Agradecemos Angelika Berg de assistência laboratorial. Este trabalho foi apoiado e financiado pela Sociedade Max Planck e da Escola de Comunicação Jena microbiana (JSMC).

1. Insect Criação <ol><li> Compre ou obter ovos garras de Spodoptera littoralis de seu próprio criação. Mantê-los em placas de Petri estéreis à temperatura ambiente (RT) até a eclosão. </li><li> Prepare a dieta artificial para insectos de criação como se segue: <ol><li> Mergulhe 500 g de feijão branco de terra durante a noite em 100 ml de água. </li><li> Adicionar 9,0 g de ácido ascórbico e 75 g de ágar a 1000 ml de H2O destilada e depois reduzi-lo. </li><li> Deixe a mistura a arrefecer e, quando a mesma solidifica (para uma mistura de sólido ceroso branco) armazená-lo a 4 ° C até à sua utilização. </li></ol></li><li> Transfira a larva a uma caixa de plástico limpo e criá-los na dieta artificial a 23-25 ​​° C, sob um regime de longo dia com 16 horas de iluminação e 8 horas de escuridão. Mude a comida todos os dias até as larvas passam por todos os seis estágios larvais. </li></ol> 2. 13 C-rotulagem de DNA em bactérias do intestino metabolicamente ativo <ol><li> Dissolve-se 186,1 mg de totalmente 13 C-glucose marcada com água destilada e água desionizada (ddH2O) e misture bem com 100 g de uma dieta artificial para o experimento SIP. Certifique-se de uma concentração de 13 C-glucose final de 10 mM na dieta artificial. Este simula a concentração de glucose in situ no intestino de S. littoralis larvas em plantas de algodão de acordo com Shao et al. (submetido). </li><li> Transferência 9-15 segunda larvas saudável a partir da caixa de criação para placas de Petri de plástico estéril (uma larva por placa de Petri) contendo fresco 13 C-glicose cravado dieta artificial. Use dieta artificial contendo a mesma quantidade de glicose nativa (12 C-glicose), tal como descrito, para a alimentação do grupo de controlo. </li><li> Renove a dieta artificial com frequência durante o período de incubação (1 dia). Use condições de criação como no passo 1.3. </li><li> Colete nove larvas de cada tratamento para posterior processamento (extração de DNA). Cadareplicar é constituído por três indivíduos; fazer, pelo menos, três repetições por tratamento. </li></ol> 3. Insect Dissection <ol><li> Limpar e desinfectar as ferramentas de dissecação no início do trabalho com etanol 70% (Ferramentas = tesoura Vannas, fórceps e bisturi com lâminas descartáveis ​​finas). </li><li> Pegue os insetos com uma pinça macios e lavar a pele superficialmente com água destilada. Colocá-los em gelo durante pelo menos 30 minutos para anestesiar eles. </li><li> Enquanto ainda anestesiados lugar deles a 0 ° C durante 1 hora para matar. Desinfetar os insetos mortos superficialmente por imersão em etanol (70%) por um par de minutos. </li><li> Realizar o insecto dissecção em um volume de aproximadamente 15 ml de PBS 1x depositado sobre uma placa de Petri esterilizada (NaCl 1XPBS = 137 mM, KCl 2,7 mM, 4,3 mM de Na 2 HPO 4, 1,47 mM, KH 2 PO 4, ajustar o pH para 7,4 , autoclave). Certifique-se de ter o corpo todo inseto totalmente imersa na solutíon durante todo o período de dissecação. </li><li> Comece a dissecção, fazendo uma incisão na pele ao longo do lado esquerdo do inseto direita e, começará na cabeça e terminar no ânus. Retire toda a pele, túbulos de Malpighi, e gordura corporal. Mude para tampão fresco antes de cortar aberto o intestino. Seção do intestino em primeiro plano, médio e intestino posterior, quando necessário. Armazenar o tecido no congelador (-80 a -20 ° C) até que a extracção do ADN </li></ol> 4. Extração de DNA e amplificação <ol><li> Colocar o tecido de insectos em um tubo de 1,5 ml de centrífuga estéril e secar todas as amostras a 45 ° C num dispositivo de concentrador de vácuo. Esmagar o tecido seco com um pilão de plástico estéril. </li><li> Extrair o DNA genômico utilizando um kit adequado para a extração de DNA do solo. Transferir o tecido seco para o tubo de reacção do kit e seguir as instruções como indicado pelo fabricante. </li><li> Determinar a concentração do ADN eluído final, utilizando um espectrofotómetro. </li><li> Verifya extração com sucesso do DNA metagenômica microbiana do intestino do inseto através da preparação de um ensaio de PCR diagnóstico usando eubacterianas primers gerais 27f (5 - AGAGTTTGATCCTGGCTCAG -3) e 1492r (5 - GGTTACCTTGTTACGACTT -3). Definir a reacção de PCR como se segue: <ol><li> Definir uma mistura de reacção de 50 ul contendo 1x tampão, 1,5 mM de MgCl 2, 10 mM de quatro trifosfatos de desoxinucleótidos (dNTPs), 2,5 U de Taq DNA polimerase, 0,5 mM de cada iniciador e 60 ng do ADN extraído como molde. </li><li> Executar as reacções de PCR utilizando um termociclador como se segue: desnaturação inicial a 94 ° C durante 3 min, seguido por 35 ciclos de: 94 ° C durante 45 seg, emparelhamento a 55 ° C durante 30 seg e extensão a 72 ° C durante 1 min . Usar um passo de extensão final a 72 ° C durante 10 min. </li><li> Verificar a amplificação com êxito por PCR em agarose a 1% da electroforese de brometo de etídio (EB) gel corado (dissolver 1 g de agarose em 100 ml de tampão 1 x TAE e mancha com 1ml EB). Depósito 5 jul of thproduto e PCR + 1ml de 6x corante de carregamento para os bolsos de gel. (1x TAE = 40 mM Tris-Base, 20 mM de ácido acético glacial, 1 mM de EDTA, ajustado a pH 8). </li><li> Executar o gel utilizando tampão 1xTAE a 300 V, 115 mA, durante ca. 20 min em uma câmara