The authors wish to acknowledge the many Alexandrov lab members who have contributed to the development of the LTE systems over the last 10 years, in particular Sergey Mureev who pioneered the system and developed the SITS ribosome entry site. Figure 1 was created by Biorender.com and reproduced under licence.

This protocol includes detailed media recipes and steps that involve culturing, centrifuging, measuring GFP fluorescence using a multimode platereader, measuring culture OD600nm, and assessing lysate Abs280nm. It also covers the setup and imaging of SDS-PAGE protein gels. The materials required or suggested for this protocol are listed in the Materials spreadsheet. It&#39;s important to note that typical laboratory resources such as media components, centrifuges, tubes, spectrophotometers, and gel electrophoresis setups can likely be used interchangeably unless specified otherwise. Figure 1 provides a summary of the LTE manufacturing process.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/65592/65592fig01.jpg" /> 
Figure 1: Overview of LTE manufacturing protocol. This cartoon provides a concise summary of the LTE manufacturing protocol. <a href="https://www.jove.com/files/ftp_upload/65592/65592fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
1. Growth of Leishmania tarentolae&#160; cultures
<ol>
	<li>Prepare at least 3 L of TBGG growth media (Bactotryptone 12 g/L, Yeast extract 24 g/L, glycerol 8 mL/L, glucose 1 g/L, KH2PO4 2.3 g/L, K2HPO4 2.5 g/L, see Table of Materials). Sterilize the media using a 0.22 &#181;m filter under vacuum or a similar setup.</li>
	<li>Store the media at room temperature (RT), with the final additions (Hemin, Antibiotics) added just before inoculation with&#160;L. tarentolae. Hemin (0.25% v/v in 50% triethanolamine) is added at 0.2% v/v, Penicillin (10,000 units/mL) plus Streptomycin (10,000 &#181;g/mL) mix at 0.5% v/v. 
	NOTE: The starting point of this protocol is a maintained 2 x 10 mL culture of wild type L. tarentolae. Maintenance cultures are grown at 27 &#176;C in standard 50 mL tissue culture flasks with low shaking (75 rpm). Such 10 mL cultures can be maintained indefinitely with ~1/20 dilutions in sterile (TBGG + hemin, penicillin, streptomycin) every 2-3 days. A standard biosafety cabinet in a PC2 laboratory is recommended; however, bacterial contaminations tend to be prevented by the added antibiotics, while fungal contaminations are generally outgrown by L. tarentolae.</li>
	<li>Over two days, expand the L. tarentolae maintenance cultures to 200 mL (day 1) and then 2 L (day 2) via 1:10 dilutions with an increasing volume of TBGG + hemin/antibiotics each day. Perform both dilutions in autoclave-sterilized baffled 5 L glass flasks (filled to a maximum of 1 L). The second dilution must occur in the afternoon between 3-6 pm, with the intention of starting lysate production the next day between 8-11 am. 
	NOTE: This protocol uses the minimum starting volume for LTE production (2 x 1 L cultures). It is also possible to expand the culture up to 10 L for LTE production by incorporating an additional expansion step (e.g., Day 1: 100 mL; Day 2: 1 L; Day 3: 10 L). Although this protocol uses baffled flasks (see Table of Materials) to grow L. tarentolae, optionally, conventional bioreactors designed for bacterial growth with Rushton impellers can be used, provided the stirring rate is kept below 100 rpm. Improved aeration and pH control in bioreactors generally extend the log-phase growth of the L. tarentolae cultures, allowing for a higher harvest OD600nm of 10 to be used in step 1.4.</li>
	<li>Record the OD600nm of the culture in triplicate via a 1:10 dilution in TBGG directly in the spectrophotometer cuvette. A suitable starting range for making lysate is OD600nm = 4.0-8.0.</li>
	<li>Provide additional incubation time if OD600nm &#60; 4.0. A culture with OD600nm &#62; 8 is usable and will result in a greater volume of cell-free expression lysate, but with lower quality due to the onset of the late-log growth phase. Place culture flasks on ice, awaiting subsequent steps. 
	&#8203;NOTE: Accurate measurement of the final culture OD600nm is critical, as it is used to calculate the final volume for concentrated cells prior to disruption. This calculation replaces a pellet weighing method used in earlier versions of LTE manufacture to calibrate cell concentration prior to disruption34, in order to simplify the protocol. Ensure to dilute in TBGG for OD600nm measurement, as otherwise, osmotic shock changes the cell shape, causing measurement error. Pipette mix the 1:10 dilution for OD600nm measurement (directly in the cuvette) seconds before taking the spectrophotometric read, as L. tarentolae cells rapidly settle out with a distinctive cloudy appearance. If the final volume of the expression culture is considered approximate, weighing flasks at harvest (with suitable empty flask tare) to get a better estimated volume (at 1 g = 1 mL) is also recommended. The maximum OD600nm possible from L. tarentolae growth in baffled flasks is 15-20, although this is inappropriate for lysate manufacture due to reaching the stationary phase.</li>
</ol>
2. Concentration of&#160;&#160;L. tarentolae cultures
<ol>
	<li>The Leishmania cells must be washed and concentrated approximately 60x prior to disruption. Calculate the target volume for cell concentration based on OD600nm = 300 for the final concentrate. The equation is V = harvest volume (mL) x (harvest OD600nm/300). For example, using a 2 L culture with a harvest OD600 = 5, the target volume is 33 mL. 
	NOTE: The OD600nm target of 300 can be modified; previous LTE production has used values in the range of 150-350. Higher concentrations of cells going into disruption will tend to yield final cell-free expression reactions with higher protein yields, but with an increased tendency for vulnerable proteins to aggregate. OD600nm = 300 represents a suitable default target for LTE production.</li>
	<li>Transfer the harvested cultures to suitable centrifuge bottles and spin them at 2500 x g for 10 min at 4 &#176;C. Carefully decant the supernatant into the culture waste. 
	NOTE: It is important to minimize the loss of cells into the discarded supernatant, as it affects the calculation of disruption loading. In previous LTE production protocols, the concentration of L. tarentolae cells for disruption was calibrated by spinning down the cell concentrate in a test microcentrifuge tube and measuring the pellet weight versus the total weight34. This simplified protocol instead uses a theoretical OD600nm target for the concentrate, based on the measured harvest OD600nm, and assumes low cell loss during cell concentration and washing.</li>
	<li>Wash the cell pellet in SEB buffer (45 mM HEPES-KOH pH 7.6, 250 mM sucrose, 100 mM KOAc, 3 mM Mg(OAc)2, kept on ice) three times, each time centrifuging at 2500 x g for 10 min at 4 &#176;C. For the first wash, resuspend each 1 L of pelleted culture in 100 mL of SEB buffer, then combine them into a single centrifuge flask. For the second wash, also use 100 mL of SEB for each 1 L of the original culture. 
	NOTE: For the final pellet resuspension, add SEB buffer to 50% of the final target resuspension volume (step 2.1). This allows the pooled concentrate to be carefully topped up to exactly the final target volume in step 2.4. Each resuspension must be as gentle as possible to avoid premature lysis of L. tarentolae, for example, by gently swirling the added SEB around the decanted pellet or pipetting SEB over the pellet adhering to the centrifuge tube wall. It may be more convenient to transfer supernatants to smaller centrifuge tubes for the final step.</li>
	<li>Pour the resuspended concentrate into a suitable washed glass volumetric cylinder, then top up the volume to the target volume (step 2.1) using additional cold SEB and gently mix.</li>
</ol>
3. Lysis of L. tarentolae&#160; concentrate
<ol>
	<li>Transfer the cell concentrate into the nitrogen cavitation device (see Table of Materials) pre-cooled to 4 &#176;C, pressurize it to 70 bars of nitrogen, and incubate for 45 min on ice. 
