All work was funded by Artios Pharma Ltd. Figure 1 and Figure 3 were created with Biorender.com.

1. Preparation and quality control&#160;(QC) of reporter substrates
NOTE: The plasmids encoding the reporter substrates can be propagated in standard Escherichia coli strains (e.g., DH5&#945; and derivates) and recovered by plasmid isolation. Plasmid details (size and antibiotic resistance) are described in Table 1 and Figure 1.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/66969/66969fig01.jpg" /> 
Figure 1: Schematics of extrachromosomal NanoLuc-based DSBR reporter assays. Schematic representation of DSBR reporter substrates, including their location within each source plasmid, main sequence features, and final layout after pathway-specific repair. The resection-independent MMEJ substrate core is excised from the source plasmid by digestion with XhoI/HindIII, after which caps must be ligated to both ends to produce the substrate for MMEJ. The blunt NHEJ reporter substrate is generated by excision from the source plasmid with EcoRV. The resection-dependent MMEJ, non-blunt NHEJ, long template HR, and SSA reporter substrates are generated by linearization of the source plasmids using either I-SceI (which produces non-cohesive ends) or HindIII (which produces cohesive ends). The short template HR reporter substrate is generated by linearization of the source plasmid using I-SceI (which produces cohesive ends). Repair of each reporter substrate by the target DSBR pathway reconstitutes an intact nanoluciferase ORF encoding functional NanoLuc. This figure was adapted from Rajendra et al.7. Abbreviations: DSBR = double strand break repair; NanoLuc = Nanoluciferase; MMEJ = microhomology-mediated end joining; NHEJ = non-homologous end joining; HR = homologous recombination; SSA = single strand annealing; ORF = open reading frame. <a href="https://www.jove.com/files/ftp_upload/66969/66969fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<ol>
	<li>Preparation of resection-independent MMEJ reporter substrate (Figure 1 and Figure 2A-C)
	<ol>
		<li>Preparation of ssDNA/dsDNA caps (Figure 2A)
		<ol>
			<li>Resuspend the four oligonucleotides listed in Table 2 individually in annealing buffer (20 mM Tris pH 7.5, 50 mM NaCl in molecular biology grade water) to generate a stock solution at 100 &#181;M.</li>
			<li>Annealing of ss/dsDNA caps
			<ol>
				<li>Mix 50 &#181;L each of the long and short oligonucleotides (100 &#181;M stock solution) for the left cap from step 1.1.1.1 in a 0.2 mL tube.</li>
				<li>Repeat for right cap oligonucleotides.</li>
				<li>Using a thermocycler, incubate each oligonucleotide mix at 99 &#176;C for 5 min then ramp down to 10 &#176;C at 1 &#176;C/min. 
				NOTE: This will produce the annealed left and right caps.</li>
			</ol>
			</li>
			<li>(QC, optional) Verification of oligonucleotide annealing by electrophoresis
			<ol>
				<li>Electrophorese 100 ng of each product from step 1.1.1.2 alongside individual oligonucleotides from step 1.1.1.1 and a low molecular weight DNA ladder in a 20% acrylamide-Tris-Borate-EDTA (TBE) gel at 200 V for 80 min.</li>
				<li>Stain the gel with TBE running buffer containing an appropriate fluorescent DNA dye for visualization of both ssDNA and dsDNA for at least 10-15 min.</li>
				<li>Visualize fluorescence on a gel documentation system (Figure 2A). 
				NOTE: Steps 1.1.1.3.1 to 1.1.1.3.3 are used to verify that caps have correctly annealed. The apparent sizes for the left cap and right cap should be ~120 bp and ~175 bp, respectively.</li>
			</ol>
			</li>
		</ol>
		</li>
		<li>Purification of reporter substrate core (Figure 2B)
		<ol>
			<li>Mix 100 &#181;g of the reporter core plasmid with 4 &#181;L of HindIII and 4 &#181;L of XhoI (4 U/&#181;g plasmid for each enzyme) and 20 &#181;L of 10x buffer. Bring the total volume to 200 &#181;L with double-distilled water (ddH2O) and incubate at 37 &#176;C for 2 h to overnight to digest plasmid. 
			NOTE: For digestion of larger or smaller quantities, scale the reaction proportionally.</li>
			<li>Incubate digestion reaction at 80 &#176;C for 20 min to heat inactivate restriction enzymes.</li>
			<li>Add 40 &#181;L of alkaline phosphatase (2 U/&#181;g plasmid) and 27 &#181;L of 10x buffer to the reaction mix from step 1.1.2.2. Incubate at 37 &#176;C for 2 h to dephosphorylate the plasmid. 
			NOTE: Scale reaction up or down as needed.</li>
			<li>Add 60 &#181;L of 6x loading dye to the reaction from step 1.1.2.3. Electrophorese alongside a high molecular weight DNA ladder in a 1.5 % (w/v) agarose-Tris-Acetate-EDTA (TAE) gel containing a fluorescent dsDNA stain at 120 V for 2.5 h or until bands are sufficiently resolved.</li>
			<li>Visualize fluorescence on a gel documentation system (Figure 2B).</li>
			<li>Excise the reporter core fragment (~1.5 kb) from the gel using a clean scalpel, taking care not to contaminate with vector backbone (~2.5 kb).</li>
			<li>Extract the reporter core fragment using a gel extraction kit, following the manufacturer&#39;s instructions.</li>
			<li>Measure the DNA concentration and quality (A260/280) by spectrophotometry.</li>
		</ol>
		</li>
		<li>Ligation of reporter substrate core with ssDNA/dsDNA caps and purification of final reporter substrate (Figure 2C)
		<ol>
			<li>Mix 30 &#181;g of the reporter core fragment from step 1.1.2.7 with 3.85 &#181;L of each annealed left and right cap from step 1.1.2 (approx. 6:1 molar ratio of cap:core DNA), 30 &#181;L of 10x ligase buffer, and 1.5 &#181;L of T4 DNA ligase (20 U/&#181;g DNA). Bring the total volume of the reaction to 300 &#181;L with ddH2O and incubate overnight at 16 &#176;C to ligate caps to reporter core fragment. 
			NOTE: Scale reaction up or down as required.</li>
			<li>(QC, optional) Electrophorese 200 ng of the resulting product from step 1.1.3.1 alongside the reporter substrate core and a high molecular weight DNA ladder in a 0.7% (w/v) agarose-TAE gel containing a fluorescent dsDNA stain at 120 V for at least 1.5 h. Verify that the band corresponding to the ligated product migrates at a slightly slower rate than the non-ligated reporter substrate core (Figure 2C). 
			NOTE: This QC step is to verify that the ligation of caps to the reporter core fragment has taken place correctly.</li>
			<li>Purify the DNA from the digestion reaction in step 1.3.1. using the preferred method (e.g., a bead-based or column-based method), following the manufacturer&#39;s instructions. 
			NOTE: The purification step 1.1.3.3 substantially reduces the presence of unligated caps.</li>
		</ol>
		</li>
		<li>Measure DNA concentration and quality (A260/280) by spectrophotometry.</li>
	</ol>
	</li>
	<li>Preparation of blunt NHEJ reporter substrate (Figure 1 and Figure 2D,E)
	<ol>
		<li>Mix 100 &#181;g of the reporter core plasmid with 5 &#181;L of EcoRV (5 U/&#181;g plasmid) and 20 &#181;L of 10x buffer. Bring the total volume to 200 &#181;L with ddH2O and incubate at 37 &#176;C for 2 h to overnight to digest plasmid. 
		NOTE: For digestion of larger or smaller quantities, scale the reaction proportionally.</li>
		<li>Incubate the digestion reaction at 65 &#176;C for 20 min to heat inactivate restriction enzyme.</li>
		<li>Add 50 &#181;L of 6x loading dye to the reaction from step 1.2.2. Electrophorese alongside a high molecular weight DNA ladder in a 1.5% (w/v) agarose-TAE gel containing a fluorescent dsDNA stain at 120 V for 2 h or until bands are sufficiently resolved.</li>
		<li>Visualize fluorescence on a gel documentation system (Figure 2D).</li>
		<li>Excise the reporter substrate (~1.7 kb) from the gel using a clean scalpel, taking care not to contaminate with the vector backbone (~2.6 kb).</li>
		<li>Extract the reporter core fragment using a gel extraction kit, following the manufacturer&#39;s instructions (Figure 2E).</li>
		<li>Measure the DNA concentration and quality (A260/280) by spectrophotometry.</li>
	</ol>
	</li>
	<li>Preparation of I-SceI-based reporter substrates (Figure 1) 
	NOTE: These substrates include resection-dependent MMEJ (Figure 2F), non-blunt NHEJ (Figure 2G), long template HR (Figure 2H), short template HR (Figure 2I), and SSA (Figure 2J).
	<ol>
		<li>Mix 100 &#181;g of the reporter core plasmid with 50 &#181;L of I-SceI (5 U/&#181;g plasmid) and 60 &#181;L of 10x buffer. Bring the total volume to 600 &#181;L with ddH2O and incubate at 37 &#176;C for 2 h to overnight to digest plasmid. 
		NOTE: For digestion of larger or smaller quantities, scale the reaction proportionally. Non-blunt NHEJ, resection-dependent MMEJ, long template HR and SSA plasmids can also be digested with HindIII, which will generate complementary cohesive ends.</li>
		<li>Incubate the digestion reaction at 65 &#176;C for 20 min to heat inactivate I-SceI. Set the temperature to 80 &#176;C during this step if HindIII was used for digestion instead.</li>
		<li>Purify DNA from the inactivated digestion reaction in step 1.3.2 using the preferred method (e.g., a bead-based or column-based method), following the manufacturer&#39;s instructions.</li>
