>מערבולת ב-3,000 סל"ד למשך 15 שניות. הוסיפו חיץ ליזה של 200 μL לדגימה, וערבבו היטב על ידי מערבולות ב-3,000 סל"ד במשך 15 שניות.</li>
		<li>מוסיפים 200 μL אתנול (96-100%) ומערבבים שוב ביסודיות על ידי ערבול ב-3,000 סל"ד במשך 15 שניות. הערה: ניתן לחבר מראש חיץ ליזיס ואתנול יחד בשלב אחד כדי לחסוך זמן. משקע לבן עשוי להיווצר על תוספת של חיץ ליזיס ואתנול.</li>
	</ol></li>
	<li>יש להכניס את התערובת לעמודת ספיחת הדנ"א הממוקמת בצינור איסוף של 2 מ"ל. צנטריפוגה ב-6,000 × גרם למשך דקה. יש להשליך את הזרימה ואת צינור האיסוף.</li>
	<li>הניחו את עמודת ספיחת הדנ"א מהשלב הקודם בצינור איסוף חדש של 2 מ"ל, הוסיפו 500 מיקרוליטר של חיץ להסרת חלבונים וצנטריפוגה ב-6,000 × גרם למשך דקה אחת. יש להשליך את הזרימה ואת צינור האיסוף.</li>
	<li>מעבירים את עמודת ספיחת הדנ"א לצינור איסוף חדש של 2 מ"ל, מוסיפים 500 מיקרוליטר של חיץ התפלה, וצנטריפוגות ב-20,000 × גרם למשך 3 דקות כדי לייבש את קרום עמודת ספיחה הדנ"א. יש להשליך את הזרימה ואת צינור האיסוף. הערה: שלב צנטריפוגה זה מבטיח הסרה של כל שאריות אתנול לפני ההדבקה הבאה. אם יש סחבת כלשהי של אתנול, צנטריפוגה שוב ב 20,000 × גרם למשך דקה אחת.</li>
	<li>מניחים את עמודת ספיחת הדנ"א בצינור מיקרוצנטריפוגה נקי של 2 מ"ל, מזרימים ישירות 100 מיקרוליטר של חיץ אלוציית DNA על קרום העמודה, דוגרים בטמפרטורת החדר למשך דקה אחת, ואז צנטריפוגה ב 6,000 × גרם למשך דקה אחת כדי ללוטש. הערה: Elution עם 100 μL (במקום 200 μL) מגדיל את ריכוז ה- DNA הסופי ב- eluate אך גם מקטין את תפוקת ה- DNA הכוללת. כדי למקסם את תפוקת הדנ"א, חזור על ההדחה פעם אחת כמתואר בשלב 2.8.</li>
	<li>אחסנו את דגימות הדנ"א בטמפרטורה של 4°C (עד שבוע) או -80°C לאחסון לטווח ארוך.</li>
</ol>3. זיהוי ריכוז DNA
<ol><li>קבע את הערכים של OD 260 ו- OD 280 כדי להשוות את טוהר ה- DNA וריכוז חומצות הגרעין באמצעות קורא מיקרו-צלחות. חזור על הפעולה שלוש פעמים בכל דגימה.</li>