	NOTE: While nitrogen cavitation disrupters are not common laboratory items, they are recommended for LTE production. Alternative methods such as cellular freeze-thaw and French-press type disrupters have been tried; however, protein expression activity was &#60;50% compared to using the nitrogen cavitation method. The nitrogen cavitation device must be thoroughly cleaned before use and between runs, similar to all reused vessels that come into contact with the cell lysate from this step onward (such as the receiver flask). A suitable cleaning regimen involves washing with laboratory detergents followed by thorough rinsing with deionized water.</li>
	<li>Open the vent on the nitrogen cavitation device and expel the resulting lysate into a suitably robust container, such as a vacuum receiver flask on ice. Tilt the receiver flask to ensure all of the resulting lysate settles and can be pipetted into a fresh centrifuge tube or a similar vessel. 
	&#8203;CAUTION: Nitrogen cavitation disrupters rely on the abrupt transition of the cell concentrate from 70 bars of nitrogen to ambient pressure, achieved through a strong flow of first liquid and then nitrogen through the device&#39;s exit valve. Venting must be done with appropriate personal protective equipment (PPE) in a chemical safety hood. There is a risk of breaking the destination vessel and losing the lysate, which is why we use a sturdy vacuum receiver instead of a generic flask. If the device&#39;s exit valve is a tube, avoid placing the tube directly inside the receiver to prevent excessive pressure buildup at the venting point.</li>
</ol>
4. Centrifugation of cell lysate
<ol>
	<li>Transfer the lysate to suitable g force rated centrifuge tubes and centrifuge at 10,000 x g for 15 min at 4 &#176;C. Remove the supernatant to fresh, similar centrifuge tubes.</li>
	<li>Centrifuge the lysate at 30,000 x g for 15 min at 4 &#176;C, and then remove the final supernatant to a fresh centrifuge tube or a similar container placed on ice. Estimate the total volume.</li>
</ol>
5. Gel filtration of cell lysate
NOTE: Gel filtration is used to remove sucrose included in the SEB buffer. While sucrose assists in stabilizing cellular machinery during cell disruption, it decreases yield if retained in protein expression reactions.
<ol>
	<li>Set up a sufficient number of PD-10 gravity-fed gel filtration columns (see Table of Materials) in a rack format that allows them to drip into a collection tray or a similar container beneath, ensuring they can filter the entire lysate volume at 2.5 mL per column. Pre-equilibrate the columns by passing 10 mL of 4 &#176;C EB buffer (45 mM HEPES-KOH pH 7.6, 100 mM KOAc, 3 mM Mg(OAc)2) through them beforehand. 
	NOTE: All steps from this point benefit from being conducted in a 4 &#176;C cold room. However, it is also suitable to keep all lysates and reagents on a benchtop ice tray. One exception is the gel filtration step, in which the authors place a rack of columns inside a 4 &#176;C fridge while rebuffering. In the original versions of this protocol, new gel filtration columns were &#39;blocked&#39; by initially buffering the lysate and discarding the first output. Although this is not considered necessary, columns must be flushed with EB buffer and stored at 4 &#176;C between lysate batches. The first output lysate may have lower protein expression activity than subsequent outputs due to some background retention of lysate components on the new column.</li>
	<li>Add 2.5 mL of lysate to each column and wait until it passes into the column. Add an additional 0.5 mL of EB to settle the lysate into the column while discarding the eluate.</li>
	<li>Elute the gel-filtered lysate by adding an additional 2.5 mL of EB to each column, collecting the output by placing a fresh, clean tray or another receptacle beneath the columns.</li>
</ol>
6. Supplementation of cell lysate
<ol>
	<li>Use the nanodrop spectrophotometer (see Table of Materials) to measure Abs280nm of the gel-filtered lysate. If it exceeds 60, dilute it to reach Abs280nm = 60 using additional 4 &#176;C EB buffer. 
	NOTE: While controlling cell density input into disruption using OD600nm approximately determines lysate output strength, normalizing the Abs280nm after lysate disruption and processing further improves the batch consistency of lysate performance. Lysate Abs280nm can be adjusted up and down, with consequences for protein expression yield and aggregation (see Discussion section). If the unsupplemented lysate indicates an Abs280nm &#60; 60, it may be necessary to include more Leishmania biomass in the disruption step, i.e., increase the cell disrupter loading to OD600nm &#62; 300 in step 2.1.</li>
	<li>Add 5x Feeding Solution (5x FS, Table 1) to the lysate in a 2:5 ratio and vortex mix thoroughly. Aliquot it into suitable containers (e.g., 1.5 mL microfuge tubes), and snap-freeze it in liquid nitrogen. If one is following the optional steps 7.1-7.3 for LTE expression optimization below, use the reduced rNTP.Mg 5x FS from Table 1 instead of the default 5x FS. Include 5 x 100 &#181;L aliquots for freezing for use in the optimization experiments. 
	&#8203;NOTE: Freezing with the default 5x FS in a 2:5 ratio creates expression-ready supplemented LTE, used at 7 &#181;L/10 &#181;L expression (hence, the 5x FS becomes 1x FS in the final reaction). However, the authors recommend following the further optional steps where 0.6x the default amount of rNTPs and magnesium is provided in the 5x FS. This is followed by an optimization step where an equimolar mix of the two (referred to as rNTP.Mg) is added to top up test reactions to an optimized value. The partial 5x FS also contains an oligonucleotide that shuts down endogenous mRNA expression (see Introduction section). The sequence of the oligonucleotide is CAATAAAGTACAGAAACTGATACTTATATAGCGTT.</li>
</ol>
7. QC and optimization of final supplemented LTE
NOTE: The minimum necessary steps to determine the appropriate &#39;top-up&#39; addition of rNTP.Mg to the reduced rNTP and magnesium-supplemented lysate involve expressing eGFP or a similar fluorophore (e.g., sfGFP) without a fusion partner. Increasing concentrations of rNTP.Mg are added to the reactions to determine the point at which expression level (measured as eGFP RFU via a multimode plate reader) is optimized. Premature terminations of eGFP, which are not fluorescent, become evident by decreasing eGFP RFU at too high rNTP.Mg concentrations. However, short-product malfunctions of LTE occur more frequently in larger expressed proteins (&#62;50 kDa). Hence, it is possible to perform this optimization using a larger template than eGFP, especially if one is available in a suitable expression vector, providing a fluorophore fusion that is desired to be produced by LTE for a particular application or study (see Representative Results section).
<ol>
	<li>Thaw a 100 &#181;L aliquot and set up six 10 &#181;L expression reactions, each composed of 7 &#181;L partially supplemented lysate from step 6.2, 1 &#181;L of top-up solution as per Table 2, and 2 &#181;L of ultrapure water containing sufficient DNA control template to achieve a final concentration of 50 ng/&#181;L in the reaction.</li>
	<li>Incubate the reactions for 2 h at 25 &#176;C and monitor the increase in GFP fluorescence using a multimode plate reader. 
	NOTE: Suitable configuration values for GFP are excitation at 485 nm (bandwidth 5 nm), emission at 516 nm (bandwidth 5 nm), with a reading interval of 1 min for 2 h.</li>
	<li>Rank the final expression values to determine the rNTP.Mg concentration corresponding to the highest eGFP RFU. If kinetic data is available, an excess of rNTP.Mg will also be indicated by a biphasic increase in eGFP RFU during the 2 h expression period (see Representative Results section).</li>
	<li>Once the optimized top-up rNTP.Mg concentration is determined, add it to all further protein expressions using the batch of LTE that was partially supplemented in the previous steps. 
	NOTE: If aliquoting in step 6.2 is done carefully with fixed volumes, the top-up can be retrospectively added to each aliquot without thawing, e.g., with the aliquots placed on dry ice. These aliquots are now fully supplemented, as the correct rNTP.Mg top-up will be mixed through each when they are thawed and mixed for use.</li>
</ol>