		<li>Measure the DNA concentration and purity A260/280) by spectrophotometry.</li>
	</ol>
	</li>
	<li>Quality control of reporter substrates
	<ol>
		<li>Electrophorese 200 ng of the reporter substrate alongside a high molecular weight DNA ladder in a 0.7% (w/v) agarose-TAE gel containing a fluorescent dsDNA stain at 120 V for 2 h or until bands are sufficiently resolved. Load the original uncut reporter plasmid alongside as a control.</li>
		<li>Verify that the defined bands of the correct size are observed for each reporter substrate (refer to Table 1 and Figure 2F-J).</li>
	</ol>
	</li>
</ol>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/66969/66969fig02.jpg" /> 
Figure 2: Gel electrophoretic analyses of DSBR reporter substrate generation. (A-C) Representative images from gel electrophoretic analysis of intermediates and final construct required for the generation of the resection-independent MMEJ reporter substrate. The adjacent images in&#160;panels (A) and&#160;(C) are from the same gels; irrelevant lanes have been omitted. (D,E) Representative images from gel electrophoretic analysis for source plasmid, EcoRV-digested products, and gel-extracted final construct required for the generation of the blunt NHEJ reporter substrate. (F-J) Representative images from gel electrophoretic analysis of source plasmids and linearised DSBR constructs for the I-SceI-digested reporter substrates: resection-dependent MMEJ, non-blunt NHEJ, long template HR, short template HR, SSA. Abbreviations: DSBR = double strand break repair; MMEJ = microhomology-mediated end joining; NHEJ = non-homologous end joining; HR = homologous recombination; SSA = single strand annealing. <a href="https://www.jove.com/files/ftp_upload/66969/66969fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
2. Transient transfection of DSBR reporter substrates
NOTE: An overview of the experimental workflow of assays and some potential permutations are outlined in Figure 3. The protocol below describes an experiment using HEK-293 cells, where these are reverse-transfected with the reporter substrate. Numbers below can be scaled up or down according to the number of wells to be used per plate. The following steps are calculated for an assay performed in one 96-well plate; see Discussion for additional considerations.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/66969/66969fig03.jpg" /> 
Figure 3: Experimental workflow for DSBR reporter assays. Cells of interest are transfected with the linearised DSBR substrate (coding for a NanoLuc ORF that needs to be repaired through a specific DNA repair event) and a Firefly plasmid (transfection control). Then, 6-24 h post transfection, the Firefly luminescence and NanoLuc luminescence can be read sequentially following the addition of Nano-Glo Dual-Luciferase reagents. Example permutations to the core steps (shown within light blue boxes) can be used to test how genetic modulation (knockout, knockdown, or overexpression) or pharmacological treatment affects DSBR pathway proficiency in cells. Abbreviations: DSBR = double strand break repair; NanoLuc = Nanoluciferase; WT = wild type; KO = knockout. <a href="https://www.jove.com/files/ftp_upload/66969/66969fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<ol>
	<li>(Optional) If assessing the impact of compounds on the reporter assay, dispense compounds dissolved in vehicle (e.g., dimethyl sulfoxide [DMSO]) into wells of a 96-well plate according to a predefined experimental layout. Normalize vehicle concentration across all wells. 
	NOTE: Technical replicates are recommended. Include control wells (e.g., vehicle-only).</li>
	<li>In a 1.5 mL tube, dilute Firefly control plasmid (control luciferase) and NanoLuc DSBR reporter substrate (reporter luciferase) generated in steps 1.1, 1.2 or 1.3, in 500 &#181;L of transfection buffer. Use 0.66 &#181;g of control luciferase plasmid per 1 &#215; 106 cells. See Table 3 for the quantities of NanoLuc DSBR reporter substrate to use. 
	NOTE: A positive control plasmid that constitutively expresses the reporter luciferase can be used to validate instrument setup and transfection conditions or to check for non-specific effects on the reporter luciferase itself. As a starting point, we recommend 0.1 &#181;g of reporter luciferase plasmid and 0.66 &#181;g of control luciferase plasmid per 1 &#215; 106 cells.</li>
	<li>Add lipid-based transfection reagent to the diluted DNA from step 2.2 at a manufacturer&#39;s recommended ratio (e.g., 1:2, &#181;g DNA:&#181;L reagent for the reagent described in the Table of Materials), mix well by vortexing briefly, and incubate for 10 min at room temperature.</li>
	<li>Harvest cells by trypsinization, resuspend them in fresh medium containing 10% fetal bovine serum (FBS), and count them.</li>
	<li>Transfer 3 &#215; 106 cells into a 15 mL tube and resuspend in 8.5 mL of medium.</li>
	<li>Add the DNA transfection mix from step 2.3 into the cell suspension and mix several times by inversion.</li>
	<li>Plate 80 &#181;L of cell suspension (approximately 2.7 &#215; 104 cells) per well. 
	NOTE: The suspension containing cells and DNA transfection mix can be dispensed onto the plate either by pipetting manually or using an automated liquid handler for higher-throughput experiments.</li>
	<li>Incubate at 37 &#176;C/5% CO2 for 24 h.</li>
</ol>
3. Detection of luminescence
<ol>
	<li>Preparation of reagents
	<ol>
		<li>Follow the manufacturer&#39;s instructions for the preparation and addition of reporter (NanoLuc) and control (Firefly) luciferase reagents, which provide the substrates for both luciferases (Furimazine and 5&#180;-Fluoroluciferin, respectively):</li>
		<li>Prepare control luciferase reagent. Reconstitute according to the manufacturer&#39;s instructions and mix by inversion until the luciferase substrate is thoroughly dissolved.</li>
		<li>Prepare fresh reporter luciferase reagent according to the manufacturer&#39;s instructions. Calculate the amount of reagent needed to add 80 &#181;L/well and add substrate into an appropriate volume of assay buffer at a 1:100 ratio (luciferase substrate:buffer). For one 96-well plate, dilute 88 &#181;L of luciferase substrate into 8,800 &#181;L of buffer and mix by inversion. 
		NOTE: These quantities include an approximate 10% excess. Once reconstituted, the control luciferase reagent can be stored according to the manufacturer&#39;s instructions for future use. The reporter luciferase reagent must be prepared fresh for each use.</li>
	</ol>
	</li>
	<li>Serial detection of luminescence from control and reporter luciferases (96-well plate)
	<ol>
		<li>Allow the plate and luciferase reagents to reach room temperature.</li>
		<li>Add 80 &#181;L of control luciferase reagent per well.</li>
		<li>Shake the plate for 3 min on an orbital shaker at 450 rpm.</li>
		<li>Measure the control luciferase luminescence signal with a luminescence plate reader. 
		NOTE: Read emission at 580 nm (80 nm bandpass filter) or the total luminescence per well. This luminescence is used as a measure of transfection efficiency and cell density and can also inform about cellular toxicity caused by the test treatments.</li>
		<li>Add 80 &#181;L of reporter luciferase reagent per well. 
		NOTE: This reagent will inhibit the control luciferase; it also contains the substrate for the reporter luciferase.</li>
		<li>Shake the plate for 3 min on an orbital shaker at 450 rpm.</li>
		<li>Leave the plate to rest for 7 min at room temperature.</li>
		<li>Measure the reporter luciferase luminescence signal with a luminescence plate reader. 
		NOTE: Read emission at 470 nm (80 nm bandpass filter) or, alternatively, total luminescence per well. This luminescence gives information on the amount of reporter substrate that has been repaired by the DSBR pathway of interest.</li>
		<li>Export luminescence readings for downstream analysis.</li>
	</ol>
	</li>
</ol>
4. Data analysis
<ol>
	<li>Divide the reporter luciferase (NanoLuc) luminescence signal by the control luciferase (Firefly) luminescence signal originating from the same well to calculate the assay signal. Apply that calculation to all the wells as shown in equation (1). 
	<img alt="Equation 1" src="/files/ftp_upload/66969/66969eq01.jpg" style="margin: auto;" />&#160; &#160; &#160;(1)</li>
	<li>Calculate the average of the assay signals for the control wells (e.g., vehicle-only).</li>
	<li>Normalize the assay signals for test wells to the control well average using equation (2) to calculate Repair (%) per well. 
	<img alt="Equation 2" src="/files/ftp_upload/66969/66969eq02.jpg" style="margin: auto;" /> (2)</li>
	<li>(Optional, curve fitting) If testing multiple compound doses, plot the calculated Repair (%) against the compound concentration and fit a dose-response curve using a non-linear regression model. Use this curve for subsequent EC50 interpolation.</li>
</ol>