	<li>קבע את ריכוז הדנ"א המופק על ידי פלואורומטר באמצעות הערכה הנלווית לו, עם שלושה עותקים משוכפלים לכל דגימה.<ol><li>קח 190 μL של פתרון עבודה לתוך שני צינורות צנטריפוגות 0.5 מ"ל, לקחת 10 μL כל אחד של תקן #1 ותקן #2, להוסיף אותם פתרונות עבודה, ולהרחיק אותם מאור במשך לא פחות מ 15 דקות. הערה: תקן #1 ותקן #2 מכוילים במדויק עבור ריכוז מסוים של DNA. פתרונות סטנדרטיים צריכים להיות מוגדרים במדויק כדי להבטיח היווצרות של עקומה סטנדרטית מדויקת. תקן #1 הוא דגימת DNA דו-גדילי (dsDNA) בגודל 0.2 ng/μL; תקן #2 הוא 2,000 ננוגרם/מיקרוליטר. פתרון העבודה הוא צבע שנקשר במיוחד ל- dsDNA.</li>
		<li>קח 2 μL של DNA הבדיקה וערבב אותו עם 198 μL של פתרון עבודה בצינור צנטריפוגה 0.5 מ"ל, ולשמור הרחק מאור במשך לא פחות מ 15 דקות. הערה: אם ריכוז הדנ"א נמוך, הוסף 5 μL של DNA בדיקה עם 195 μL של פתרון עבודה.</li>
		<li>לאחר 15 דקות, הפעל את המכשיר ובחר מדידת ריכוז dsDNA | טווח ארוך. ראשית, בדוק תקן #1, ולאחר מכן, תקן #2 כדי להשיג את העקומה הסטנדרטית. הערה: יש להשתמש בפתרון הסטנדרטי באותו יום לאחר הגדרתו; השארתו למשך זמן רב מדי תגרום לשגיאה גדולה בעקומה הסטנדרטית.</li>
		<li>הניחו את הדגימות לבדיקה בבארות הבדיקה בזו אחר זו, התאימו את נפח זינוק הדנ"א ל-2 מיקרוליטר, חזרו על המדידה שלוש פעמים, קחו את הערך הממוצע ורשמו.</li>
	</ol></li>
</ol>4. PCR וזיהוי אלקטרופורטי
הערה: רצף הגן CO <img alt="Equation 1" src="/files/ftp_upload/66737/66737eq01v2.jpg" style="margin: auto;"> מיטוכונדריאלי באורך של 278 bp נלקח להגברת PCR עם פריימר קדמי C1-J-2495: CAGCTACTTTATGAGCTTTAGG, ופריימר הפוך C1-N-2800: CATTTCAAGCTGTGTAAGCATC8, ולאחר מכן 2% אלקטרופורזה ג'ל אגרוז נעשה כדי לאמת את אפקט ההגברה ואת אורך מוצרי ההגברה אומת.
<ol><li>הגדר 20 μL של מערכת הגברה PCR על ידי הוספת 10 μL של 2x תערובת Taq, 1 μL של כל פריימר, 5 μL של ddH2O, ו 3 μL של DNA תבנית; מערבבים היטב 10 שניות בצנטריפוגה.</li>
	<li>השתמש בפרמטרים הבאים של מחזור PCR: predenaturation 95 °C למשך 10 דקות; דנטורציה 95 ° C עבור 30 שניות, חישול 48 ° C עבור 30 שניות, הארכה 72 ° C עבור 45 s עבור סך של 40 מחזורים; והארכה סופית 72°C למשך 10 דקות.</li>
	<li>יש להעביר את המוצרים לאחר PCR לאלקטרופורזה של ג'ל אגרוז 2%, ולאחר אלקטרופורזה, להניח אותם על מערכת הדמיה ג'ל לניתוח תמונות.</li>
</ol>