de eletroforese. Usando uma câmara de documentação de gel (transiluminador UV ligado a uma câmera digital e computador) observar o gel e comparar o tamanho do seu produto final com o marcador de gene também carregado, o tamanho correto dos amplicons deve ser de aproximadamente 1,5 kb. </li></ol></li><li> Armazenar os produtos de PCR sob condições de congelamento profundo, preferencialmente -80 ° C, até utilização. </li></ol> 5. Separação do CsCl DNA Gradiente Ultracentrifugação <ol><li> Preparar os reagentes para os gradientes de ultracentrifugação como se segue: <ol><li> Prepara-se uma M de cloreto de césio (CsCl), solução 7,163 dissolvendo gradualmente 603,0 g de CsCl em ddH2O e encher-se até um volume final de 500 ml. </li><li> Exatamente desterminé a densidade da solução de CsCl preparado por pesagem de um aliquota de 1,0 ml em um equilíbrio de três dígitos por triplicado. Esta, geralmente, varia entre 1,88 e 1,89 g / ml à temperatura ambiente. </li><li> Preparar o tampão de gradiente (Tris 100 mM, KCl 100 mM e EDTA 1 mM) por combinação de 50 mL de 1 M de Tris-HCl (pH 8,0), 1 ml de 0,5 M de EDTA (pH 8) e 3,75 g de KCl numa final volume de 500 ml, utilizando DDQ 2 O. Filtro (0,22 mM) e esterilizar em autoclave esta solução. </li></ol></li><li> Separação DNA <ol><li> Tendo determinado a concentração de DNA individual dos insectos tratados, medida como no ponto 4.3, reunir os insetos correspondentes a um conjunto de replicação e normalizar a concentração de ADN para assegurar que cada um, contribui igualmente para a amostra combinada. A concentração final de 500-5.000 ng de ADN (medir novamente a concentração final), é adequado para o processo de ultracentrifugação 21. </li><li> Para configurar o meio de gradiente, combinar o DNA quantificado, um buffer de gradiented 4,8 mL de solução 7,163 M de CsCl em conjunto a um volume de mistura de 6,0 ml para um tubo estéril de 15 ml com tampa de rosca (geração de uma mistura de ADN-meio de gradiente). </li><li> Cuidadosamente coloque o gradiente de mistura de ADN-meio preparado para um tubo de ultracentrífuga 5,1 ml (preencher até a base do gargalo do tubo) utilizando uma seringa e agulha. Evitar bombeamento ou formar quaisquer bolhas de ar. Inclua pelo menos um gradiente em branco (usando DDH 2 O em vez de DNA) em cada centrífuga prazo, como um gradiente de referência. </li><li> Pares de tubos de equilíbrio para dentro de 10 mg de peso após cada meio de gradiente necessário é preenchida para o respectivo tubo de ultracentrífuga. Selar o tubo com um &quot;Topper Tube&quot; e garantir que o selo é livre de vazamentos invertendo o tubo e aplicando uma pressão moderada com a mão. </li><li> Use um rotor quase vertical com oito poços para a realização de 5,1 ml tubos de ultracentrifugação para a ultracentrifugação. Selar cuidadosamente os poços do rotor e carregar o rotor para a ultracentrífuga de acordo com a mainstruções do nufacturer. Definir as condições de ultracentrifugação: rotação em 50.000 rpm (cerca de 177.000 xg), a temperatura a 20 ° C, e ultracentrifugação tempo de funcionamento por 40 horas, com vácuo. Selecione a aceleração máxima e desaceleração sem freio. </li><li> Uma vez terminado, remova cuidadosamente os tubos do rotor de centrífuga com a pinça. Colocá-los em um rack, sem perturbar os gradientes formados dentro dos tubos. Processe as amostras de fraccionamento de gradiente, logo que possível, para minimizar qualquer difusão. </li></ol></li><li> Recuperação de DNA a partir de gradientes isopícnica separados por fracionamento <ol><li> Usar um sistema de bomba de HPLC com uma precisão de realizar o fraccionamento de gradiente, o qual separa os gradientes igualmente formados a partir do tubo de ultracentrífuga método de deslocamento superior. Ligue a bomba de HPLC (100% gradiente de fluxo) para a garrafa cheia de 1 L de deslocamento DDH 2 O e firmemente anexar a tubulação da bomba aberta com um 23 G 1 em agulha de seringa. Adicionar suficiente bromophenol corante azul para o DDH 2 O para dar-lhe uma cor azul escuro. Isto facilita a visualização de interface entre o meio de gradiente e o deslocamento de ddH 2 O. </li><li> Definir a bomba a uma taxa de fluxo de 850 mL / min e equilibrar o sistema até que uma gota da cor azul ddH2O emerge para fora da agulha de uma seringa. </li><li> Cuidadosamente fixar o tubo de ultracentrífuga para uma posição de fixação e perfurar o fundo do tubo com uma seringa de 23 G 1 em agulha longa. Ligar a bomba para o tubo de ultracentrífuga, inserindo a agulha ligada ao tubo da bomba para a parte superior do tubo, e recolher gotas a partir do fundo directamente em tubos estéreis de microcentrífuga de 1,5 ml. Coletar uma fração a cada 30 seg, no valor de cerca de 425 mL por fração e um total de 12 frações por gradiente. Note que a última fracção (fracção 12) contém geralmente o deslocamento ddH2O e deve ser descartado. </li><li> Após o fracionamento, measure a densidade de todas as fracções separadas, utilizando uma balança analítica, como mencionado na etapa 5.1.2. </li><li> Precipitar o DNA a partir de cada fracção (em 425 uL) adicionando primeiro uma glicogénio ul (20 ug / ul em ddH2O, autoclavado) como um transportador para a precipitação de uma baixa quantidade de ADN. Misture bem por inversão. </li><li> Adicionar dois volumes (850 uL) de uma solução de (PEG) (dissolver 150 g de polietileno glicol 6000 e 46,8 g de NaCl em ddH2O para um volume total de 500 ml de