Quantifying DNA Double Strand Break Repair with Nanoluciferase Reporter Assays

<ol>
	<li>Jackson, S. P., Bartek, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+DNA-damage+response+in+human+biology+and+disease.">The DNA-damage response in human biology and disease.</a> Nature. 461 (7267), 1071-1078 (2009).</li><li>Scully, R., Panday, A., Elango, R., Willis, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+double-strand+break+repair-pathway+choice+in+somatic+mammalian+cells.">DNA double-strand break repair-pathway choice in somatic mammalian cells.</a> Nat Rev Mol Cell Biol. 20 (11), 698-714 (2019).</li><li>Ramsden, D. A., Carvajal-Garcia, J., Gupta, G. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism,+cellular+functions+and+cancer+roles+of+polymerase-theta-mediated+DNA+end+joining.">Mechanism, cellular functions and cancer roles of polymerase-theta-mediated DNA end joining.</a> Nat Rev Mol Cell Biol. 23 (2), 125-140 (2022).</li><li>Ceccaldi, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Homologous-recombination-deficient+tumours+are+dependent+on+Pol&#952;-mediated+repair.">Homologous-recombination-deficient tumours are dependent on Pol&#952;-mediated repair.</a> Nature. 518 (7538), 258-262 (2015).</li><li>van de Kooij, B., van Attikum, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+reporter+constructs+to+monitor+pathway-specific+repair+of+DNA+double-strand+breaks.">Genomic reporter constructs to monitor pathway-specific repair of DNA double-strand breaks.</a> Front Genet. 12, 809832 (2021).</li><li>Gunn, A., Stark, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=I-SceI-based+assays+to+examine+distinct+repair+outcomes+of+mammalian+chromosomal+double+strand+breaks.">I-SceI-based assays to examine distinct repair outcomes of mammalian chromosomal double strand breaks.</a> Methods Mol Biol. 920 (9), 379-391 (2012).</li><li>Rajendra, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=titratable+and+high-throughput+reporter+assays+to+measure+DNA+double+strand+break+repair+activity+in+cells.">titratable and high-throughput reporter assays to measure DNA double strand break repair activity in cells.</a> Nucleic Acids Res. 52 (4), 1736-1752 (2024).</li><li>Hall, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineered+luciferase+reporter+from+a+deep+sea+shrimp+utilizing+a+novel+imidazopyrazinone+substrate.">Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate.</a> ACS Chem. Biol. 7 (11), 1848-1857 (2012).</li><li>Wyatt, D. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+roles+for+polymerase+&#952;-mediated+end+joining+in+the+repair+of+chromosome+breaks.">Essential roles for polymerase &#952;-mediated end joining in the repair of chromosome breaks.</a> Mol Cell. 63 (4), 662-673 (2016).</li><li>Wood, R. D., Doubli&#233;, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+protection+by+DNA+polymerase+&#952;.">Genome protection by DNA polymerase &#952;.</a> Annu Rev Genet. 56, 207-228 (2022).</li><li>Belan, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=POLQ+seals+post-replicative+ssDNA+gaps+to+maintain+genome+stability+in+BRCA-deficient+cancer+cells.">POLQ seals post-replicative ssDNA gaps to maintain genome stability in BRCA-deficient cancer cells.</a> Mol Cell. 82 (24), 4664-4680 (2022).</li><li>Zatreanu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pol&#952;+inhibitors+elicit+BRCA-gene+synthetic+lethality+and+target+PARP+inhibitor+resistance.">Pol&#952; inhibitors elicit BRCA-gene synthetic lethality and target PARP inhibitor resistance.</a> Nat Commun. 12 (1), 3636 (2021).</li><li>Stockley, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery,+characterization,+and+structure-based+optimization+of+small-molecule+in+vitro+and+in+vivo+probes+for+human+DNA+polymerase+theta.">Discovery, characterization, and structure-based optimization of small-molecule in vitro and in vivo probes for human DNA polymerase theta.</a> J Med Chem. 65 (20), 13879-13891 (2022).</li><li>Scott, D. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+small-molecule+inhibitor+of+the+BRCA2-RAD51+interaction+modulates+RAD51+assembly+and+potentiates+DNA+damage-induced+cell+death.">A small-molecule inhibitor of the BRCA2-RAD51 interaction modulates RAD51 assembly and potentiates DNA damage-induced cell death.</a> Cell Chem Biol. 28 (6), 835-847 (2021).</li><li>Schep, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+chromatin+context+on+Cas9-induced+DNA+double-strand+break+repair+pathway+balance.">Impact of chromatin context on Cas9-induced DNA double-strand break repair pathway balance.</a> Mol Cell. 81 (10), 2216-2230 (2021).</li></ol>

D.G., E.R., B.M., A.G., S.J.B., G.C.M.S, and H.M.R.R. are all employees and shareholders of Artios Pharma Ltd. G.C.M.S. is a shareholder of AstraZeneca PLC. S.J.B. is a Founder Scientist and shareholder of Artios Pharma Ltd. A patent has been filed on some of the reporters outlined in this study (WO 2021/001647). Promega is the source of the NanoLuc&#174; technology and the modified NanoLuc&#174; polynucleotides. Artios Pharma was authorized by Promega to generate the modified NanoLuc&#174; polynucleotides.

Here, we have described protocols for the generation and implementation of a suite of extrachromosomal luminescence-based reporters for measuring the cellular proficiency of the four major DSBR pathways (HR, NHEJ, MMEJ, and SSA)7. Reporter substrates can be introduced into cells by transient transfection and used to assess DSBR activity using a sensitive and robust plate-based readout of NanoLuc luminescence, which is reconstituted upon engagement with cognate cellular DSBR pathways.
Several stages of reporter substrate generation, transfection of the substrates into cells, and data interpretation are critical to the successful execution of these assays. Although standard molecular biology techniques are used to generate the reporter substrates, visualizing the process by gel electrophoresis ensures the highest quality and purity of the substrates prior to transfection. As these assays are reliant on transient transfection, common considerations for these methods apply. These include optimizing seeding density, transfection conditions (including reagents and DNA quantities), and assessing suitability in forward and reverse transfection formats. These reporter assays have been successfully performed with a range of electroporation and lipofection protocols, and options should be fully explored prior to performing these assays. Care should also be taken to inspect the component NanoLuc and Firefly signals rather than just the composite repair signal derived by normalizing the NanoLuc signal (reporter substrate) to the Firefly signal (control). Artifacts can arise from the ratio being driven by changes in the Firefly signal. For example, assessing inhibition in dose-response mode using a highly specific compound should suppress the NanoLuc signal in a titratable manner without perturbing the Firefly signal, which should remain stable (Figure 4G,H). However, in cases where Firefly signals are perturbed, useful impacts on repair can still be determined by identifying a dose window where the Firefly signal is unaffected (Figure 5).
Compared with the most frequently used DSBR reporter assays, these extrachromosomal luminescence-based reporter assays have some distinct advantages. As DSBR pathways are highly conserved, even if cellular machinery varies between cell models, the assays can still report on DSBR proficiency and pathway choice. This opens up the assessment of DSBR to any model of interest to the user, as long as optimal transient transfection conditions are established in advance.
The use of Nanoluciferase as the reporter gene also offers advantages over fluorescent options, which have been used traditionally in DSBR reporter assays. NanoLuc is fast-maturing and luminescence is detected with high sensitivity using a plate reader8. Coupled to the speed of substrate repair (as the reporter substrates are transfected into cells with ready-to-repair DSB ends), this format of DSBR reporter assay is ideal for the rapid turnaround and quantitative robustness required for screening small molecules as part of an industrial drug discovery cascade. Indeed, we have recently described the implementation of the resection-independent MMEJ reporter assay in the discovery cascade used for the identification of small molecule inhibitors of the Pol&#952; polymerase domain13.
There is also flexibility in the implementation of the reporter assays to address specific questions about genetic and pharmacological perturbations of DSBR (Figure 3). For example, prior to transfection of the reporter substrates, cells can be transfected with siRNA against a gene of interest for 48-72 h. Alternatively, the effects of gene overexpression on DSBR pathways can be tested by performing plasmid transfection 24-48 h prior to the transfection of reporter substrates. For pharmacological studies, the present protocol already describes how the use of small molecules can be incorporated into the standard workflow, but alternative formats may include alterations in compound treatment regimes, such as pre-incubations or washouts.
The scalability of transient transfection could also support large-scale screening approaches in which batch transfection of reporter substrates is performed prior to screening. Furthermore, the duration of the assay from transfection to readout can also be varied. Although standard durations may be 16-24 h, some assays may be read out in as little as 6 h7. Concerns over toxicity from small molecules or siRNA that can compromise cell viability should also be considered in determining the assay duration.
In summary, the assays outlined in this study and fully described in a recent publication7 provide a rapid and robust assessment of cellular DSBR proficiency. They are highly sensitive and titratable, making them amenable to both genetic and pharmacological studies. Crucially, as the reporter substrates can be introduced into cells by transient transfection, they have the potential to be utilized in any transfectable cell model of interest, rather than being restricted to specific cell lines by stable integration as is the case with chromosomal DSBR reporters. However, a distinct limitation of these reporter extrachromosomal assays is that the lack of integration into the genome may not fully recapitulate the physiological, chromatinized context of DNA repair and its associated regulatory cues and orchestration15. To this end, extrachromosomal reporter assays are complementary to existing methods of DSBR assessment and expand the toolkit of resources suitable for both basic research and drug discovery.