הערכת טוהר וריכוז DNA בדגימות זבובים נקרופיליים טריים וישנים

<ol>
	<li>Amendt, J., Richards, C. S., Campobasso, C. P., Zehner, R., Hall, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Forensic+entomology:+applications+and+limitations.">Forensic entomology: applications and limitations.</a> Forensic Sci Med Pathol. 7 (4), 379-392 (2011).</li><li>Wydra, J., Matuszewski, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+optimal+post-eclosion+interval+while+estimating+the+post-mortem+interval+based+on+an+empty+puparium.">The optimal post-eclosion interval while estimating the post-mortem interval based on an empty puparium.</a> Forensic Sci Med Pathol. 17 (2), 192-198 (2021).</li><li>Mazzanti, M., Alessandrini, F., Tagliabracci, A., Wells, J. D., Campobasso, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+degradation+and+genetic+analysis+of+empty+puparia:+genetic+identification+limits+in+forensic+entomology.">DNA degradation and genetic analysis of empty puparia: genetic identification limits in forensic entomology.</a> Forensic Sci Int. 195 (1-3), 99-102 (2010).</li><li>Odeniran, P. O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=molecular+identification+and+distribution+of+Trypanosome-transmitting+Dipterans+from+cattle+settlements+in+Southwest+Nigeria.">molecular identification and distribution of Trypanosome-transmitting Dipterans from cattle settlements in Southwest Nigeria.</a> Acta Parasitol. 66 (1), 116-128 (2021).</li><li>Wells, J. D., Stevens, J. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+DNA-based+methods+in+forensic+entomology.">Application of DNA-based methods in forensic entomology.</a> Annu Rev Entomol. 53, 103-120 (2008).</li><li>Kotrba, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+barcoding+in+forensic+entomology-establishing+a+DNA+reference+library+of+potentially+forensic+relevant+arthropod+species.">DNA barcoding in forensic entomology-establishing a DNA reference library of potentially forensic relevant arthropod species.</a> J Forensic Sci. 64 (2), 593-601 (2019).</li><li>Weedon, M. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+SNP+chips+to+detect+rare+pathogenic+variants:+Retrospective,+population+based+diagnostic+evaluation.">Use of SNP chips to detect rare pathogenic variants: Retrospective, population based diagnostic evaluation.</a> BMJ. 372, 214 (2021).</li><li>Cai, J. -. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+availability+of+mitochondrial+DNA+cytochrome+oxidasegene+for+the+distinction+of+forensically+important+flies+in+China.">The availability of mitochondrial DNA cytochrome oxidasegene for the distinction of forensically important flies in China.</a> Acta Entomologica Sinica. 48 (3), 380-385 (2005).</li><li>Khayrova, A., Lopatin, S., Varlamov, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obtaining+chitin,+chitosan+and+their+melanin+complexes+from+insects.">Obtaining chitin, chitosan and their melanin complexes from insects.</a> Int J Biol Macromol. 167, 1319-1328 (2021).</li><li>Guo, Y. Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+three+DNA+extracting+methods+from+different+parts+of+common+necrophagous+flies.">Comparison of three DNA extracting methods from different parts of common necrophagous flies.</a> J Henan Univ Sci Tech (Med Sci). 36 (02), 130-133 (2018).</li><li>Du, H., Xie, H., Ma, M., Igarashi, Y., Luo, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modified+methods+obtain+high-quality+DNA+and+RNA+from+anaerobic+activated+sludge+at+a+wide+range+of+temperatures.">Modified methods obtain high-quality DNA and RNA from anaerobic activated sludge at a wide range of temperatures.</a> J Microbiol Methods. 199, 106532 (2022).</li><li>Sukumaran, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concentration+determination+of+nucleic+acids+and+proteins+using+the+micro-volume+BioSpec-nano-spectrophotometer.">Concentration determination of nucleic acids and proteins using the micro-volume BioSpec-nano-spectrophotometer.</a> J Vis Exp. (48), e2699 (2011).</li><li>Masago, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+between+fluorimetry+(Qubit)+and+spectrophotometry+(NanoDrop)+in+the+quantification+of+DNA+and+RNA+extracted+from+frozen+and+FFPE+tissues+from+lung+cancer+patients:+A+real-world+use+of+genomic+tests.">Comparison between fluorimetry (Qubit) and spectrophotometry (NanoDrop) in the quantification of DNA and RNA extracted from frozen and FFPE tissues from lung cancer patients: A real-world use of genomic tests.</a> Medicina (Kaunas). 57 (12), 1375 (2021).</li><li>Ponti, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+value+of+fluorimetry+(Qubit)+and+spectrophotometry+(NanoDrop)+in+the+quantification+of+cell-free+DNA+(cfDNA)+in+malignant+melanoma+and+prostate+cancer+patients.">The value of fluorimetry (Qubit) and spectrophotometry (NanoDrop) in the quantification of cell-free DNA (cfDNA) in malignant melanoma and prostate cancer patients.</a> Clin Chim Acta. 479, 14-19 (2018).</li><li>Adams, Z. J., Hall, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+used+for+the+killing+and+preservation+of+blowfly+larvae,+and+their+effect+on+post-mortem+larval+length.">Methods used for the killing and preservation of blowfly larvae, and their effect on post-mortem larval length.</a> Forensic Sci Int. 138 (1-3), 50-61 (2003).</li><li>Fliegerova, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+DNA+extraction+and+sample+preservation+method+on+rumen+bacterial+population.">Effect of DNA extraction and sample preservation method on rumen bacterial population.</a> Anaerobe. 29, 80-84 (2014).</li><li>Rodrigues, B. L., Galati, E. A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+taxonomy+of+phlebotomine+sand+flies+(Diptera,+Psychodidae)+with+emphasis+on+DNA+barcoding:+A+review.">Molecular taxonomy of phlebotomine sand flies (Diptera, Psychodidae) with emphasis on DNA barcoding: A review.</a> Acta Trop. 238, 106778 (2023).</li></ol>

המחברים מצהירים כי אין להם אינטרסים כלכליים מתחרים.