Streamlined Protocol for Leishmania Translational Extract (LTE) Production

<ol>
	<li>Nirenberg, M. W., Matthaei, J. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dependence+of+cell-free+protein+synthesis+in+E.coli+upon+naturally+occurring+or+synthetic+polyribonucleotides.">The dependence of cell-free protein synthesis in E.coli upon naturally occurring or synthetic polyribonucleotides.</a> Proc Natl Acad Sci USA. 47 (10), 1588-1602 (1961).</li><li>Caschera, F., Noireaux, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+2.3+mg/ml+of+protein+with+an+all+Escherichia+coli+cell-free+transcription-translation+system.">Synthesis of 2.3 mg/ml of protein with an all Escherichia coli cell-free transcription-translation system.</a> Biochimie. 99, 162-168 (2014).</li><li>Kelwick, R., Webb, A. J., MacDonald, J. T., Freemont, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+a+Bacillus+subtilis+cell-free+transcription-translation+system+for+prototyping+regulatory+elements.">Development of a Bacillus subtilis cell-free transcription-translation system for prototyping regulatory elements.</a> Metab Eng. 38, 370-381 (2016).</li><li>Ezure, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+protein+synthesis+system+prepared+from+insect+cells+by+freeze-thawing.">Cell-free protein synthesis system prepared from insect cells by freeze-thawing.</a> Biotechnol Prog. 22 (6), 1570-1577 (2006).</li><li>Harbers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wheat+germ+systems+for+cell-free+protein+expression.">Wheat germ systems for cell-free protein expression.</a> FEBS Letters. 588 (17), 2762-2773 (2014).</li><li>Kobs, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selecting+the+cell-free+protein+expression+system+that+meets+your+experimental+goals.">Selecting the cell-free protein expression system that meets your experimental goals.</a> Promega Corporation. 21, 6-9 (2008).</li><li>Kovtun, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Leishmania+cell-free+protein+expression+system.">Leishmania cell-free protein expression system.</a> Methods. 55 (1), 58-64 (2011).</li><li>Basile, G., Peticca, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+protein+expression+in+Leishmania+tarentolae.">Recombinant protein expression in Leishmania tarentolae.</a> Mol Biotechnol. 43 (3), 273-278 (2009).</li><li>Mureev, S., Kovtun, O., Nguyen, U. T., Alexandrov, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species-independent+translational+leaders+facilitate+cell-free+expression.">Species-independent translational leaders facilitate cell-free expression.</a> Nat Biotechnol. 27 (8), 747-752 (2009).</li><li>Gambin, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+fluorescence+reveals+the+oligomerization+and+folding+steps+driving+the+prion-like+behavior+of+ASC.">Single-molecule fluorescence reveals the oligomerization and folding steps driving the prion-like behavior of ASC.</a> J Mol Biol. 430 (4), 491-508 (2018).</li><li>Sierecki, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+mapping+of+interactions+between+human+SNX-BAR+proteins+measured+in+vitro+by+AlphaScreen+and+single-molecule+spectroscopy.">Rapid mapping of interactions between human SNX-BAR proteins measured in vitro by AlphaScreen and single-molecule spectroscopy.</a> Mol Cell Proteomics. 13 (9), 2233-2245 (2014).</li><li>Sierecki, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanomolar+oligomerization+and+selective+co-aggregation+of+alpha-synuclein+pathogenic+mutants+revealed+by+single-molecule+fluorescence.">Nanomolar oligomerization and selective co-aggregation of alpha-synuclein pathogenic mutants revealed by single-molecule fluorescence.</a> Sci Rep. 6, 37630 (2016).</li><li>Leitao, A., Bhumkar, A., Hunter, D. J. B., Gambin, Y., Sierecki, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unveiling+a+selective+mechanism+for+the+inhibition+of+alpha-synuclein+aggregation+by+beta-synuclein.">Unveiling a selective mechanism for the inhibition of alpha-synuclein aggregation by beta-synuclein.</a> Int J Mol Sci. 19 (2), 334 (2018).</li><li>Gambin, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+analysis+reveals+self+assembly+and+nanoscale+segregation+of+two+distinct+cavin+subcomplexes+on+caveolae.">Single-molecule analysis reveals self assembly and nanoscale segregation of two distinct cavin subcomplexes on caveolae.</a> Elife. 3, e01434 (2013).</li><li>Ve, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+basis+of+TIR-domain-assembly+formation+in+MAL-+and+MyD88-dependent+TLR4+signaling.">Structural basis of TIR-domain-assembly formation in MAL- and MyD88-dependent TLR4 signaling.</a> Nat Struct Mol Biol. 24 (9), 743-751 (2017).</li><li>Guo, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subunit+organisation+of+in+vitro+reconstituted+HOPS+and+CORVET+multisubunit+membrane+tethering+complexes.">Subunit organisation of in vitro reconstituted HOPS and CORVET multisubunit membrane tethering complexes.</a> PLoS One. 8 (12), e81534 (2013).</li><li>Ruehrer, S., Michel, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+Leishmania+tarentolae+cell-free+extracts+for+the+synthesis+of+human+solute+carriers.">Exploiting Leishmania tarentolae cell-free extracts for the synthesis of human solute carriers.</a> Mol Membr Biol. 30 (4), 288-302 (2013).