DNA double strand breaks (DSBs) represent a particularly toxic class of DNA damage1 due to which cells have evolved multiple DSB repair (DSBR) pathways to repair these lesions. The four major DSBR mechanisms are homologous recombination (HR), non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), and single strand annealing (SSA)2,3. DSBR pathways contribute to the maintenance of healthy tissue development and physiology and protect against diseases such as cancer. Furthermore, these repair mechanisms hold therapeutic potential for the development of small molecule modulators in precision oncology. For example, targeting DNA Polymerase &#952; (Pol&#952;), a pivotal enzyme in the MMEJ repair pathway, has attracted interest due to its synthetic lethality with HR deficiency in cancer4.
Understanding DSBR therefore has broad clinical implications and functional cellular assays capable of measuring the activity of all the major DSBR pathways are needed5. Assays must be suitable for both genetic and pharmacological interrogation and deployable across cell models of interest. To support small molecule drug discovery efforts, assays must be highly sensitive, titratable, have a fast turnaround, and be scalable to high-throughput formats suitable for compound screening.
In general, DSBR has been previously measured using fluorescence-based reporter assay systems stably integrated into the cell genome6. However, while physiological recapitulation of chromosomal DSBR is a distinct advantage, such assays are restricted to a host model in which the reporter is integrated, utilize labor-intensive sample preparation and analysis by flow cytometry, and have limited throughput, turnaround time, robustness, and sensitivity, all essential features necessary for drug discovery efforts.
Here we describe a suite of DSBR reporter assays that allow assessment of the four major DSBR pathways. The suite of reporter assay substrates is outlined in Figure 1 and further described in a recent publication7. They are extrachromosomal, allowing their introduction into cells by simple transient transfection, and the incorporation of a nanoluciferase reporter gene8, which must be reconstituted by engagement with specific DSBR mechanisms, engenders sensitivity, robustness, and scalability. The following DSBR reporter substrate variants are included in the protocol (Figure 1):
Resection-independent MMEJ: This linear substrate is composed of a core double-stranded DNA (dsDNA) region with single-stranded DNA (ssDNA) overhangs, which mimic resected DNA ends9. Four nucleotide microhomologies at the termini of the ssDNA regions encode the start codon for the reporter gene. Repair of this substrate through MMEJ restores the reporter gene open reading frame (ORF).
Resection-dependent MMEJ: The N-terminal reporter gene exon is interrupted by a segment containing a stop codon, which is flanked by 8 base-pair (bp) microhomologies. Nucleolytic end resection is required prior to MMEJ-mediated repair to restore the intact reporter gene.
Blunt NHEJ: The reporter gene is split into N- and C-terminal sections, of which the latter is placed upstream of the promoter. The DSB is produced using EcoRV and it requires direct ligation (without end processing) by NHEJ for both reporter gene portions to be re-joined and the reporter ORF to be restored.
Non-blunt NHEJ: The DSB is located within an intron and will have cohesive or non-cohesive ends depending on the choice of restriction enzyme. The repair of this substrate by NHEJ requires ligation to be preceded by end processing.
Long template HR: The N-terminal exon of the reporter gene is interrupted by a DNA segment containing restriction sites, which replace 22 bp of the original reporter gene sequence. To restore this sequence, repair by HR uses the 2.5 kilobase (kb) homology template placed downstream of the C-terminal exon.
Short template HR: The restriction site needed to generate the DSB replaces part of the native reporter gene sequence and introduces an in-frame stop codon. Like the long template version, this HR substrate requires the downstream homology template (360 bp) for accurate repair and restoration of the reporter ORF.
SSA: This substrate contains a premature stop codon located within the N-terminal exon of the reporter gene. The removal of this stop codon and reinstatement of the intact reporter gene sequence requires repair by SSA, which involves bi-directional long-range resection prior to alignment of the homologies.
For generation of the DSB, some of the reporter substrates can be digested with I-SceI (Figure 1). This will generate a linear substrate with non-cohesive ends in the resection-dependent MMEJ, non-blunt NHEJ, long template HR and SSA reporters, which have tandem I-SceI sites in inverted orientations. In the short template HR reporter substrate, digestion of the single I-SceI site will generate cohesive ends.&#160;The non-blunt NHEJ, resection-dependent MMEJ, long template HR and SSA plasmids can also be digested with HindIII, which will produce complementary cohesive ends.
We provide protocols for the generation of the reporter assay substrates and describe how the assays can be performed, providing details on how they can be used to quantify DSBR, including titratable responses to small molecules, assessing cellular potency, on-target activity, and pathway selectivity.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>10x TBE buffer</td>
			<td>Thermo Fisher</td>
			<td>AM9863</td>
			<td></td>
		</tr>
		<tr>
			<td>20% TBE-acrylamide gel</td>
			<td>Invitrogen</td>
			<td>EC6315BOX</td>
			<td></td>
		</tr>
		<tr>
			<td>50x TAE buffer</td>
			<td>Fisher Scientific</td>
			<td>BP13321</td>
			<td></td>
		</tr>
		<tr>
			<td>6x Gel Loading Dye, Purple</td>
			<td>NEB</td>
			<td>B7024S</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well white plate (with transparent bottom and lid)</td>