polietileno-glicol. Filtro, esterilizar e autoclave. A solução de PEG é 30 % PEG 6000 e 1,6 M de NaCl), e misturar novamente invertendo dez vezes. </li><li> Deixar os tubos a temperatura ambiente durante pelo menos duas horas (se for necessário, durante a noite) para precipitar o ADN. </li><li> Centrifugar os precipitados a 13.000 xg durante 30 min à temperatura ambiente. A pelota visível devem formar. </li><li> Cuidadosamente remove-se o sobrenadante com uma pipeta e lava-se o sedimento com 500 ul de etanol a 70%. Centrifugar sob o mesmocondições para 10 minutos novamente. </li><li> Descartar o sobrenadante cuidadosamente e ar secar o sedimento à TA durante 15 min. </li><li> Redissolver o sedimento de DNA seco em 30 uL de ddH2O e misturar bem batendo ligeiramente no tubo. Quantificar o DNA em cada fração gradiente como no passo 4.3 loja as amostras a -20 ou -80 ° C, se o armazenamento de longo prazo é necessária. </li></ol></li></ol> 6. DNA Caracterização por Pyrosequencing <ol><li> Assegure-se que o ADN nativo não marcado (12 C) ocupa o intervalo de densidade de 1,705 g / ml a 1,720 g / ml, enquanto que o ADN de C-13 marcado tem uma densidade de cerca de 1,720-1,735 g / ml. Note-se que tanto o nativo e 13-C marcado de DNA extraído a partir de amostras ambientais pode abranger várias fracções do gradiente. Esperar que o ADN de luz para ser associada com as fracções 9-11 e o ADN pesado para ser associada com as fracções 4-6. </li><li> Combine frações chave para criar um único &quot;compilado&quot; ac fracção representativacordões para a atribuição de pico específico do ADN resolvido densidade. Alternativamente, outros meios para examinar as fracções separadas usando a espectrometria de massa isotópica razão isotópica (IRMS) 22 ou um método de impressão digital, como eletroforese desnaturante (DGGE) 23, pode ajudar a escolher frações apropriadas antes do seqüenciamento. </li><li> Realize pyrosequencing dos genes 16S rRNA amplificados por PCR a partir das frações pesadas, médias e leves compilados de cada gradiente individual. Usando este método, a identificação da linhagem e abundância relativa de espécies de bactérias metabolicamente activas no SIP amostras incubadas é possível. Realizar pyrosequencing como se segue: <ol><li> Realizar amplicão pyrosequencing usando um instrumento FLX Roche 454 com reagentes de titânio. </li><li> Prepare amplicons com código de barras para multiplexação usando o primer fusão definir Gray28F (5 - GAGTTTGATCNTGGCTCAG -3) e Gray519r (5 - GTNTTACNGCGGCKGCTG -3) 24,25 estendido com the respectiva cartilha adaptador A / B e identificadores multiplex-específica da amostra (média). </li><li> Aplicar uma PCR de um passo com 30 ciclos, utilizando uma polimerase Hot Start Taq, para gerar a biblioteca de sequenciação. </li><li> Sequenciar o amplicons com base no protocolo de fornecedor, e estender a lê a frente (Gray28F) como descrito no <a href="http://www.researchandtesting.com/">http://www.researchandtesting.com/</a> . </li></ol></li></ol> 7. Análise de Dados pyrosequencing <ol><li> Analisar a seqüência cru lê gerado pelo 454 pyrosequencing com os &quot;insights quantitativos em ecologia microbiana&quot;, software QIIME oleoduto 26. Executar o processamento da seguinte forma: <ol><li> Inicialmente, converter o arquivo sff 454-máquina gerado para FASTA, QUAL e arquivos Flowgram com o script process_sff.py. </li><li> Validar o arquivo de mapeamento (baseado em check_id_map.py) e atribuir multiplexado lê para sam biológicacípios com o script split_libraries.py. Apare a baixa qualidade termina com um tamanho de janela de correr de 50 e um parâmetro de qualidade média de corte de 25, eliminar também as sequências ambíguas curtas (o comprimento &lt;200 pb) do conjunto de dados. </li><li> DeNoise dos dados 454 utilizando o denoise_wrapper.py. </li><li> Em seguida, agrupar a alta qualidade lê em unidades taxonômicas operacionais (Otus) usando o método de múltipla OTU escolher (pick_otus.py com 97% de similaridade de seqüência cut-offs). </li><li> Escolha uma seqüência representante de cada OTU usando pick_rep_set.py. </li><li> Atribuir taxonomia para o conjunto representativo seqüência com base em assign_taxonomy.py. Use o classificador Ribosomal Database Project (RDP) com uma confiança mínima para atribuição recorde de 0,80. </li><li> Alinhe a seqüência de representação instituído contra os prealigned principais seqüências 16S GreenGenes usando o algoritmo PyNast (align_seqs.pycom o mínimo seqüência identidade por cento conjunto de 75). </li><li> Além disso, esgotar quimeras de uma análise mais aprofundada, executando identify_chimeric_seqs.py. </li><li> Remova todas as posições de gap (não úteis para inferência filogenética) com o modelo lanemask (filter_alignment.py) antes da construção de uma árvore filogenética (make_phylogeny.py). </li><li> Finalmente, gerar tabelas OTU com make_otu_table.py, descrevendo a ocorrência de filotipos bacterianos dentro de cada amostra. Use a tabela de OTU para construir o mapa de calor para comparar a abundância ea atividade bacteriana. </li><li> Se necessário, calcular o alfa e beta diversidade dentro e entre as amostras, respectivamente. Da mesma forma, curvas de rarefação (gráficos de diversidade em função da profundidade de seqüenciamento) e Análise de Coordenadas Principais (PCoA) parcelas representando as relações entre comunidades microbianas pode também estar preparado. </li></ol></li></ol>