מיצוי DNA הוא החוליה הקריטית ביותר בזיהוי מולקולרי של זבובים נקרופיליים, ושיטת המיצוי שלו ואיכות הדנ"א המופק משפיעים ישירות על הגילוי לאחר מכן. בניסוי זה חילצנו בהצלחה דנ"א מזבובים נקרופיליים באמצעות ערכת דם נפוצה, ללא צורך ברכישת ערכת מיצוי דנ"א מיוחדת של חרקים, מה שמקל על מיצוי דנ"א של חרקי...

<a href="https://app.jove.com/t/6604">This corrects</a> the article <a href="https://dx.doi.org/10.3791/66737">10.3791/66737</a>

An erratum was issued for:&#160;<a href="https://www.jove.com/t/66737">DNA Extraction and Comparison Between Old and Fresh Necrophilic Fly Samples</a>. The Authors section was updated.

Erratum: DNA Extraction and Comparison Between Old and Fresh Necrophilic Fly Samples

היקש זמן המוות היה מאז ומתמיד אחד הנושאים המרכזיים והקשים לפתרון בפרקטיקה השיפוטית. בפרקטיקה של מדע פורנזי, עבור תיק פלילי, קביעת מרווח לאחר המוות משחקת תפקיד מכריע בהסקת זמן הפשע, נעילת החשוד וצמצום היקף החקירה. שיטות מסורתיות להסיק את זמן המוות מבוססות בעיקר על תופעות מוקדמות לאחר המוות, אשר בדרך כלל ניתן להשתמש בהן רק כדי להסיק את זמן המוות בתוך 24 שעות. עם זאת, זמן המוות הארוך אינו יכול להיקבע על ידי תופעות שלאחר המוות. כיום מקובל בקהילת המדע הפורנזי כי לאנטומולוגיה משפטית יש פוטנציאל להיות שיטה יעילה להסיק זמן מוות ארוך יותר.
חרקים נקרופגיים נקראים על שם הזחלים שלהם הניזונים מגוויות. ביניהם, בכל פעם שיש גופה, הזבובים הנקרופיליים הבוגרים יהיו הראשונים להגיע לגופה ולהטיל את ביציהם או זחליהם. הזחלים ניזונים מרקמת הגופה ומבשילים לגלמים, המתגלגלים לבוגרים. זבובים נקרופיליים ממלאים תפקיד עצום בפועל של מדע פורנזי בגלל מחזור החיים הרגיל שלהם ותפוצה גיאוגרפית, למשל, ניכוי זמן המוות וקביעת מקום המוות 1,2. עם זאת, המחסום לשימוש בזבובים נקרופיליים בפרקטיקה משפטית הוא זיהוי מינים. שיטות מורפולוגיות עדיין משמשות כשיטה המוסמכת לזיהוי מינים של זבובים נקרופיליים. עם זאת, זיהוי מינים מורפולוגיים דורש רמה גבוהה של שלמות חרקים. אם הזבובים היו בשלבי התפתחות שונים, או עקב שינויים מורפולוגיים שנגרמו כתוצאה מבחירות סביבתיות, כל אלה מקשים על הבדיקה המורפולוגית. בפרט, המורפולוגיה של גלמים וקליפות גולמים, אשר נמצאים לרוב בזירת הפשע, בקושי ניתן לזיהוי. עובדה זו, יחד עם מיעוטם של מומחים מורפולוגיים, מקשה מאוד על זיהוי המינים מבחינה מורפולוגית. לכן, התפתחה שיטת הביולוגיה המולקולרית לזיהוי מינים של זבובים, המפחיתה את הקושי בזיהוי מורפולוגי ואינה תלויה בשלב ההתפתחותי 3,4,5,6,7.
הצעד הראשון בזיהוי מינים של זבובים נקרופיליים המבוסס על שיטות ביולוגיה מולקולרית הוא מיצוי יעיל של DNA, בעוד ערכות מיוחדות למיצוי DNA של חרקים אינן זמינות כיום בדרך כלל. וכיצד להשתמש בערכות דם נפוצות למיצוי DNA של זבובים נקרופיליים הופך רלוונטי יותר מבחינה משפטית. זבובים נקרופיליים שנמצאו בזירות פשע מושחתים לעתים קרובות או עברו ריקבון והשפלת DNA. דגימות זבובים אינן זמינות באופן מיידי למיצוי DNA לאחר הרכישה, או במידת האפשר, יש לשמור דגימות שלמות עקב דרישות שימור ראיות. בהתבסס על הדרישות לעיל, במחקר זה, יישמנו את ערכת הדנ"א של הדם המבוססת על עיכול פרוטאינאז K, ובחרנו שלוש דגימות טריות של Chrysomya megacephala (Diptera, Lepidoptera) (איור 1), דגימה ישנה אחת של C. megacephala שהושמה באלכוהול במשך שנתיים, ודגימה אחת של C. megacephala שהושמה באחסון מוגן אור במשך שנתיים, שקלנו כל אחת מחמש הדגימות, בחר את רקמת בית החזה של החרק למיצוי DNA. השוואת האיכות והטוהר של הדנ"א שהופק מהדגימות הישנות והחדשות, הגברה PCR ואלקטרופורזה של הדנ"א שחולץ בוצעו באמצעות פריימרים ספציפיים לזבוב נקרופילי הממוקמים ברצף הגן CO <img alt="Equation 1" src="/files/ftp_upload/66737/66737eq01v2.jpg" style="margin: auto;"> מיטוכונדריאלי.