			<td>Porvair</td>
			<td>204012</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Cleaver Scientific</td>
			<td>CSL-AG500</td>
			<td></td>
		</tr>
		<tr>
			<td>AMPure XP beads</td>
			<td>Beckman Coulter</td>
			<td>A63881</td>
			<td>For bead-based purification of DNA</td>
		</tr>
		<tr>
			<td>Antarctic phosphatase and 10X buffer</td>
			<td>NEB</td>
			<td>M0289L</td>
			<td></td>
		</tr>
		<tr>
			<td>CLARIOstar</td>
			<td>BMG Labtech</td>
			<td>430-101</td>
			<td>Plate reader</td>
		</tr>
		<tr>
			<td>Countess II Automated Cell Counter</td>
			<td>Thermo Fisher</td>
			<td>AMQAX1000</td>
			<td>Cell counter</td>
		</tr>
		<tr>
			<td>Custom oligonucleotides</td>
			<td>Sigma-Aldrich</td>
			<td>Custom order</td>
			<td>For resection-independent MMEJ substrate. See Table 2.</td>
		</tr>
		<tr>
			<td>D300e</td>
			<td>Tecan</td>
			<td>30100152</td>
			<td>DMSO-based compound dispenser</td>
		</tr>
		<tr>
			<td>D300e D4+ cassette</td>
			<td>Tecan</td>
			<td>30097371</td>
			<td>High volume cassette for D300e compound dispenser</td>
		</tr>
		<tr>
			<td>D300e T8+ cassette</td>
			<td>Tecan</td>
			<td>30097370</td>
			<td>Low volume cassette for D300e compound dispenser</td>
		</tr>
		<tr>
			<td>Dimethyl sulfoxide, cell culture grade</td>
			<td>Sigma-Aldrich</td>
			<td>D2650-100ML</td>
			<td>Vehicle for compounds, used in Figure 4 and Figure 5</td>
		</tr>
		<tr>
			<td>DSBR reporter source plasmids</td>
			<td>Artios</td>
			<td></td>
			<td>Available to the academic community upon request&#160;</td>
		</tr>
		<tr>
			<td>EcoRV-HF and 10x CutSmart buffer</td>
			<td>NEB</td>
			<td>R3195M</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethanol absolute</td>
			<td>VWR</td>
			<td>20821.365</td>
			<td></td>
		</tr>
		<tr>
			<td>Foetal Bovine Serum</td>
			<td>PAN-Biotech</td>
			<td>P30-3031&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>GeneRuler Ultra Low Range DNA Ladder</td>
			<td>Thermo Fisher</td>
			<td>SM1211</td>
			<td>Low molecular weight DNA ladder</td>
		</tr>
		<tr>
			<td>HEK-293 cells</td>
			<td>ATCC</td>
			<td>CRL-1573</td>
			<td>Example cell line used in protocol</td>
		</tr>
		<tr>
			<td>HindIII-HF and 10x CutSmart buffer</td>
			<td>NEB</td>
			<td>R3104M</td>
			<td></td>
		</tr>
		<tr>
			<td>HyClone Molecular Biology grade water</td>
			<td>Fisher Scientific</td>
			<td>10275262</td>
			<td></td>
		</tr>
		<tr>
			<td>I-SceI and 10x Tango Buffer</td>
			<td>Invitrogen</td>
			<td>ER1771</td>
			<td></td>
		</tr>
		<tr>
			<td>Isopropanol</td>
			<td>VWR</td>
			<td>20842.33</td>
			<td></td>
		</tr>
		<tr>
			<td>JetPRIME reagent and buffer</td>
			<td>PolyPlus</td>
			<td>114-15</td>
			<td>Lipid-based transfection reagent</td>
		</tr>
		<tr>
			<td>MegaStar 1.6</td>
			<td>VWR</td>
			<td>521-1749</td>
			<td>Centrifuge for 15 or 50 mL tubes</td>
		</tr>
		<tr>
			<td>MEM Eagle</td>
			<td>PAN-Biotech</td>
			<td>P04-08056</td>
			<td>Culture medium for HEK-293 cells</td>
		</tr>
		<tr>
			<td>Microplate shaker</td>
			<td>Fisherbrand</td>
			<td>15504070</td>
			<td>Microplate orbital shaker</td>
		</tr>
		<tr>
			<td>MicroStar 17R</td>
			<td>VWR</td>
			<td>521-1647</td>
			<td>Centrifuge for 1.5 or 2 mL tubes</td>
		</tr>
		<tr>
			<td>MultiDrop</td>
			<td>Thermo Fisher</td>
			<td>5840300</td>
			<td>Cell or water-based reagent dispenser</td>
		</tr>
		<tr>
			<td>MultiDrop Standard Cassette</td>
			<td>Thermo Fisher</td>
			<td>24072670</td>
			<td>Cassette for MultiDrop reagent dispenser</td>
		</tr>
		<tr>
			<td>NanoDLR Stop &#38; Glo Buffer and Substrate</td>
			<td>Promega</td>
			<td>N1630 or N1650</td>
			<td>Reporter luciferase (NanoLuc) reagent to quench Firefly luminescence and detect NanoLuc luminescence. Part of the Nano-Glo Dual-Luciferase Reporter Assay System kit</td>
		</tr>
		<tr>
			<td>ONE-Glo EX Luciferase Assay Buffer and Substrate</td>
			<td>Promega</td>
			<td>N1630 or N1650</td>
			<td>Control luciferase (Firefly) assay reagent to detect Firefly. Part of the Nano-Glo Dual-Luciferase Reporter Assay System kit</td>
		</tr>
		<tr>
			<td>PBS (without calcium or magnesium)</td>
			<td>PAN-Biotech</td>
			<td>P04-36500</td>
			<td></td>
		</tr>
		<tr>
			<td>pGL4 Firefly plasmid (or similar)</td>
			<td>Promega</td>
			<td>E1310 (or equivalent)</td>
			<td>Firefly control plasmid</td>
		</tr>
		<tr>
			<td>pNL1.1 NanoLuc plasmid (or similar)</td>
			<td>Promega</td>
			<td>N1091 (or equivalent)</td>
			<td>NanoLuc control plasmid, for adjustment of equipment settings/optimisation experiments</td>
		</tr>
		<tr>
			<td>QIAquick Gel Extraction Kit</td>
			<td>Qiagen</td>
			<td>28706</td>
			<td></td>
		</tr>
		<tr>
			<td>Quick-Load Purple 1 kb DNA Ladder</td>
			<td>NEB</td>
			<td>N0552S</td>
			<td>High molecular weight DNA ladder</td>
		</tr>
		<tr>
			<td>Sodium Acetate (3 M), pH 5.5</td>
			<td>Thermo Fisher</td>
			<td>AM9740</td>
			<td>For pH adjustment during gel extraction with QIAquick Gel Extraction Kit</td>
		</tr>
		<tr>
			<td>SYBR Gold (10,000x)</td>
			<td>Invitrogen</td>
			<td>S11494</td>
			<td>For visualisation of ssDNA and dsDNA</td>
		</tr>
		<tr>
			<td>SYBR Safe (10,000x)</td>
			<td>Invitrogen</td>
			<td>S33102</td>
			<td>For visualisation of dsDNA only</td>
		</tr>
		<tr>
			<td>T4 DNA Ligase and 10x Ligase buffer</td>
			<td>NEB</td>
			<td>M0202L</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue stain 0.4%</td>
			<td>Invitrogen</td>
			<td>T10282</td>
			<td>For measurement of viability during cell counting</td>
		</tr>
		<tr>
			<td>Trypsin-EDTA solution; 0.25% Trypsin and 0.53 mM EDTA</td>
			<td>Sigma-Aldrich</td>
			<td>T4049-100ML</td>
			<td></td>
		</tr>
		<tr>
			<td>XhoI and 10x CutSmart buffer</td>
			<td>NEB</td>
			<td>R0146M</td>
			<td></td>
		</tr>
	</tbody>
</table>