<ol>
	<li>Pais, R., Lohs, C., Wu, Y. N., Wang, J. W., Aksoy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+obligate+mutualist+Wigglesworthia+glossinidia+influences+reproduction,+digestion,+and+immunity+processes+of+its+host,+the+tsetse+fly.">The obligate mutualist Wigglesworthia glossinidia influences reproduction, digestion, and immunity processes of its host, the tsetse fly.</a> Appl. Environ. Microbiol. 74, 5965-5974 (2008).</li><li>Freitak, D., Heckel, D. G., Vogel, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dietary-dependent+trans-generational+immune+priming+in+an+insect+herbivore.">Dietary-dependent trans-generational immune priming in an insect herbivore.</a> Proc. Biol. Sci. 276, 2617-2624 (2009).</li><li>Dillon, R. J., Vennard, C. T., Charnley, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Note:+Gut+bacteria+produce+components+of+a+locust+cohesion+pheromone.">A Note: Gut bacteria produce components of a locust cohesion pheromone.</a> J. Appl. Microbiol. 92, 759-763 (2002).</li><li>Douglas, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutritional+interactions+in+insect-microbial+symbioses:+Aphids+and+their+symbiotic+bacteria+Buchnera.">Nutritional interactions in insect-microbial symbioses: Aphids and their symbiotic bacteria Buchnera.</a> Annu. Rev. Entomol. 43, 17-37 (1998).</li><li>Reichardt, N., Barclay, A. R., Weaver, L. T., Morrison, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+stable+isotopes+to+measure+the+metabolic+activity+of+the+human+intestinal+microbiota.">Use of stable isotopes to measure the metabolic activity of the human intestinal microbiota.</a> Appl. Environ. Microbiol. 77, 8009-8014 (2011).</li><li>Dumont, M. G., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+isotope+probing+-+linking+microbial+identity+to+function.">Stable isotope probing - linking microbial identity to function.</a> Nat. Rev. Microbiol. 3, 499-504 (2005).</li><li>Gil, R., Latorre, A., Moya, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+endosymbionts+of+insects:+insights+from+comparative+genomics.">Bacterial endosymbionts of insects: insights from comparative genomics.</a> Environ. Microbiol. 6, 1109-1122 (2004).</li><li>Brune, A., VH, R. e. s. h., Card&#233;, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Encyclopedia of Insects. , 1132 (2005).</li><li>Breznak, J. A., Brune, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+microorganisms+in+the+digestion+of+lignocellulose+by+termites.">Role of microorganisms in the digestion of lignocellulose by termites.</a> Annu. Rev. Entomol. 39, 453-487 (1994).</li><li>Broderick, N. A., Raffa, K. F., Goodman, R. M., Handelsman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Census+of+the+bacterial+community+of+the+gypsy+moth+larval+midgut+by+using+culturing+and+culture-independent+methods.">Census of the bacterial community of the gypsy moth larval midgut by using culturing and culture-independent methods.</a> Appl. Environ. Microbiol. 70, 293-300 (2004).</li><li>Funke, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hydrolysis+of+quorum-sensing+molecules+in+the+gut+of+lepidopteran+larvae.">Rapid hydrolysis of quorum-sensing molecules in the gut of lepidopteran larvae.</a> Chembiochem. 9, 1953-1959 (2008).</li><li>Tang, X. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complexity+and+variability+of+gut+commensal+microbiota+in+polyphagous+lepidopteran+larvae.">Complexity and variability of gut commensal microbiota in polyphagous lepidopteran larvae.</a> PloS One. 7, (2012).</li><li>Amann, R. I., Ludwig, W., Schleifer, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phylogenetic+identification+and+in-situ+detection+of+individual+microbial-cells+without+cultivation.">Phylogenetic identification and in-situ detection of individual microbial-cells without cultivation.</a> Microbiol. Rev. 59, 143-169 (1995).</li><li>Olsen, G. J., Lane, D. J., Giovannoni, S. J., Pace, N. R., Stahl, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+ecology+and+evolution+-+a+ribosomal-rna+approach.">Microbial ecology and evolution - a ribosomal-rna approach.</a> Annu. Rev. Microbiol. 40, 337-365 (1986).</li><li>Pilloni, G., von Netzer, F., Engel, M., Lueders, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electron+acceptor-dependent+identification+of+key+anaerobic+toluene+degraders+at+a+tar-oil-contaminated+aquifer+by+Pyro-SIP.">Electron acceptor-dependent identification of key anaerobic toluene degraders at a tar-oil-contaminated aquifer by Pyro-SIP.