</li><li>Varasteh Moradi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+Interactions+among+cell-free+expressed+Zika+virus+proteins.">Mapping Interactions among cell-free expressed Zika virus proteins.</a> J Proteome Res. 19 (4), 1522-1532 (2020).</li><li>Gagoski, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+pipeline+for+discovery+of+thermotolerant+xylanases+and+endo-1,4-beta-glucanases.">Cell-free pipeline for discovery of thermotolerant xylanases and endo-1,4-beta-glucanases.</a> J Biotechnol. 259, 191-198 (2017).</li><li>Ergun Ayva, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+performance+parameters+of+artificial+allosteric+protein+switches.">Exploring performance parameters of artificial allosteric protein switches.</a> J Mol Biol. 434 (17), 167678 (2022).</li><li>Lau, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+biosensor+for+real-time+interaction+dynamics+of+host+proteins+with+HIV-1+capsid+tubes.">Fluorescence biosensor for real-time interaction dynamics of host proteins with HIV-1 capsid tubes.</a> ACS Appl Mater Interfaces. 11 (38), 34586-34594 (2019).</li><li>Ryan, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+antiinflammatory+biologics+shaped+by+parasite-host+coevolution.">Novel antiinflammatory biologics shaped by parasite-host coevolution.</a> Proc Natl Acad Sci USA. 119 (36), e2202795119 (2022).</li><li>McMahon, K. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+intracellular+cavin+target+proteins+reveals+cavin-PP1alpha+interactions+regulate+apoptosis.">Identification of intracellular cavin target proteins reveals cavin-PP1alpha interactions regulate apoptosis.</a> Nat Commun. 10 (1), 3279 (2019).</li><li>Sierecki, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cell-free+approach+to+accelerate+the+study+of+protein-protein+interactions+in+vitro.">A cell-free approach to accelerate the study of protein-protein interactions in vitro.</a> Interface Focus. 3 (5), 20230018 (2013).</li><li>Johnston, W. A., Moradi, S. V., Alexandrov, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaption+of+the+Leishmania+cell-free+expression+system+to+high-throughput+analysis+of+protein+interactions.">Adaption of the Leishmania cell-free expression system to high-throughput analysis of protein interactions.</a> Methods Mol Biol. 2025, 403-421 (2019).</li><li>Jung, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-free+formation+and+interactome+analysis+of+caveolae.">Cell-free formation and interactome analysis of caveolae.</a> J Cell Biol. 217 (6), 2141-2165 (2018).</li><li>Fontaine, F. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+domain+analysis+of+SOX18+transcription+factor+using+a+single-chain+variable+fragment-based+approach.">Functional domain analysis of SOX18 transcription factor using a single-chain variable fragment-based approach.</a> MAbs. 10 (4), 596-606 (2018).</li><li>Overman, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pharmacological+targeting+of+the+transcription+factor+SOX18+delays+breast+cancer+in+mice.">Pharmacological targeting of the transcription factor SOX18 delays breast cancer in mice.</a> Elife. 6, e21221 (2017).</li><li>Kubala, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+farnesyltransferase+alpha+subunit+regulates+vacuolar+protein+sorting-associated+protein+4A+(Vps4A)--dependent+intracellular+trafficking+through+recycling+endosomes.">Mammalian farnesyltransferase alpha subunit regulates vacuolar protein sorting-associated protein 4A (Vps4A)--dependent intracellular trafficking through recycling endosomes.</a> Biochem Biophys Res Commun. 468 (4), 580-586 (2015).</li><li>Han, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cortactin+scaffolds+Arp2/3+and+WAVE2+at+the+epithelial+zonula+adherens.">Cortactin scaffolds Arp2/3 and WAVE2 at the epithelial zonula adherens.</a> J Biol Chem. 289 (11), 7764-7775 (2014).</li><li>Das Gupta, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Class+IIa+histone+deacetylases+drive+toll-like+receptor-inducible+glycolysis+and+macrophage+inflammatory+responses+via+pyruvate+kinase+M2.">Class IIa histone deacetylases drive toll-like receptor-inducible glycolysis and macrophage inflammatory responses via pyruvate kinase M2.</a> Cell Rep. 30 (8), 2712-2728.e8 (2020).</li><li>Leit&#227;o, A. D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selectivity+of+protein+interactions+along+the+aggregation+pathway+of+&#945;-synuclein.">Selectivity of protein interactions along the aggregation pathway of &#945;-synuclein.</a> BioRxiv. , (2021).</li><li>Gagoski, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Performance+benchmarking+of+four+cell-free+protein+expression+systems.">Performance benchmarking of four cell-free protein expression systems.</a> Biotechnol Bioeng. 113 (2), 292-300 (2016).</li><li>Johnston, W. A., Alexandrov, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+eukaryotic+cell-free+lysate+from+Leishmania+tarentolae.">Production of eukaryotic cell-free lysate from Leishmania tarentolae.</a> Methods Mol Biol. 1118, 1-15 (2014).</li><li>Hunter, D. J. B., Bhumkar, A., Giles, N., Sierecki, E., Gambin, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unexpected+instabilities+explain+batch-to-batch+variability+in+cell-free+protein+expression+systems.">Unexpected instabilities explain batch-to-batch variability in cell-free protein expression systems.</a> Biotechnol Bioeng. 115 (8), 1904-1914 (2018).</li></ol>

No competing financial interests are present.