assessment of dna double strand break repair activity using high-throughput and quantitative luminescence-based reporter assays

The repair of DNA double strand breaks (DSBs) is crucial for the maintenance of genome stability and cell viability. DSB repair (DSBR) in cells is mediated through several mechanisms: homologous recombination (HR), non-homologous end joining (NHEJ), microhomology-mediated end joining (MMEJ), and single strand annealing (SSA). Cellular assays are essential to measure the proficiency and modulation of these pathways in response to various stimuli.
Here, we present a suite of extrachromosomal reporter assays that each measure the reconstitution of a nanoluciferase reporter gene by one of the four major DSBR pathways in cells. Upon transient transfection into cells of interest, repair of pathway-specific reporter substrates can be measured in under 24 h by the detection of Nanoluciferase (NanoLuc) luminescence.
These robust assays are quantitative, sensitive, titratable, and amenable to a high-throughput screening format. These properties provide broad applications in DNA repair research and drug discovery, complementing the currently available toolkit of cellular DSBR assays.

Repair of each of the reporter assays can be detected and quantified using the same procedure. Correct repair of a substrate by its cognate repair pathway in cells will reconstitute an intact, functional ORF encoding NanoLuc. This luminescence signal can be detected using a plate reader.
The co-transfection with an intact plasmid encoding Firefly luciferase serves as a transfection control. This control serves two purposes. First, it provides a standard to normalize the NanoLuc signal to, as it should be unperturbed by modulation of DSBR by either genetic or pharmacological means. Second, it can provide an indication of off-target cellular perturbations that impact the luciferase signal, such as cell cycle modulation, effects on transcription/translation, or general toxicity.
The ratio of NanoLuc to Firefly serves as a surrogate readout of repair. Luminescence values can be exported and analyzed by normalizing the two luciferase signals from within the same well. In the case of genetic perturbation studies (e.g., comparing wild-type and KO or non-targeting and target siRNA), repair is usually normalized to the parental sample (wild-type cells or cells treated with non-targeting control siRNA). In the case of pharmacological modulation, values from a compound-treated sample are normalized to the value produced by vehicle treatment.
Full validation of the described reporter suite has been recently published7. Data exemplifying the characterization of genetic and pharmacological modulation of DSBR are shown in Figure 4 (adapted from 7). Pol&#952; is the key mediator of MMEJ and loss or inhibition of this enzyme is predicted to specifically ablate cellular MMEJ3,10. Using a cell line in which POLQ, the gene encoding Pol&#952;, has been knocked out11, the resection-independent MMEJ reporter assay demonstrates that MMEJ is indeed almost fully suppressed. Evaluation of the component NanoLuc and Firefly luminescence signals shows that the observed repair defect is driven by a reduction in the NanoLuc signal (encoded by the reporter substrate) while the Firefly signal (control) is unperturbed (Figure 4A-C). In contrast, the assessment of NHEJ proficiency using the blunt end NHEJ reporter demonstrates that POLQ knockout does not inhibit the repair of the reporter substrate (Figure 4D-F). Together, these genetic data support the specific role of Pol&#952; in MMEJ-mediated repair. These observations are fully recapitulated pharmacologically with ART55812,13, a recently reported highly potent and specific inhibitor of the polymerase domain of Pol&#952; (Figure 4G), where titratable inhibition of MMEJ is observed, which derives from a specific decrease in the NanoLuc and not the Firefly signal (Figure 4H). Furthermore, and in agreement with genetic data, there is no effect on NHEJ (Figure 4I,J). Together these data highlight how these reporters can be used to characterize the genetic modulation of DSBR pathways and show cellular potency and target/pathway specificity of small molecules.
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/66969/66969fig04.jpg" /> 
Figure 4: Effects of genetic knockout and pharmacological inhibition of Pol&#952; on MMEJ and NHEJ reporter signals. eHAP1 WT and POLQ(-) cells were transfected with a Firefly control plasmid and with (A-C) the resection-independent MMEJ reporter or (D-F) blunt end NHEJ reporter. Percentage of MMEJ or NHEJ repair is the ratio of NanoLuc luminescence over Firefly luminescence, normalized to the DMSO-treated control, 24 h post transfection. Data represent mean &#177; SEM of three biological replicates, each averaging 8 technical replicates. HEK-293 cells were transfected with a Firefly control plasmid and (G,H) the resection-independent MMEJ reporter or the (I,J) blunt end NHEJ reporter and treated with the Pol&#952; polymerase inhibitor ART558. Percentage of repair is the ratio of NanoLuc luminescence over Firefly luminescence, normalized to the DMSO-treated control, 24 h post transfection. Percentage inhibition of the individual luminescence signals in (G) and (I) was calculated relative to DMSO-treated control and shown respectively in (H) and (J). Data represent mean &#177; SEM of 2 biological replicates, each averaging 4 technical replicates. This figure was adapted from Rajendra et al.7. Abbreviations: NanoLuc = Nanoluciferase; MMEJ = microhomology-mediated end joining; NHEJ = non-homologous end joining; WT = wild type. <a href="https://www.jove.com/files/ftp_upload/66969/66969fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/66969/66969fig05.jpg" /> 
Figure 5: Inhibition of HR reporter signal by the RAD51 inhibitor CAM833. (A) HEK-293 cells were transfected with the long template HR reporter substrate, a Firefly luciferase control plasmid, and treated with the RAD51 inhibitor CAM83314. NanoLuc and Firefly luminescence was read 16 h after transfection. Percentage of HR repair is the ratio of NanoLuc luminescence over Firefly luminescence, normalized to the DMSO-treated control. Dashed lines highlight percentage HR inhibition and CAM833 concentration at the curve EC50. Data represent mean &#177; SEM of 2 biological replicates, each averaging 4 technical replicates. (B) Percentage inhibition of the individual luminescence signals in (A) was calculated relative to the DMSO-treated control. Dashed lines highlight percentage NanoLuc and Firefly inhibition at 3.33 &#181;M CAM833 (EC50). The decrease in Firefly signal at CAM833 concentrations &#8805; 10 &#181;M is indicative of compound toxicity at high doses; however, NanoLuc signal reduction is observed at concentrations where Firefly signal is unaffected, suggesting that CAM833 induces on-target HR inhibition. This figure was adapted from Rajendra et al.7. Abbreviations: NanoLuc = Nanoluciferase; HR = homologous recombination. <a href="https://www.jove.com/files/ftp_upload/66969/66969fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="2">Reporter substrate</td>
			<td>Source plasmid 
			(size in kb, resistance)</td>
			<td colspan="3">DSB generation</td>
			<td>Expected size of final reporter substrate (kb)</td>
		</tr>
		<tr>
			<td colspan="2">Resection-independent MMEJ</td>
			<td>4.0, Kan</td>
			<td colspan="3">Resected 3&#39; tails through ligation of caps</td>
			<td>1.6</td>
		</tr>
		<tr>
			<td colspan="2">Resection-dependent MMEJ</td>
			<td>6.5, Kan</td>
			<td colspan="3">I-SceI (non-cohesive), HindIII (cohesive)</td>
			<td>6.5</td>
		</tr>
		<tr>
			<td colspan="2">Blunt NHEJ</td>
			<td>4.3, Kan</td>
			<td colspan="3">Blunt ends upon excision from plasmid by EcoRV</td>
			<td>1.7</td>
		</tr>
		<tr>
			<td colspan="2">Non-blunt NHEJ</td>
			<td>6.7, Kan</td>
			<td colspan="3">I-SceI (non-cohesive), HindIII (cohesive)</td>
			<td>6.5</td>
		</tr>
		<tr>
			<td colspan="2">Long template HR</td>
			<td>9.2, Kan</td>
			<td colspan="3">I-SceI (non-cohesive), HindIII (cohesive)</td>
			<td>9.2</td>
		</tr>
		<tr>
			<td colspan="2">Short template HR</td>
			<td>9.3, Amp</td>
			<td colspan="3">I-SceI (cohesive)</td>
			<td>9.3</td>
		</tr>
		<tr>
			<td colspan="2">SSA</td>
			<td>9.5, Kan</td>
			<td colspan="3">I-SceI (non-cohesive), HindIII (cohesive)</td>
			<td>9.5</td>
		</tr>
	</tbody>
</table>
Table 1: Reporter substrate plasmids. Abbreviations: DSB = double strand break; MMEJ = microhomology-mediated end joining; NHEJ = non-homologous end joining; HR = homologous recombination; SSA = single strand annealing; Kan = kanamycin; Amp = ampicillin.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">Sequence (5&#8217;-3&#8217;)</td>
			<td>Supplier</td>
			<td>Purification</td>
			<td>Function</td>
		</tr>
		<tr>
			<td colspan="3">5&#8217;[Phos]TCGAGGACTTGGTCCAGGTT 
			GTAGCCGGCTGTCTGTCGCCAGTCC 
			CCAACGAAATCTTCGAGTGTGAAGACCAT</td>
			<td>Sigma</td>
			<td>PAGE</td>
			<td>Left cap, long oligonucleotide</td>
		</tr>
		<tr>
			<td colspan="3">5&#8217;[Phos]GCCGGCTACAACCTGGACCAAGTCC</td>
			<td>Sigma</td>
			<td>PAGE</td>
			<td>Left cap, short oligonucleotide</td>
		</tr>
		<tr>
			<td colspan="3">5&#8217;[Phos]AGCTTTATTGCGGTAGTTTATCA 
			CAGTTAAATTGCTAACGCAGTCAGTGG 
			GCCTCGGCGGCCAAGCTAGGCAATCC 
			GGTACTGTTGGTAAAGCCACCATGG</td>
			<td>Sigma</td>
			<td>PAGE</td>
			<td>Right cap, long oligonucleotide</td>
		</tr>
		<tr>
			<td colspan="3">5&#8217;[Phos]CGAGGCCCACTGACTGCGTTA 
			GCAATTTAACTGTGATAAACTACCGCAATAA</td>
			<td>Sigma</td>
			<td>PAGE</td>
			<td>Right cap, short oligonucleotide</td>
		</tr>
	</tbody>
</table>
Table 2: Oligonucleotides for caps for generation of resection-independent MMEJ reporter substrate. Abbreviations: ssDNA = single-stranded DNA; dsDNA = double-stranded DNA; MMEJ = microhomology-mediated end joining; PAGE = polyacrylamide gel electrophoresis. Microhomologies are underlined.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Reporter assay</td>
			<td>NanoLuc reporter substrate DNA (&#181;g DNA/1x106 cells)</td>
			<td>Firefly control luciferase plasmid (&#181;g DNA/1x106 cells)</td>
		</tr>
		<tr>
			<td>Resection-independent MMEJ</td>
			<td>0.5</td>
			<td>0.66</td>
		</tr>
		<tr>
			<td>Resection-dependent MMEJ</td>
			<td>1</td>
			<td>0.66</td>
		</tr>
		<tr>
			<td>Blunt NHEJ</td>
			<td>0.5</td>
			<td>0.66</td>
		</tr>
		<tr>
			<td>Non-blunt NHEJ</td>
			<td>0.5</td>
			<td>0.66</td>
		</tr>
		<tr>
			<td>Long template HR</td>
			<td>1</td>
			<td>0.66</td>
		</tr>
		<tr>
			<td>Short template HR</td>
			<td>2</td>
			<td>0.66</td>
		</tr>
		<tr>
			<td>SSA</td>
			<td>1</td>
			<td>0.66</td>
		</tr>
	</tbody>
</table>
Table 3: DNA quantities for transient transfection of NanoLuc reporter substrates and Firefly control luciferase plasmid (HEK-293, 96-well plate format). Abbreviations: MMEJ = microhomology-mediated end joining; NHEJ = non-homologous end joining; HR = homologous recombination; SSA = single strand annealing.

Author Spotlight: Developing Novel Anticancer Therapeutics Targeting the DNA Damage Response

We present protocols for the assessment of double strand break repair pathway proficiency in cells using a suite of luminescence-based extrachromosomal reporter substrates.