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Buffer AE</td>
			<td>Qiagen</td>
			<td>172026832</td>
			<td>DNA elution buffer</td>
		</tr>
		<tr>
			<td>Buffer AL</td>
			<td>Qiagen</td>
			<td>172028374</td>
			<td>lysis buffer</td>
		</tr>
		<tr>
			<td>Buffer ATL</td>
			<td>Qiagen</td>
			<td>172028162</td>
			<td>tissue lysis buffer</td>
		</tr>
		<tr>
			<td>Buffer AW1</td>
			<td>Qiagen</td>
			<td>172028760</td>
			<td>protein removal buffer</td>
		</tr>
		<tr>
			<td>Buffer AW2</td>
			<td>Qiagen</td>
			<td>57203108</td>
			<td>desalination buffer</td>
		</tr>
		<tr>
			<td>C1-J-2495</td>
			<td>Taihe Biotechnology</td>
			<td>TW21109216</td>
			<td>forword primer</td>
		</tr>
		<tr>
			<td>C1-N-2800</td>
			<td>Taihe Biotechnology</td>
			<td>TW21109217</td>
			<td>reverse primer</td>
		</tr>
		<tr>
			<td>D2000 DNA ladder</td>
			<td>Real-Times(Beijing) Biotechnology</td>
			<td>RTM415</td>
			<td>Measure the position of electrophoretic bands</td>
		</tr>
		<tr>
			<td>DNeasy Mini spin column</td>
			<td>Qiagen</td>
			<td>166050343</td>
			<td>DNA adsorption column</td>
		</tr>
		<tr>
			<td>Dry Bath Incubator</td>
			<td>Miulab</td>
			<td>DKT200-2D</td>
			<td>used for heating</td>
		</tr>
		<tr>
			<td>MIX-30S Mini Mixer</td>
			<td>Miulab</td>
			<td>MUC881206</td>
			<td>oscillatory action</td>
		</tr>
		<tr>
			<td>Proteinase K</td>
			<td>Qiagen</td>
			<td>172026218</td>
			<td>Inactivation of intracellular nucleases and other proteins</td>
		</tr>
		<tr>
			<td>Qubit 3.0 Fluorometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>2321611188</td>
			<td></td>
		</tr>
		<tr>
			<td>Speed Micro-Centrifuge</td>
			<td>Scilogex</td>
			<td>9013001121</td>
			<td>centrifuge</td>
		</tr>
		<tr>
			<td>Standard#1</td>
			<td>Thermo Fisher Scientific</td>
			<td>2342797</td>
			<td></td>
		</tr>
		<tr>
			<td>Standard#2</td>
			<td>Thermo Fisher Scientific</td>
			<td>2342797</td>
			<td></td>
		</tr>
		<tr>
			<td>Tanon 3500R Gel Imager</td>
			<td>Tanon</td>
			<td>16T5553R-455</td>
			<td>gel imaging</td>
		</tr>
		<tr>
			<td>Taq Mix Pro</td>
			<td>Monad</td>
			<td>00007808-140534</td>
			<td>PCR Mix</td>
		</tr>
		<tr>
			<td>Taq Mix Pro</td>
			<td>Monad</td>
			<td>00007808-140534</td>
			<td>PCR Mix</td>
		</tr>
		<tr>
			<td>Thermo Cycler</td>
			<td>Zhuhai Hema</td>
			<td>VRB020A</td>
			<td>ordinary PCR</td>
		</tr>
		<tr>
			<td>Working Solution</td>
			<td>Thermo Fisher Scientific</td>
			<td>2342797</td>
			<td></td>
		</tr>
	</tbody>
</table>