Protocols for creating LTE have been published over the past decade7 and have undergone periodic updates25,34. However, newcomers to the technique often encounter a steep learning curve, resulting in delays in achieving high-quality and high-yield protein expression. Similar challenges have been reported by other research groups working with LTE35, particularly concerning significant batch-to-batch variations. The v...

In the 1960s, cell-free protein expression systems played a pivotal role in uncovering the genetic code1. However, prokaryotic cell-free protein expression systems, mainly based on E. coli, currently dominate both laboratory and commercial applications. While E. coli-based systems offer advantages such as cost-effectiveness, scalability, and high expression yields, they face challenges when producing multi-domain proteins in their active forms and facilitating the assembly of protein complexes2,3. In the present day, commonly used forms of eukaryotic Cell-Free Protein Synthesis (CFPS) include wheat germ extract (WGE), rabbit reticulocyte lysate (RRL), and insect cell lysate (ICL)4,5,6. This work introduces an alternative eukaryotic cell-free system that is both straightforward and scalable, based on the unicellular flagellate parasite Leishmania tarentolae.
Leishmania tarentolae can be cultivated easily in flasks using cost-effective media and can also be scaled up in bioreactors to achieve higher cell density. The presence of endogenous mRNAs in cell lysate, which might otherwise compete with introduced messages, can be neutralized using antisense oligonucleotides targeting the conserved Leishmania mRNA splice leader sequence7. Unlike its close relative Leishmania major, which causes human disease, L. tarentolae infects the moorish gecko (Tarentolae mauritanica), making it suitable for cultivation in PC2 laboratory environments without the need for special precautions. It has previously been used as a transgenic organism for in vivo protein expression8.
To facilitate template priming in cell-free systems, universal sequences have been designed based on polymeric RNA structures that enhance translational initiation9. These species-independent translation sequences (SITS) are applicable to both prokaryotic and eukaryotic cell-free systems and are suitable for introducing genetic information into LTE. While this protocol does not provide a detailed explanation of vector construction for LTE cell-free protein expression, optimization and quality control require suitable vectors containing fluorophore fusions of the desired proteins of interest downstream of the SITS site. For this purpose, appropriate LTE vectors have been deposited with the Addgene gene repository, such as the pCellFree_G03 vector, which encodes an N-terminal eGFP fusion to the desired protein of interest using Gateway cloning sites.
LTE has proven its value in a wide range of applications requiring protein expression, including the analysis of protein self-assembly10,16, production of human integral membrane proteins17, research on antiviral drug candidates18, the development of biotechnologically useful enzymes19, prototyping protein biosensors20,21, and the study of biologics from hookworms22. LTE has also been instrumental in mapping Protein-Protein interaction networks in the fields of virology and cellular structures21,32. LTE has been benchmarked to perform similarly to other eukaryotic cell-free systems in expressing full-length, monodispersed, and non-aggregated proteins33, all while offering more cost-effective and scalable production.
This protocol provides techniques for cultivating and disrupting the host organism, preparing lysate, and supplementing a feeding solution (FS) for coupled transcription/translation protein expression. Additionally, it includes a protocol for optimizing production batches. In the initial version of the Leishmania cell-free system, undesired batch-to-batch variation was observed in expression levels, the fraction of full-length proteins, and the presence of protein aggregates, leading to the disposal of batches34. Subsequent protocol improvements were made to address this issue25. The current protocol builds upon these improvements, allowing individual batches to be optimized for peak protein expression and size. It achieves this by closely controlling cell-disrupter loading (measured as optical density at 600 nm; OD600nm) and normalizing the resulting lysate output using absorbance at 280 nm (Abs280nm). Furthermore, it incorporates a method for partially supplementing the lysate with rNTP and magnesium during manufacturing, with subsequent optimization of these feed solution components during test expressions. Although this optimization is presented as an option in the protocol, it is strongly recommended by the authors.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >PD-10 SuperDex 25 Columns</td>
			<td >Cytiva</td>
			<td >17085101</td>
			<td >Gel filtration columns</td>
		</tr>
		<tr >
			<td >Nitrogen Cavitation cell disrupter</td>
			<td >Parr Industries</td>
			<td >4635 or 4639</td>
			<td>Cell Disrupter</td>
		</tr>
		<tr >
			<td >Bovine derived Hemin</td>
			<td >Sigma-Aldrich</td>
			<td >H5533</td>
			<td>Culture additive</td>
		</tr>
		<tr >
			<td >Penicillin/Streptomycin 10000U/ml</td>
			<td >Thermo-Fisher</td>
			<td >15140122</td>
			<td>Antibiotic mix</td>
		</tr>
		<tr >
			<td >Optiplate 384</td>
			<td >Perkin-Elmer</td>
			<td >6007290</td>
			<td>Multiwell plate for 10ul expressions</td>
		</tr>
		<tr >
			<td >Oligonucleotide</td>
			<td >IDT synthesis</td>
			<td ></td>
			<td>&#160;Oligo with sequence CAATAAAGTACAGAAACTGATAC TTATATAGCGTT</td>
		</tr>
		<tr >
			<td >Creatine Phosphokinase</td>
			<td >Sigma-Aldrich</td>
			<td >9001-15-4</td>
			<td>Enzyme</td>
		</tr>
		<tr >
			<td >Tecan Spark</td>
			<td >Tecan</td>
			<td ></td>
			<td >or similar Multimode Platereader</td>
		</tr>
		<tr >
			<td >Chemidoc MP Imager</td>
			<td >Biorad</td>
			<td ></td>
			<td>or similar SDS-PAGE gel Imager</td>
		</tr>
		<tr >
			<td >4-12% Bis-Tris Gels</td>
			<td >Invitrogen</td>
			<td >NW04125</td>
			<td>SDS-PAGE gels</td>
		</tr>
		<tr >
			<td >Biophotometer</td>
			<td >Eppendorf</td>
			<td ></td>
			<td >or similar Cuvette Specrophotometer</td>
		</tr>
		<tr >
			<td >Nanodrop One</td>
			<td >Thermofisher</td>
			<td ></td>
			<td>Nanodrop spectrophotometer</td>
		</tr>
		<tr >
			<td >Avanti JXN-26 centrifuge</td>
			<td >Beckman Coulter</td>
			<td ></td>
			<td>or similar centrifuge, with rotors/tubes rated 10K and 50K g</td>
		</tr>
		<tr >
			<td >5424R microcentrifuge</td>
			<td >Eppendorf</td>
			<td ></td>
			<td>or similar microcentrifuge, with 1.5ml microcentrifuge tubes</td>
		</tr>
		<tr >
			<td >Flask Incubator Inova S44i</td>
			<td >Eppendorf</td>
			<td ></td>
			<td>or similar flask incubator shaker suitable for 5L Flasks</td>
		</tr>
		<tr >
			<td >5L glass culture flasks</td>
			<td ></td>
			<td ></td>
			<td>Baffled glass flasks for culture growth</td>
		</tr>
		<tr >
			<td >Bactotryptone</td>
			<td >BD</td>
			<td >211705</td>
			<td>Growth medium</td>
		</tr>
		<tr >
			<td >Yeast Extract</td>
			<td >Merck</td>
			<td >VM930053</td>
			<td>Growth medium</td>
		</tr>
		<tr >
			<td >Glycerol</td>
			<td ></td>
			<td ></td>
			<td>Any analytical grade</td>
		</tr>
		<tr >
			<td >Glucose</td>
			<td ></td>
			<td ></td>
			<td>Any analytical grade</td>
		</tr>
		<tr >
			<td >KH2PO4</td>
			<td ></td>
			<td ></td>
			<td>Any analytical grade</td>
		</tr>
		<tr >
			<td >K2HPO4</td>
			<td ></td>
			<td ></td>
			<td>Any analytical grade</td>
		</tr>
		<tr >
			<td >UltraPure water</td>
			<td >Invitrogen</td>
			<td >10977-015</td>
			<td>Or output from any MilliQ-type water dispenser</td>
		</tr>
	</tbody>
</table>