Assessment of DNA Double Strand Break Repair Activity Using High-throughput and Quantitative Luminescence-Based Reporter Assays

The repair of DNA double strand breaks (DSBs) is crucial for the maintenance of genome stability and cell viability. DSB repair (DSBR) in cells is ...

assessment-dna-double-strand-break-repair-activity-using-high

Research

JoVE Journal

Cancer Research

1.0K Views.  Artios Pharma Ltd, Cambridge. We present protocols for the assessment of double strand break repair pathway proficiency in cells using a suite of luminescence-based extrachromosomal reporter substrates.

Video: Author Spotlight: Developing Novel Anticancer Therapeutics Targeting the DNA Damage Response

A Syngeneic Mouse Model of Metastatic Renal Cell Carcinoma for Quantitative and Longitudinal Assessment of Preclinical Therapies

Renal cell carcinoma (RCC) affects &#62; 60,000 people in the United States annually, and ~ 30% of RCC patients have multiple metastases at the time of diagnosis. Metastatic RCC (mRCC) is incurable, with a median survival time of only 18 months. Immune-based interventions (e.g., interferon (IFN) and interleukin (IL)-2) induce durable responses in a fraction of mRCC patients, and multikinase inhibitors (e.g., sunitinib or sorafenib) or anti-VEGF receptor monoclonal antibodies (mAb) are largely palliative, as complete remissions are rare. Such shortcomings in current therapies for mRCC patients provide the rationale for the development of novel treatment protocols. A key component in the preclinical testing of new therapies for mRCC is a suitable animal model. Beneficial features that recapitulate the human condition include a primary renal tumor, renal tumor metastases, and an intact immune system to investigate any therapy-driven immune effector responses and the formation of tumor-induced immunosuppressive factors. This report describes an orthotopic mRCC mouse model that has all of these features. We describe an intrarenal implantation technique using the mouse renal adenocarcinoma cell line Renca, followed by the assessment of tumor growth in the kidney (primary site) and lungs (metastatic site).

Implementation of an orthotopic model of renal cell carcinoma in immunocompetent mice affords the investigator a clinically-relevant system defined by the presence of a primary renal tumor and lung metastases in the same animal. This system can be used to preclinically test a variety of treatments in vivo.

Renal cell carcinoma (RCC) affects &#62; 60,000 people in the United States annually, and ~ 30% of RCC patients have multiple metastases at the time of ...

Application of Laser Micro-irradiation for Examination of Single and Double Strand Break Repair in Mammalian Cells

Highly coordinated DNA repair pathways exist to detect, excise and replace damaged DNA bases, and coordinate repair of DNA strand breaks. While molecular biology techniques have clarified structure, enzymatic functions, and kinetics of repair proteins, there is still a need to understand how repair is coordinated within the nucleus. Laser micro-irradiation offers a powerful tool for inducing DNA damage and monitoring the recruitment of repair proteins. Induction of DNA damage by laser micro-irradiation can occur with a range of wavelengths, and users can reliably induce single strand breaks, base lesions and double strand breaks with a range of doses. Here, laser micro-irradiation is used to examine repair of single and double strand breaks induced by two common confocal laser wavelengths, 355 nm and 405 nm. Further, proper characterization of the applied laser dose for inducing specific damage mixtures is described, so users can reproducibly perform laser micro-irradiation data acquisition and analysis.

Confocal fluorescence microscopy and laser micro-irradiation offer tools for inducing DNA damage and monitoring the response of DNA repair proteins in selected sub-nuclear areas. This technique has significantly advanced our knowledge of damage detection, signaling, and recruitment. This manuscript demonstrates these technologies to examine single and double strand break repair.

Highly coordinated DNA repair pathways exist to detect, excise and replace damaged DNA bases, and coordinate repair of DNA strand breaks. While molecular ...

Immunofluorescence Microscopy of &#947;H2AX and 53BP1 for Analyzing the Formation and Repair of DNA Double-strand Breaks

DNA double-strand breaks (DSB) are serious DNA lesions. Analysis of the formation and repair of DSB is relevant in a broad spectrum of research areas including genome integrity, genotoxicity, radiation biology, aging, cancer, and drug development. In response to DSB, the histone H2AX is phosphorylated at Serine 139 in a region of several megabase pairs forming discrete nuclear foci detectable by immunofluorescence microscopy. In addition, 53BP1 (p53 binding protein 1) is another important DSB-responsive protein promoting repair of DSB by nonhomologous end-joining while preventing homologous recombination. According to the specific functions of &#947;H2AX and 53BP1, the combined analysis of &#947;H2AX and 53BP1 by immunofluorescence microscopy may be a reasonable approach for a detailed analysis of DSB. This manuscript provides a step-by-step protocol supplemented with methodical notes for performing the technique. Specifically, the influence of the cell cycle on &#947;H2AX foci patterns is demonstrated in normal fibroblasts of the cell line NHDF. Further, the value of the &#947;H2AX foci as a biomarker is depicted in x-ray irradiated lymphocytes of a healthy individual. Finally, genetic instability is investigated in CD34+ cells of a patient with acute myeloid leukemia by immunofluorescence microscopy of &#947;H2AX and 53BP1.

This manuscript provides a protocol for the analysis of DNA double-strand breaks by immunofluorescence microscopy of &#947;H2AX and 53BP1.

DNA double-strand breaks (DSB) are serious DNA lesions. Analysis of the formation and repair of DSB is relevant in a broad spectrum of research areas ...

An Integrated Platform for Genome-wide Mapping of Chromatin States Using High-throughput ChIP-sequencing in Tumor Tissues

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of associated loci. In addition, the presence of specific modifications has been used to determine the position and identity non-coding functional elements such as enhancers. In recent years, chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq) has become a powerful tool in determining the genome-wide profiles of individual histone modifications. However, it has become increasingly clear that the combinatorial patterns of chromatin modifications, referred to as Chromatin States, determine the identity and nature of the associated genomic locus. Therefore, workflows consisting of robust high-throughput (HT) methodologies for profiling a number of histone modification marks, as well as computational analyses pipelines capable of handling myriads of ChIP-Seq profiling datasets, are needed for comprehensive determination of epigenomic states in large number of samples. The HT-ChIP-Seq workflow presented here consists of two modules: 1) an experimental protocol for profiling several histone modifications from small amounts of tumor samples and cell lines in a 96-well format; and 2) a computational data analysis pipeline that combines existing tools to compute both individual mark occupancy and combinatorial chromatin state patterns. Together, these two modules facilitate easy processing of hundreds of ChIP-Seq samples in a fast and efficient manner. The workflow presented here is used to derive chromatin state patterns from 6 histone mark profiles in melanoma tumors and cell lines. Overall, we present a comprehensive ChIP-seq workflow that can be applied to dozens of human tumor samples and cancer cell lines to determine epigenomic aberrations in various malignancies.

Here, we describe an optimized high-throughput ChIP-sequencing protocol and computational analyses pipeline for the determination of genome-wide chromatin state patterns from frozen tumor tissues and cell lines.

Histone modifications constitute a major component of the epigenome and play important regulatory roles in determining the transcriptional status of ...

Generation of High-Throughput Three-Dimensional Tumor Spheroids for Drug Screening

Cancer cells have routinely been cultured in two dimensions (2D) on a plastic surface. This technique, however, lacks the true environment a tumor mass is exposed to in vivo. Solid tumors grow not as a sheet attached to plastic, but instead as a collection of clonal cells in a three-dimensional (3D) space interacting with their neighbors, and with distinct spatial properties such as the disruption of normal cellular polarity. These interactions cause 3D-cultured cells to acquire morphological and cellular characteristics which are more relevant to in vivo tumors. Additionally, a tumor mass is in direct contact with other cell types such as stromal and immune cells, as well as the extracellular matrix from all other cell types. The matrix deposited is comprised of macromolecules such as collagen and fibronectin.
In an attempt to increase the translation of research findings in oncology from bench to bedside, many groups have started to investigate the use of 3D model systems in their drug development strategies. These systems are thought to be more physiologically relevant because they attempt to recapitulate the complex and heterogeneous environment of a tumor. These systems, however, can be quite complex, and, although amenable to growth in 96-well formats, and some now even in 384, they offer few choices for large-scale growth and screening. This observed gap has led to the development of the methods described here in detail to culture tumor spheroids in a high-throughput capacity in 1536-well plates. These methods represent a compromise to the highly complex matrix-based systems, which are difficult to screen, and conventional 2D assays. A variety of cancer cell lines harboring different genetic mutations are successfully screened, examining compound efficacy by using a curated library of compounds targeting the Mitogen-Activated Protein Kinase or MAPK pathway. The spheroid culture responses are then compared to the response of cells grown in 2D, and differential activities are reported. These methods provide a unique protocol for testing compound activity in a high-throughput 3D setting.