dna extraction and comparison between old and fresh necrophilic fly samples

בסך הכל נבחרו חמש דגימות של Chrysomya megacephala - שלוש דגימות טריות, דגימה אחת שאוחסנה באלכוהול במשך שנתיים, ודגימה אחת שאוחסנה באחסון אטום יבש במשך שנתיים המוגנת מפני אור בלבד - כדי לחקור אם ערכת מיצוי DNA בדם יכולה להפיק DNA מזבובים נקרופיליים ולקבוע אם אלכוהול יכול להאריך את שימור הדנ"א של זבובים נקרופיליים. ראשית, ערכת מיצוי הדנ"א בדם שימשה להפקת דנ"א מרקמות בית החזה שלהם. לאחר מכן, טוהר הדנ"א וריכוזו נבדקו באמצעות קורא מיקרו-צלחות ופלואורומטר. לבסוף, הגברה PCR ואלקטרופורזה של הדנ"א שחולץ נעשו עם פריימרים ספציפיים לזבוב נקרופילי הממוקם ברצף הגן CO I המיטוכונדריאלי. התוצאות הראו כי טוהר הדנ"א של כל הדגימות היה גדול מ-2.0. ריכוז הדנ"א נצפה בסדר הבא: דגימות טריות > דגימות ישנות שהשתמרו באלכוהול > דגימות ישנות שלא טופלו. לכל הדגימות היו רצועות אלקטרופורטיות ספציפיות לאחר הגברה של PCR. לסיכום, ניתן להשתמש בערכת מיצוי DNA בדם כדי לחלץ דנ"א מזבובים נקרופיליים בהצלחה, וריכוז הדנ"א של דגימות זבובים טריים גדול מזה של דגימות זבובים ישנים. הזבובים יכולים להיות מאוחסנים באלכוהול במשך זמן רב.

The inference of the time of death has always been one of the key and difficult issues to be resolved in judicial practice. In the practice of forensic science, for a criminal case, determining postmortem interval plays a crucial role in deducing the time of the crime, locking in the suspect, and narrowing the scope of the investigation. Traditional methods of inferring the time of death are based primarily on early postmortem phenomena, which can generally only be used to infer the time of death within 24 h. However, the long time of death cannot be determined by postmortem phenomena. It is now generally recognized in the forensic science community that forensic entomology has the potential to be an effective method of inferring a longer time of death.
Necrophagous insects are named for their larvae that feed on corpses. Among them, whenever a corpse is present, the adult necrophilous flies will be the first to reach the corpse and lay their eggs or larvae. The larvae feed on corpse tissue and mature into pupae, which fledge into adults. Necrophilic flies play a huge role in the practice of forensic science because of their regular life cycle and geographic distribution, for example, deducting the time of death and determining the place of death1,2. However, the barrier to the use of necrophilous flies in forensic practice is species identification. Morphological methods are still used as the authoritative method for species identification of necrophilous flies. However, morphological species identification requires a high degree of insect integrity. If the flies were in different developmental stages, or due to morphological changes caused by environmental choices, those all make morphological examination more difficult. In particular, the morphology of pupae and pupal shells, which are most often found at the crime scene, is barely recognizable. This, together with the scarcity of morphological experts, makes huge difficulty to the identification of species morphologically. Therefore, the application of molecular biology methods for species identification of flies has emerged, which reduces the difficulty of morphological identification and is independent of developmental stage3,4,5,6,7.
The first step in species identification of necrophilous flies based on molecular biology methods is the efficient extraction of DNA, while specialized kits for insect DNA extraction are not commonly available currently. And how to use common blood kits for DNA extraction of necrophilic flies becomes more forensically relevant. Necrophilic flies found at crime scenes are often mutilated or have undergone decay and DNA degradation. Fly samples are not immediately available for DNA extraction after acquisition, or if possible, complete samples need to be retained due to evidence preservation requirements. Based on the above requirements, in this study, we applied the blood DNA kit based on proteinase K digestion, and selected three fresh Chrysomya megacephala (Diptera, Lepidoptera) samples (Figure 1), one old C. megacephala sample placed in alcohol for two years, and one C. megacephala sample placed in light-protected storage for two years, weighed each of the five samples, elected the insect thorax tissue for DNA extraction. Comparing the quality and purity of DNA extracted from the old and new samples, PCR amplification and electrophoresis of the extracted DNA were performed with necrophilic fly-specific primers located in the mitochondrial CO <img alt="Equation 1" src="/files/ftp_upload/66737/66737eq01v2.jpg" style="margin: auto;" /> gene sequence.