</a> FEMS Microbiol. Ecol. 78, 165-175 (2011).</li><li>Lu, Y. H., Conrad, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+stable+isotope+probing+of+methanogenic+archaea+in+the+rice+rhizosphere.">In situ stable isotope probing of methanogenic archaea in the rice rhizosphere.</a> Science. 309, 1088-1090 (2005).</li><li>Radajewski, S., Ineson, P., Parekh, N. R., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable-isotope+probing+as+a+tool+in+microbial+ecology.">Stable-isotope probing as a tool in microbial ecology.</a> Nature. 403, 646-649 (2000).</li><li>Lueders, T., Pommerenke, B., Friedrich, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable-isotope+probing+of+microorganisms+thriving+at+thermodynamic+limits:+Syntrophic+propionate+oxidation+in+flooded+soil.">Stable-isotope probing of microorganisms thriving at thermodynamic limits: Syntrophic propionate oxidation in flooded soil.</a> Appl. Environ. Microbiol. 70, 5778-5786 (2004).</li><li>Kunapuli, U., Lueders, T., Meckenstock, R. U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+stable+isotope+probing+to+identify+key+iron-reducing+microorganisms+involved+in+anaerobic+benzene+degradation.">The use of stable isotope probing to identify key iron-reducing microorganisms involved in anaerobic benzene degradation.</a> ISME J. 1, 643-653 (2007).</li><li>Fuhrer, T., Fischer, E., Sauer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+identification+and+quantification+of+glucose+metabolism+in+seven+bacterial+species.">Experimental identification and quantification of glucose metabolism in seven bacterial species.</a> J. Bacteriol. 187, 1581-1590 (2005).</li><li>Dunford, E. A., Neufeld, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Stable-Isotope+Probing+(DNA-SIP).">DNA Stable-Isotope Probing (DNA-SIP).</a> J. Vis. Exp. (42), (2010).</li><li>Yamasaki, S., Nomura, N., Nakajima, T., Uchiyama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cultivation-independent+identification+of+candidate+dehalorespiring+bacteria+in+tetrachloroethylene+degradation.">Cultivation-independent identification of candidate dehalorespiring bacteria in tetrachloroethylene degradation.</a> Environ. Sci. Technol. 46, 7709-7716 (2012).</li><li>Lueders, T., Manefield, M., Friedrich, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+sensitivity+of+DNA-+and+rRNA-based+stable+isotope+probing+by+fractionation+and+quantitative+analysis+of+isopycnic+centrifugation+gradients.">Enhanced sensitivity of DNA- and rRNA-based stable isotope probing by fractionation and quantitative analysis of isopycnic centrifugation gradients.</a> Environ. Microbiol. 6, 73-78 (2004).</li><li>Ishak, H. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+diversity+in+Solenopsis+invicta+and+Solenopsis+geminata+ant+colonies+characterized+by+16S+amplicon+454+pyrosequencing.">Bacterial diversity in Solenopsis invicta and Solenopsis geminata ant colonies characterized by 16S amplicon 454 pyrosequencing.</a> Microb. Ecol. 61, 821-831 (2011).</li><li>Sun, Y., Wolcott, R. D., Dowd, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tag-encoded+FLX+amplicon+pyrosequencing+for+the+elucidation+of+microbial+and+functional+gene+diversity+in+any+environment.">Tag-encoded FLX amplicon pyrosequencing for the elucidation of microbial and functional gene diversity in any environment.</a> Methods Mol. Biol. 733, 129-141 (2011).</li><li>Kuczynski, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+QIIME+to+Analyze+16S+rRNA+Gene+sequences+from+microbial+communities.">Using QIIME to Analyze 16S rRNA Gene sequences from microbial communities.</a> Curr. Protoc. Microbiol. Chapter 1, Unit1E 5 (2012).</li><li>Dillon, R. J., Dillon, V. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gut+bacteria+of+insects:+nonpathogenic+interactions.">The gut bacteria of insects: nonpathogenic interactions.</a> Annu. Rev. Entomol. 49, 71-92 (2004).</li><li>Neufeld, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+stable-isotope+probing.">DNA stable-isotope probing.</a> Nat. Protoc. 2, 860-866 (2007).</li><li>Dumont, M. G., Murrell, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+isotope+probing+-+linking+microbial+identity+to+function.">Stable isotope probing - linking microbial identity to function.</a> Nat. Rev. Microbiol. 3, 499-504 (2005).</li></ol>