production and optimization of lte, a leishmania tarentolae derived cell-free protein expression system for recombinant protein production

This protocol outlines the production and optimization of a eukaryotic Cell-Free Protein Expression System (CFPS) derived from the unicellular flagellate Leishmania tarentolae, referred to as Leishmania Translational Extract or LTE. Although this organism originally evolved as a parasite of geckos, it can be cultivated easily and inexpensively in flasks or bioreactors. Unlike Leishmania major, it is non-pathogenic to humans and does not require special laboratory precautions. Another advantage of using Leishmania for CFPS is that the addition of a single antisense oligonucleotide to the CFPS, targeting a conserved splice leader sequence on the 5'-end of all protein-coding RNAs, can suppress endogenous protein expression. We provide procedures for cell disruption and lysate processing, which have been simplified and improved compared to previous versions. These procedures start with simple flask cultures. Additionally, we explain how to introduce genetic information using vectors containing species-independent translation initiation sites (SITS) and how to perform straightforward batch optimization and quality control to ensure consistent protein expression quality.

The purpose of cell-free protein expression is to produce full-length proteins in a folded, active form suitable for a wide range of applications. LTE (Leishmania tarentolae extract) has previously been compared to other prokaryotic and eukaryotic cell-free expression systems, demonstrating a high capacity to avoid truncation and aggregation when operating optimally, particularly in comparison to E. coli-based cell-free expression33. However, this was previously accompanied by si...

Production and Optimization of LTE, a Leishmania tarentolae Derived Cell-Free Protein Expression System for Recombinant Protein Production

Leishmania Translational Extract (LTE) is a eukaryotic cell-free protein expression system derived from the single-celled parasite, Leishmania tarentolae. This optimized protocol makes LTE simple and cost-effective to manufacture. It is suitable for various applications focused on the multiparallel expression and study of complex eukaryotic proteins and their interactions.

This protocol outlines the production and optimization of a eukaryotic Cell-Free Protein Expression System (CFPS) derived from the unicellular flagellate ...

production-optimization-lte-leishmania-tarentolae-derived-cell-free

Without Section

Research

JoVE Journal

Bioengineering

510 Views.  Queensland University of Technology. Leishmania Translational Extract (LTE) is a eukaryotic cell-free protein expression system derived from the single-celled parasite, Leishmania tarentolae. This optimized protocol makes LTE simple and cost-effective to manufacture. It is suitable for various applications focused on the multiparallel expression and study of complex eukaryotic proteins and their interactions.

Video: Production and Optimization of LTE, a Leishmania tarentolae Derived Cell-Free Protein Expression System for Recombinant Protein Production

Synthesis of Infectious Bacteriophages in an E. coli-based Cell-free Expression System

A new generation of cell-free transcription-translation (TXTL) systems, engineered to have a greater versatility and modularity, provide novel capabilities to perform basic and applied sciences in test tube reactions. Over the past decade, cell-free TXTL has become a powerful technique for a broad range of novel multidisciplinary research areas related to quantitative and synthetic biology. The new TXTL platforms are particularly useful to construct and interrogate biochemical systems through the execution of synthetic or natural gene circuits. In vitro TXTL has proven convenient to rapidly prototype regulatory elements and biological networks as well as to recapitulate molecular self-assembly mechanisms found in living systems. In this article, we describe how infectious bacteriophages, such as MS2 (RNA), &#934;&#935;174 (ssDNA), and T7 (dsDNA), are entirely synthesized from their genome in one-pot reactions using an all Escherichia coli, cell-free TXTL system. Synthesis of the three coliphages is quantified using the plaque assay. We show how the yield of synthesized phage depends on the biochemical settings of the reactions. Molecular crowding, emulated through a controlled concentration of PEG 8000, affects the amount of synthesized phages by orders of magnitudes. We also describe how to amplify the phages and how to purify their genomes. The set of protocols and results presented in this work should be of interest to multidisciplinary researchers involved in cell-free synthetic biology and bioengineering.

Synthesis of Infectious Bacteriophages in an E. coli-based Cell-free Expression System

A new generation of cell-free transcription-translation platforms has been engineered to construct biochemical systems in vitro through the execution of gene circuits. In this article, we describe how bacteriophages, such as MS2, &#934;&#935;174, and T7, are synthesized from their genome using an all E. coli cell-free TXTL system.

A new generation of cell-free transcription-translation (TXTL) systems, engineered to have a greater versatility and modularity, provide novel ...

Generic Protocol for Optimization of Heterologous Protein Production Using Automated Microbioreactor Technology

A core business in industrial biotechnology using microbial production cell factories is the iterative process of strain engineering and optimization of bioprocess conditions. One important aspect is the improvement of cultivation medium to provide an optimal environment for microbial formation of the product of interest. It is well accepted that the media composition can dramatically influence overall bioprocess performance. Nutrition medium optimization is known to improve recombinant protein production with microbial systems and thus, this is a rewarding step in bioprocess development. However, very often standard media recipes are taken from literature, since tailor-made design of the cultivation medium is a tedious task that demands microbioreactor technology for sufficient cultivation throughput, fast product analytics, as well as support by lab robotics to enable reliability in liquid handling steps. Furthermore, advanced mathematical methods are required for rationally analyzing measurement data and efficiently designing parallel experiments such as to achieve optimal information content.
The generic nature of the presented protocol allows for easy adaption to different lab equipment, other expression hosts, and target proteins of interest, as well as further bioprocess parameters. Moreover, other optimization objectives like protein production rate, specific yield, or product quality can be chosen to fit the scope of other optimization studies. The applied Kriging Toolbox (KriKit) is a general tool for Design of Experiments (DOE) that contributes to improved holistic bioprocess optimization. It also supports multi-objective optimization which can be important in optimizing both upstream and downstream processes.