מחבר זרקור: קידום מיצוי DNA מדגימות זבוב נקרופילי באמצעות טכניקה פשוטה

מיצוי DNA והשוואה בין דגימות זבוב נקרופילי ישן וטרי

Our particle aims to extract fly DNA simply and conveniently, and compare the DNA concentrations between new and old samples of necrophilic flies. We're trying investigating whether blood DNA extraction kits effectively extract DNA from fly, and is there a change between DNA concentrations from new and old sample of necrophilic flies? We provided a method for extracting fly DNA using ordinary blood test kits, which solved the problem of expensive and scarce insect extraction kits, and paved the way for molecular biology analysis of these sets.After solving the problem of extracting fly DNA, necrophilic flies to avert the time of death.

השתמשנו בקורא מיקרו-צלחות כדי למדוד את הערכים של OD260 ו-OD280 של תמיסת הדנ"א שחולצה, ולאחר מכן קיבלנו את ערכי OD260/OD280 כדי להעריך את טוהר הדנ"א. OD260/OD280 של כל הדגימות הטריות והמדגם הישן 1 היה גדול מ- 2. הערך המרבי של OD260/OD280 של מדגם 2 הישן היה 2.187 למרות שהממוצע היה 1.753, ושלוש המדידות שלו השתנו מאוד בגלל הער...

Read this Scientific Article Protocol about DNA Extraction and Comparison between Old and Fresh Necrophilic Fly Samples at JoVE.com

מאמר זה מתאר פרוטוקול למיצוי DNA של זבוב נקרופילי טרי וישן באמצעות ערכת מיצוי DNA משותפת שונה.

A total of five samples of Chrysomya megacephala samples - three fresh samples, one sample stored in alcohol for 2 years, and one sample stored in dry ...

dna-extraction-comparison-between-old-fresh-necrophilic-fly

Research

JoVE Journal

Medicine

DNA Extraction and Comparison Between Old and Fresh Necrophilic Fly Samples

272 Views.  Hainan Medical University, Hainan Provincial Academician Workstation (tropical forensic medicine). מטרת החלקיק שלנו היא להפיק דנ"א זבוב בפשטות ובנוחות, ולהשוות את ריכוזי הדנ"א בין דגימות חדשות וישנות של זבובים נקרופיליים. אנחנו מנסים לחקור האם ערכות מיצוי דנ"א בדם מפיקות דנ"א ביעילות מזבובים, והאם יש שינוי בין ריכוזי דנ"א מדגימה חדשה וישנה של זבובים נקרו...

Video: מחבר זרקור: קידום מיצוי DNA מדגימות זבוב נקרופילי באמצעות טכניקה פשוטה

A total of five samples of Chrysomya megacephala samples - three fresh samples, one sample stored in alcohol for 2 years, and one sample stored in dry sealed storage for 2 years protected from light only - were selected to investigate whether a blood DNA extraction kit could extract DNA from necrophilous flies and to determine whether alcohol could prolong the preservation of necrophilous flies&#39; DNA. First, the blood DNA extraction kit was used to extract DNA from their thorax tissues. Then, the DNA purity and concentration were examined using a microplate reader and a fluorometer. Finally, PCR amplification and electrophoresis of the extracted DNA were done with necrophilic fly-specific primers located in the mitochondrial CO I gene sequence. The results showed that the DNA purity of all samples was greater than 2.0. The DNA concentration was observed to be of the following order: fresh samples &#62; alcohol-preserved old samples &#62; untreated, old samples. All samples had specific electrophoretic bands after PCR amplification. In conclusion, a blood DNA extraction kit can be used to extract DNA from necrophilic flies successfully, and the DNA concentration of fresh fly samples is greater than that of old fly samples. The flies can be stored in alcohol for a long time.