Não temos nada a divulgar.

O intestino da maioria dos insetos abriga uma comunidade microbiana rica e complexa, normalmente 10 7 -10 9 células procariotas apresentar lá, superando as próprias células do hospedeiro, na maioria dos casos. Assim, o inseto intestino é um &quot;hot spot&quot; para diversas atividades microbianas, representando vários aspectos das relações microbianas, de patogênese para obrigar mutualismo 27. Embora muitos estudos têm descrito uma incrível variedade de comunidades microbiana...

Associações simbióticas Insect-bacterianos são conhecidos por um grande número de espécies de insetos 7. Nestas associações simbióticas, microrganismos desempenham um papel importante no crescimento e desenvolvimento de insectos. Os micróbios têm sido mostrados para contribuir para a reprodução de insectos 1, feromona biossíntese 3, nutrição, incluindo a síntese de aminoácidos essenciais, 4, e a digestão de alimentos inacessível ao hospedeiro. Apesar da grande variedade de associações gut-bacteriana, muito menos se sabe sobre o papel funcional que desempenham em favor do inseto. Só no caso de as térmitas, a digestão simbiótica de lignocelulose realizada por procariotas, protozoários e fungos, tem sido amplamente estudada 8,9. Em contraste com isso, pouco se sabe sobre a associação simbiótica presente no intestino dos insetos generalistas, ou seja, o curuquerê, Spodoptera littoralis. Além disso, devido à sua mudança freqüente de plantas hospedeiras, em geralist insetos e seus intestino comunidades bacterianas associadas estão permanentemente expostos a novos desafios vinculados a seus hábitos alimentares consumir plantas com uma infinidade de fitoquímicos. Ao lado desta, o ambiente do intestino em lepidópteros, representa por si só um ambiente hostil para o crescimento de bactérias por causa do elevado pH do intestino 10. Particularmente, no caso de S. littoralis, que varia de 10,5 no intestino anterior, ca. 9 no intestino médio para um pH de cerca de 7 no intestino posterior 11. Por outro lado, a comunidade bacteriana associada com o intestino de S. littoralis é simples. Tang, Freitak, et al. 12 relataram um máximo de 36 filotipos pertencentes a um total de 7 espécies de bactérias diferentes, como os únicos membros da comunidade bacteriana associada a esse inseto. Além disso, qualquer processo de criação complicado é necessário para o crescimento dos insectos no laboratório. Além disso, este e o curto ciclo de vida do insecto facilitar multi-gestudos enerational, transformando esta espécie em um sistema modelo ideal para o estudo de interações gut-micróbio. Com o advento das tecnologias de seqüenciamento baseadas na PCR, o número de estudos que tratam de intestino biota de vários organismos (ou seja, os seres humanos, insetos, ou organismos marinhos) tem aumentado. Além disso, os resultados são independentes do isolamento e cultivo das bactérias intestinais abrigado como no passado. Quase 99% das bactérias não são cultiváveis ​​e a simulação das condições ambientais prevalecentes no intestino é difícil 12. Usando PCR, os fragmentos de genes de rRNA 16S (um gene marcador filogenético amplamente utilizado entre as bactérias) pode ser amplificado de forma selectiva um molde de ADN mista de comunidades bacterianas do intestino, sequenciados, e clonado. Com essas informações, o usuário é capaz de identificar as espécies de bactérias depois de recuperar as informações da seqüência de bases de dados públicas 13,14. No entanto, a sequenciação de abordagens para descrever bacterianacomunidades continuam a ser insuficientes, devido à falta de informações sobre a contribuição metabólica intrínseca de cada espécie dentro da comunidade. Stable-isótopo sondagem (SIP) é uma técnica sem cultura promissor. Ele é frequentemente usado em microbiologia ambiental para analisar filogenias microbianas associadas a determinadas atividades metabólicas. Isto é conseguido através do rastreamento de isótopos estáveis, marcado átomos de substratos em biomarcadores microbianos, tais como os ácidos gordos derivados de fosfolípidos, DNA e RNA de 5. Ao considerar os ácidos nucleicos, a metodologia baseia-se na separação de 13 de ADN marcado com C ou de ARN a partir do ADN não marcado por ultracentrifugação em gradiente de densidade de 6. Devido a esta ligação directa entre o marcador de ADN e actividade metabólica, uma análise molecular jusante dos ácidos nucleicos identificam as espécies e fornece informações sobre as actividades metabólicas. Além disso, a combinação de ADN-SIP e pyrosequencing como aplicado porPilloni, von Netzer, 15 et al., Permite uma identificação simples e sensível em particular da espécie bacteriana presente na 13 fracção pesada de ADN marcada com C. Até agora, esta técnica tem sido aplicada para descrever as comunidades bacterianas envolvidas em processos biogeoquímicos em solo sob aeróbicos e anaeróbicos condições 16,17 18,19. Além do uso em ciências ambientais, a técnica tem sido aplicada em ciências médicas como relatado por Reichardt, et al. 5, que descreveu as atividades metabólicas dos diferentes grupos filogenéticos da microbiota intestinal humana em resposta a um carboidrato digerível. Aqui usamos 13 C-glucose em &quot;rótulo&quot; o ADN das espécies de bactérias metabolicamente activas no intestino. A glicose é um açúcar utilizado pela maioria das espécies bacterianas, ao longo da via generalizada Entner-Doudoroff (ED), embora excepções são conhecidas 20. Estejustifica o uso de 13 C-glicose como uma sonda metabólica confiável que fornece uma ligação entre metabólitos de interesse e a fonte de carbono ao longo de caminhos estabelecidos. Dependendo da causa científica, outros substratos, ou seja, 13 C-metano, 13 CO 2, ou plantas cultivadas sob uma atmosfera de 13 CO 2, podem ser usadas para tratar as actividades metabólicas. Neste ponto, apresentamos o protocolo aplicado na caracterização metabólica da comunidade bacteriana do intestino de um inseto generalista, ou seja, S. littoralis (Lepidoptera, Noctuidae). Além disso, a técnica foi acoplada a pyrosequencing, que por sua vez permite a identificação da comunidade bacteriana do intestino de insectos, com alta resolução e precisão. Como o substrato principal, 13 C-glucose marcada foi utilizado durante os experimentos.