Across a wide variety of disease indications, more physiologically relevant models are being developed and implemented into drug discovery programs. The new model system described here demonstrates how three-dimensional tumor spheroids can be cultured and screened in a high-throughput 1536-well plate-based system to search for new oncology drugs.

Cancer cells have routinely been cultured in two dimensions (2D) on a plastic surface. This technique, however, lacks the true environment a tumor mass is ...

Preclinical Assessment of the Bioactivity of the Anticancer Coumarin OT48 by Spheroids, Colony Formation Assays, and Zebrafish Xenografts

In vitro and in vivo pre-clinical screening of novel therapeutic agents are an essential tool in cancer drug discovery. Although human cancer cell lines respond to therapeutic compounds in 2D (dimensional) monolayer cell cultures, 3D culture systems were developed to understand the efficacy of drugs in more physiologically relevant models. In recent years, a paradigm shift was observed in pre-clinical research to validate the potency of new molecules in 3D culture systems, more precisely mimicking the tumor microenvironment. These systems characterize the disease state in a more physiologically relevant manner and help to gain better mechanistic insight and understanding of the pharmacological potency of a given molecule. Moreover, with the current trend in improving in vivo cancer models, zebrafish has emerged as an important vertebrate model to assess in vivo tumor formation and study the effect of therapeutic agents. Here, we investigated the therapeutic efficacy of hydroxycoumarin OT48 alone or in combination with BH3 mimetics in lung cancer cell line A549 by using three different 3D culture systems including colony formation assays (CFA), spheroid formation assay (SFA) and in vivo zebrafish xenografts.

Here, we present the preclinical screening of anticancer coumarins using 3D culture and zebrafish.

In vitro and in vivo pre-clinical screening of novel therapeutic agents are an essential tool in cancer drug discovery. Although human cancer cell lines ...

Characterizing DNA Repair Processes at Transient and Long-lasting Double-strand DNA Breaks by Immunofluorescence Microscopy

The repair of double-stranded breaks (DSBs) in DNA is a highly coordinated process, necessitating the formation and resolution of multi-protein repair complexes. This process is regulated by a myriad of proteins that promote the association and disassociation of proteins to these lesions. Thanks in large part to the ability to perform functional screens of a vast library of proteins, there is a greater appreciation of the genes necessary for the double-strand DNA break repair. Often knockout or chemical inhibitor screens identify proteins involved in repair processes by using increased toxicity as a marker for a protein that is required for DSB repair. Although useful for identifying novel cellular proteins involved in maintaining genome fidelity, functional analysis requires the determination of whether the protein of interest promotes localization, formation, or resolution of repair complexes. 
The accumulation of repair proteins can be readily detected as distinct nuclear foci by immunofluorescence microscopy. Thus, association and disassociation of these proteins at sites of DNA damage can be accessed by observing these nuclear foci at representative intervals after the induction of double-strand DNA breaks. This approach can also identify mis-localized repair factor proteins, if repair defects do not simultaneously occur with incomplete delays in repair. In this scenario, long-lasting double-strand DNA breaks can be engineered by expressing a rare cutting endonuclease (e.g., I-SceI) in cells where the recognition site for the said enzyme has been integrated into the cellular genome. The resulting lesion is particularly hard to resolve as faithful repair will reintroduce the enzyme's recognition site, prompting another round of cleavage. As a result, differences in the kinetics of repair are eliminated. If repair complexes are not formed, localization has been impeded. This protocol describes the methodology necessary to identify changes in repair kinetics as well as repair protein localization.

Repair of double-strand DNA breaks is a dynamic process, requiring not only formation of repair complexes at the breaks, but also their resolution after the lesion is addressed. Here, we use immunofluorescence microscopy for transient and long-lasting double-stranded breaks as a tool to dissect this genome maintenance mechanism.

The repair of double-stranded breaks (DSBs) in DNA is a highly coordinated process, necessitating the formation and resolution of multi-protein repair ...

Using Microarrays to Interrogate Microenvironmental Impact on Cellular Phenotypes in Cancer

Understanding the impact of the microenvironment on the phenotype of cells is a difficult problem due to the complex mixture of both soluble growth factors and matrix-associated proteins in the microenvironment in vivo. Furthermore, readily available reagents for the modeling of microenvironments in vitro typically utilize complex mixtures of proteins that are incompletely defined and suffer from batch to batch variability. The microenvironment microarray (MEMA) platform allows for the assessment of thousands of simple combinations of microenvironment proteins for their impact on cellular phenotypes in a single assay. The MEMAs are prepared in well plates, which allows the addition of individual ligands to separate wells containing arrayed extracellular matrix (ECM) proteins. The combination of the soluble ligand with each printed ECM forms a unique combination. A typical MEMA assay contains greater than 2,500 unique combinatorial microenvironments that cells are exposed to in a single assay. As a test case, the breast cancer cell line MCF7 was plated on the MEMA platform. Analysis of this assay identified factors that both enhance and inhibit the growth and proliferation of these cells. The MEMA platform is highly flexible and can be extended for use with other biological questions beyond cancer research.

The purpose of the method presented here is to show how microenvironment microarrays (MEMA) can be fabricated and used to interrogate the impact of thousands of simple combinatorial microenvironments on the phenotype of cultured cells.

Understanding the impact of the microenvironment on the phenotype of cells is a difficult problem due to the complex mixture of both soluble growth ...

Establishment and Characterization of Small Bowel Neuroendocrine Tumor Spheroids

Small bowel neuroendocrine tumors (SBNETs) are rare cancers originating from enterochromaffin cells of the gut. Research in this field has been limited because very few patient derived SBNET cell lines have been generated. Well-differentiated SBNET cells are slow growing and are hard to propagate. The few cell lines that have been established are not readily available, and after time in culture may not continue to express characteristics of NET cells. Generating new cell lines could take many years since SBNET cells have a long doubling time and many enrichment steps are needed in order to eliminate the rapidly dividing cancer-associated fibroblasts. To overcome these limitations, we have developed a protocol to culture SBNET cells from surgically removed tumors as spheroids in extracellular matrix (ECM). The ECM forms a 3-dimensional matrix that encapsulates SBNET cells and mimics the tumor micro-environment for allowing SBNET cells to grow. Here, we characterized the growth rate of SBNET spheroids and described methods to identify SBNET markers using immunofluorescence microscopy and immunohistochemistry to confirm that the spheroids are neuroendocrine tumor cells. In addition, we used SBNET spheroids for testing the cytotoxicity of rapamycin.

Neuroendocrine tumors (NETs) originate from neuroendocrine cells of the neural crest. They are slow growing and challenging to culture. We present an alternative strategy to grow NETs from the small bowel by culturing them as spheroids. These spheroids have small bowel NET markers and can be used for drug testing.

Small bowel neuroendocrine tumors (SBNETs) are rare cancers originating from enterochromaffin cells of the gut. Research in this field has been limited ...

Immunofluorescence Imaging of DNA Damage and Repair Foci in Human Colon Cancer Cells

The purpose of the manuscript is to provide a step-by-step protocol for performing immunofluorescence microscopy to study the radiation-induced DNA damage response induced by neutron-gamma mixed-beam used in boron neutron capture therapy (BNCT). Specifically, the proposed methodology is applied for the detection of repair proteins activation which can be visualized as foci using antibodies specific to DNA double-strand breaks (DNA-DSBs). DNA repair foci were assessed by immunofluorescence in colon cancer cells (HCT-116) after irradiation with the neutron-mixed beam. DNA-DSBs are the most genotoxic lesions and are repaired in mammalian cells by two major pathways: non-homologous end-joining pathway (NHEJ) and homologous recombination repair (HRR). The frequencies of foci, immunochemically stained, for commonly used markers in radiobiology like &#947;-H2AX, 53BP1 are associated with DNA-DSB number and are considered as efficient and sensitive markers for monitoring the induction and repair of DNA-DSBs. It was established that &#947;-H2AX foci attract repair proteins, leading to a higher concentration of repair factors near a DSB. To monitor DNA damage at the cellular level, immunofluorescence analysis for the presence of DNA-PKcs representative repair protein foci from the NHEJ pathway and Rad52 from the HRR pathway was planned. We have developed and introduced a reliable immunofluorescence staining protocol for the detection of radiation-induced DNA damage response with antibodies specific for repair factors from NHEJ and HRR pathways and observed radiation-induced foci (RIF). The proposed methodology can be used for investigating repair protein that is highly activated in the case of neutron-mixed beam radiation, thereby indicating the dominance of the repair pathway.

Radiation-induced DNA damage response activated by neutron mixed-beam used in boron neutron capture therapy (BNCT) has not been fully established. This protocol provides a step-by-step procedure to detect radiation-induced foci (RIF) of repair proteins by immunofluorescence staining in human colon cancer cell lines after irradiation with the neutron-mixed beam.

The purpose of the manuscript is to provide a step-by-step protocol for performing immunofluorescence microscopy to study the radiation-induced DNA damage ...