This article describes a protocol for fresh and old necrophilic fly DNA extraction using a modified common DNA extraction kit.

Preparation of Necrophilic Fly Samples for DNA Extraction

To begin, sacrifice flies with ethyl acetate, and place the samples in three gas vials. Weigh the samples, and label them as fresh one, two, and three. Next, retrieve 2-year-old samples stored in alcohol filled centrifuge tubes, and absorb surface liquid with filter paper and weigh the samples.Also, retrieve 2-year-old samples stored in centrifuge tubes and weigh them. Then, add a small amount of liquid nitrogen to a stainless steel container, and wait until all liquid nitrogen has evaporated. Place a fly sample in the container, and slowly pour liquid nitrogen.Freeze the samples in liquid nitrogen, and remove them after the liquid nitrogen evaporates. Separate the thorax individually, followed by slicing each thorax. Place the slices in a two milliliter centrifuge tube.

הכנת דגימות זבוב נקרופילי למיצוי DNA

DNA Extraction from Necrophilic Fly Samples

To begin place the clipped fly thorax samples in a two-milliliter centrifuge tube. Add 180 microliters of tissue lysis buffer to the tube, followed by 20 microliters of Proteinase K.Vortex thoroughly at 3, 000 RPM for 10 seconds and incubate at 56 degrees Celsius until tissues are lysed. After incubation, vortex the samples again for 15 seconds.Add 200 microliters of lysis buffer, and mix thoroughly by vortexing. Then add 200 microliters of ethanol and vortex again for 15 seconds. Next, place a DNA absorption column in a two-milliliter collection tube and pipette the mixture into the column.Centrifuge at 6, 000 G for one minute. Discard flow through and the collection tube. Place the column in a new tube and add 500 microliters of protein removal buffer.Centrifuge for one minute and discard the flow through. Transfer the column to a new tube. Add 500 microliters of desalination buffer and centrifuge at 20, 000 G for three minutes to dry the membrane.Then add 100 microliters of DNA elution buffer onto the membrane. Incubate a room temperature for one minute and then centrifuge at 6, 000 G for one minute to elute the DNA. Store the DNA samples as appropriate.

מיצוי DNA מדגימות זבוב נקרופילי

Qualitative and Quantitative Analysis of DNA Extracted from Fly Samples

To begin, extract DNA from fly samples using a DNA extraction kit. Then use a microplate reader to determine the values of OD260 and OD280 to compare DNA purity and nucleic acid concentration. Next, prepare fluorometer standard solutions by adding 190 microliters of working solution to two 0.5 milliliters centrifuge tubes.Then add 10 microliters each of standard one and standard two to the working solutions. Keep the tubes away from light for at least 15 minutes. Mix two microliters of test DNA with 198 microliters of working solution in a 0.5 milliliter centrifuge tube and keep the mixture in the dark for at least 15 minutes.After 15 minutes, turn on the fluorometer and select the dsDNA concentration measurement, long range setting. Test standard one and standard two to obtain the standard curve. Then place the samples to be tested in the assay wells.Adjust the DNA spiking volume to two microliters and perform the measurement. To visualize the DNA first set up 20 microliters of the PCR amplification reaction. Place the tubes in a thermal cycler and run the PCR cycles.After PCR, subject the products to 2%agarose gel electrophoresis. Then place the gel on a gel imaging system for photo analysis. Assessment of extracted DNA purity by Microplate reader showed that all fresh samples and old sample one had OD260 to OD280 ratios above two.In contrast, old sample two displayed a lower ratio. DNA concentration derived from OD260 readings was highest in fresh samples, followed by old sample one and lowest in old sample two. Electrophoretic analysis revealed bands in the range of 250 to 400 base pairs, which were more pronounced in fresh samples, compared to old ones.