<table border="0" cellpadding="0" cellspacing="0" width="872"> 
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:384px;">Dumont #5 Mirror Finish Forceps</td>
			<td style="width:203px;">Fine Science Tools</td>
			<td style="width:135px;">11251-23</td>
			<td style="width:151px;"> </td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Vannas Spring Scissors</td>
			<td>Fine Science Tools</td>
			<td>15000-00</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Speed Vacuum Concentrator 5301</td>
			<td>Eppendorf Germany</td>
			<td>5305 000.304</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Plastic pestle</td>
			<td>Carl Roth GmbH Co. Germany</td>
			<td>P986.1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">NanoVue spectrophotometer</td>
			<td>GE HealthCare, UK</td>
			<td>28-9569-58</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Mastercycler pro/thermocycler</td>
			<td>Eppendorf Germany</td>
			<td>6321 000.515</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Agagel Standard Horizontal Gel Electrophoresis chamber</td>
			<td>Biometra</td>
			<td>Discontinued</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultracentrifuge (Optima L-90K)</td>
			<td>Beckman</td>
			<td>A20684</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Ultracentrifuge rotor (NVT 90)</td>
			<td>Beckman</td>
			<td>362752</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">HPLC pump</td>
			<td>Agilent</td>
			<td>1100</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Quick-Seal, Polyallomer tube</td>
			<td>Beckman</td>
			<td>342412</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Transilluminator UVstar 15 </td>
			<td>Biometra</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

identification of metabolically active bacteria in the gut of the generalist spodoptera littoralis via dna stable isotope probing using 13c-glucose