This manuscript describes a generic approach for tailor-made design of microbial cultivation media. This is enabled by an iterative workflow combining Kriging-based experimental design and microbioreactor technology for sufficient cultivation throughput, which is supported by lab robotics to increase reliability and speed in liquid handling media preparation.

A core business in industrial biotechnology using microbial production cell factories is the iterative process of strain engineering and optimization of ...

Production of Elastin-like Protein Hydrogels for Encapsulation and Immunostaining of Cells in 3D

Two-dimensional (2D) tissue culture techniques have been essential for our understanding of fundamental cell biology. However, traditional 2D tissue culture systems lack a three-dimensional (3D) matrix, resulting in a significant disconnect between results collected in vitro and in vivo. To address this limitation, researchers have engineered 3D hydrogel tissue culture platforms that can mimic the biochemical and biophysical properties of the in vivo cell microenvironment. This research has motivated the need to develop material platforms that support 3D cell encapsulation and downstream biochemical assays. Recombinant protein engineering offers a unique toolset for 3D hydrogel material design and development by allowing for the specific control of protein sequence and therefore, by extension, the potential mechanical and biochemical properties of the resultant matrix. Here, we present a protocol for the expression of recombinantly-derived elastin-like protein (ELP), which can be used to form hydrogels with independently tunable mechanical properties and cell-adhesive ligand concentration. We further present a methodology for cell encapsulation within ELP hydrogels and subsequent immunofluorescent staining of embedded cells for downstream analysis and quantification.

Recombinant protein-engineered hydrogels are advantageous for 3D cell culture as they allow for complete tunability of the polymer backbone and therefore, the cell microenvironment. Here, we describe the process of recombinant elastin-like protein purification and its application in 3D hydrogel cell encapsulation.

Two-dimensional (2D) tissue culture techniques have been essential for our understanding of fundamental cell biology. However, traditional 2D tissue ...

Cell-free Protein Expression Using the Rapidly Growing Bacterium Vibrio natriegens

The marine bacterium Vibrio natriegens has garnered considerable attention as an emerging microbial host for biotechnology due to its fast growth rate. A general protocol is described for the preparation of V. natriegens crude cell extracts using common laboratory equipment. This high yielding protocol has been specifically optimized for user accessibility and reduced cost. Cell-free protein synthesis (CFPS) can be carried out in small scale 10 &#956;L batch reactions in either a 96- or 384-well format and reproducibly yields concentrations of &#62; 260 &#956;g/mL super folder GFP (sfGFP) within 3 h. Overall, crude cell extract preparation and CFPS can be achieved in 1&#8722;2 full days by a single user. This protocol can be easily integrated into existing protein synthesis pipelines to facilitate advances in bio-production and synthetic biology applications.

Cell-free Protein Expression Using the Rapidly Growing Bacterium Vibrio natriegens

Cell-free expression systems are powerful and cost-efficient tools for the high-throughput synthesis and screening of important proteins. Here, we describe the preparation of cell-free protein expression system using Vibrio natriegens for the rapid protein production using plasmid DNA, linear DNA, and mRNA template.

The marine bacterium Vibrio natriegens has garnered considerable attention as an emerging microbial host for biotechnology due to its fast growth rate. A ...

Production of E. coli-expressed Self-Assembling Protein Nanoparticles for Vaccines Requiring Trimeric Epitope Presentation

Self-assembling protein nanoparticles (SAPNs) function as repetitive antigen displays and can be used to develop a wide range of vaccines for different infectious diseases. In this article we demonstrate a method to produce a SAPN core containing a six-helix bundle (SHB) assembly that is capable of presenting antigens in a trimeric conformation. We describe the expression of the SHB-SAPN in an E. coli system, as well as the necessary protein purification steps. We included an isopropanol wash step to reduce the residual bacterial lipopolysaccharide. As an indication of the protein identity and purity, the protein reacted with known monoclonal antibodies in Western blot analyses. After refolding, the size of the particles fell in the expected range (20 to 100 nm), which was confirmed by dynamic light scattering, nanoparticle tracking analysis, and transmission electron microscopy. The methodology described here is optimized for the SHB-SAPN, however, with only slight modifications it can be applied to other SAPN constructs. This method is also easily transferable to large scale production for GMP manufacturing for human vaccines.

Production of E. coli-expressed Self-Assembling Protein Nanoparticles for Vaccines Requiring Trimeric Epitope Presentation

A detailed method is provided here describing the purification, refolding, and characterization of self-assembling protein nanoparticles (SAPNs) for use in vaccine development.

Self-assembling protein nanoparticles (SAPNs) function as repetitive antigen displays and can be used to develop a wide range of vaccines for different ...

Preparing Protein Producing Synthetic Cells using Cell Free Bacterial Extracts, Liposomes and Emulsion Transfer

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell mimicking environment. Furthermore, the development of cell-free expression systems has demonstrated the ability to reconstitute the protein production, transcription and translation processes (DNA&#8594;RNA&#8594;protein) in a controlled manner, harnessing synthetic biology. Here we describe a protocol for preparing a cell-free expression system, including the production of a potent bacterial lysate and encapsulating this lysate inside cholesterol-rich lipid-based giant unilamellar vesicles (GUVs) (i.e., stable liposomes), to form synthetic cells. The protocol describes the methods for preparing the components of the synthetic cells including the production of active bacterial lysates, followed by a detailed step-by-step preparation of the synthetic cells based on a water-in-oil emulsion transfer method. These facilitate the production of millions of synthetic cells in a simple and affordable manner with a high versatility for producing different types of proteins. The obtained synthetic cells can be used to investigate protein/RNA production and activity in an isolated environment, in directed evolution, and also as a controlled drug delivery platform for on-demand production of therapeutic proteins inside the body.

This protocol describes the method, materials, equipment and steps for bottom-up preparation of RNA and protein producing synthetic cells. The inner aqueous compartment of the synthetic cells contained the S30 bacterial lysate encapsulated within a lipid bilayer (i.e., stable liposomes), using a water-in-oil emulsion transfer method.

The bottom-up assembly approach for construction of synthetic cells is an effective tool for isolating and investigating cellular processes in a cell ...

From Cells to Cell-Free Protein Synthesis within 24 Hours Using Cell-Free Autoinduction Workflow

Cell-free protein synthesis (CFPS) has grown as a biotechnology platform that captures transcription and translation machinery in vitro. Numerous developments have made the CFPS platform more accessible to new users and have expanded the range of applications. For lysate based CFPS systems, cell extracts can be generated from a variety of organisms, harnessing the unique biochemistry of that host to augment protein synthesis. Within the last 20 years, Escherichia coli (E. coli) has become one of the most widely used organisms for supporting CFPS due to its affordability and versatility. Despite numerous key advances, the workflow for E. coli cell extract preparation has remained a key bottleneck for new users to implement CFPS for their applications. The extract preparation workflow is time-intensive and requires technical expertise to achieve reproducible results. To overcome these barriers, we previously reported the development of a 24 hour cell-free autoinduction (CFAI) workflow that reduces user input and technical expertise required. The CFAI workflow minimizes the labor and technical skill required to generate cell extracts while also increasing the total quantities of cell extracts obtained. Here we describe that workflow in a step-by-step manner to improve access and support the broad implementation of E. coli based CFPS.

This work describes the preparation of cell extract from Escherichia coli (E. coli) followed by cell-free protein synthesis (CFPS) reactions in under 24 hours. Explanation of the cell-free autoinduction (CFAI) protocol details improvements made to reduce researcher oversight and increase quantities of cell extract obtained.

Cell-free protein synthesis (CFPS) has grown as a biotechnology platform that captures transcription and translation machinery in vitro. Numerous ...

Light-Controlled Fermentations for Microbial Chemical and Protein Production

Microbial cell factories offer a sustainable alternative for producing chemicals and recombinant proteins from renewable feedstocks. However, overburdening a microorganism with genetic modifications can reduce host fitness and productivity. This problem can be overcome by using dynamic control: inducible expression of enzymes and pathways, typically using chemical- or nutrient-based additives, to balance cellular growth and production. Optogenetics offers a non-invasive, highly tunable, and reversible method of dynamically regulating gene expression. Here, we describe how to set up light-controlled fermentations of engineered Escherichia coli and Saccharomyces cerevisiae for the production of chemicals or recombinant proteins. We discuss how to apply light at selected times and dosages to decouple microbial growth and production for improved fermentation control and productivity, as well as the key optimization considerations for best results. Additionally, we describe how to implement light controls for lab-scale bioreactor experiments. These protocols facilitate the adoption of optogenetic controls in engineered microorganisms for improved fermentation performance.

Optogenetic control of microbial metabolism offers flexible dynamic control over fermentation processes. The protocol here shows how to set up blue light-regulated fermentations for chemical and protein production at different volumetric scales.

Microbial cell factories offer a sustainable alternative for producing chemicals and recombinant proteins from renewable feedstocks. However, ...

Large-Scale, Automated Production of Adipose-Derived Stem Cell Spheroids for 3D Bioprinting

Adipose-derived stromal/stem cells (ASCs) are a subpopulation of cells found in the stromal vascular fraction of human subcutaneous adipose tissue recognized as a classical source of mesenchymal stromal/stem cells. Many studies have been published with ASCs for scaffold-based tissue engineering approaches, which mainly explored the behavior of these cells after their seeding on bioactive scaffolds. However, scaffold-free approaches are emerging to engineer tissues in vitro and in vivo, mainly by using spheroids, to overcome the limitations of scaffold-based approaches.
Spheroids are 3D microtissues formed by the self-assembly process. They can better mimic the architecture and microenvironment of native tissues, mainly due to the magnification of cell-to-cell and cell-to-extracellular matrix interactions. Recently, spheroids are mainly being explored as disease models, drug screening studies, and building blocks for 3D bioprinting. However, for 3D bioprinting approaches, numerous spheroids, homogeneous in size and shape, are necessary to biofabricate complex tissue and organ models. In addition, when spheroids are produced automatically, there is little chance for microbiological contamination, increasing the reproducibility of the method.
The large-scale production of spheroids is considered the first mandatory step for developing a biofabrication line, which continues in the 3D bioprinting process and finishes in the full maturation of the tissue construct in bioreactors. However, the number of studies that explored the large-scale ASC spheroid production are still scarce, together with the number of studies that used ASC spheroids as building blocks for 3D bioprinting. Therefore, this article aims to show the large-scale production of ASC spheroids using a non-adhesive micromolded hydrogel technique spreading ASC spheroids as building blocks for 3D bioprinting approaches.

Here, we describe the large-scale production of adipose-derived stromal/stem cell (ASC) spheroids using an automated pipetting system to seed the cell suspension, thus ensuring homogeneity of spheroid size and shape. These ASC spheroids can be used as building blocks for 3D bioprinting approaches.

Adipose-derived stromal/stem cells (ASCs) are a subpopulation of cells found in the stromal vascular fraction of human subcutaneous adipose tissue ...

Cell-Free Expression of Membrane Proteins in Giant Unilamellar Vesicles

Reconstitution of the Bacterial Glutamate Receptor Channel by Encapsulation of a Cell-Free Expression System

Cell-free expression (CFE) systems are powerful tools in synthetic biology that allow biomimicry of cellular functions like biosensing and energy regeneration in synthetic cells. Reconstruction of a wide range of cellular processes, however, requires successful reconstitution of membrane proteins into the membrane of synthetic cells. While the expression of soluble proteins is usually successful in common CFE systems, the reconstitution of membrane proteins in lipid bilayers of synthetic cells has proven to be challenging. Here, a method for reconstitution of a model membrane protein, bacterial glutamate receptor (GluR0), in giant unilamellar vesicles (GUVs) as model synthetic cells based on encapsulation and incubation of the CFE reaction inside synthetic cells is demonstrated. Utilizing this platform, the effect of substituting the N-terminal signal peptide of GluR0 with proteorhodopsin signal peptide on successful cotranslational translocation of GluR0 into membranes of hybrid GUVs is demonstrated. This method provides a robust procedure that will allow cell-free reconstitution of various membrane proteins in synthetic cells.

Author Spotlight: Membrane Protein Reconstitution in Synthetic Cells

This protocol describes the inverted emulsion method used to encapsulate a cell-free expression (CFE) system within a giant unilamellar vesicle (GUV) for the investigation of the synthesis and incorporation of a model membrane protein into the lipid bilayer.