Guts da maioria dos insetos são habitadas por comunidades complexas de bactérias não patogênicas simbióticas. Dentro dessas comunidades microbianas é possível identificar comensais ou bactérias mutualistas espécie. Os últimos, têm sido observados para servir várias funções ao inseto, ou seja, ajudar na reprodução de insetos 1, aumentando a resposta imune 2, produção de feromônio 3, bem como a nutrição, incluindo a síntese de aminoácidos essenciais 4, entre outros. Devido à importância dessas associações, foram feitos muitos esforços para caracterizar as comunidades de baixo para os membros individuais. No entanto, a maioria desses esforços foram ou baseados em métodos de cultivo ou contado com a geração de fragmentos de genes 16S rRNA que foram seqüenciados para a identificação final. Infelizmente, estas abordagens apenas identificadas as espécies de bactérias presentes no intestino e, desde que não informatião sobre a actividade metabólica dos microrganismos. Para caracterizar a espécie de bactérias metabolicamente activas no intestino de um insecto, que utilizado isótopo estável sondagem (SIP) in vivo utilizando 13 C-glucose como um substrato universal. Esta é uma técnica de cultura livre de promissor que permite a ligação de Filogenias microbianas para a sua actividade metabólica específica. Isto é possível por rastreamento de isótopos estáveis, marcado átomos de substratos em biomarcadores microbianos, tais como o ADN e ARN 5. A incorporação de 13 C isótopos para DNA aumenta a densidade do ADN marcado em comparação com a não marcado (12 C) uma. No final, o ADN de 13 C-rotulado ou RNA é separado por ultracentrifugação de gradiente de densidade a partir de 12-C sem rótulo semelhante um 6. A análise molecular subsequente dos isotopómeros ácidos nucleicos separados proporciona a ligação entre a actividade metabólica e a identidade das espécies. Aqui, apresentamos o protocolo usado para caracterizar as bactérias metabolicamente ativas no intestino de um inseto generalista (nosso sistema modelo), Spodoptera littoralis (Lepidoptera, Noctuidae). A análise filogenética do DNA foi feito utilizando pyrosequencing, o que permitiu alta resolução e precisão na identificação do intestino do insecto comunidade bacteriana. Como substrato principal, 13 C-glucose marcada foi utilizada nas experiências. O substrato foi alimentado aos insectos por meio de uma dieta artificial.

Para alcançar rotulagem suficiente das bactérias metabolicamente activas presentes no intestino do insecto, o insecto pode ser exposto ao 13 substrato rico em C, durante um período previamente optimizado suficiente para permitir a separação da fracção mais pesada marcado facilmente do não marcado mais leve. No nosso caso, 13 C-glucose foi suplementado na dieta artificial a uma concentração final de 10 mM durante 1 dia (Figura 1A). A mesma quantidade de glicose normal <str...

Watch this Scientific Journal Video about Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose at JoVE.co

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

A comunidade bacteriana activa associada ao intestino de Spodoptera littoralis, foi determinada por-estável-sondagem isótopo (SIP) acoplado a pyrosequencing. Usando essa metodologia, a identificação das espécies de bactérias metabolicamente ativas dentro da comunidade foi feito com alta resolução e precisão.

Identificação de bactérias metabolicamente ativas no intestino do Generalista<em&gt; Spodoptera littoralis</em&gt; Via DNA Isótopos Estáveis ​​Sondagem Usando<sup&gt; 13</sup&gt; C-Glicose

Guts of most insects are inhabited by complex communities of symbiotic nonpathogenic bacteria. Within such microbial communities it is possible to ...

identification-metabolically-active-bacteria-gut-generalist

Research

JoVE Journal

Biology

Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

15.3K visualizações.  Max Planck Institute for Chemical Ecology.  A comunidade bacteriana activa associada ao intestino de Spodoptera littoralis, foi determinada por-estável-sondagem isótopo (SIP) acoplado a pyrosequencing. Usando essa metodologia, a identificação das espécies de bactérias metabolicamente ativas dentro da comunidade foi feito com alta resolução e precisão. 

Vídeo: Identification of Metabolically Active Bacteria in the Gut of the Generalist Spodoptera littoralis via DNA Stable Isotope Probing Using 13C-Glucose

Extracting DNA from the Gut Microbes of the Termite (Zootermopsis Angusticollis) and Visualizing Gut Microbes

Termites are among the few animals known to have the capacity to subsist solely by consuming wood.  The termite gut tract contains a dense and species-rich microbial population that assists in the degradation of lignocellulose predominantly into acetate, the key nutrient fueling termite metabolism (Odelson &amp; Breznak, 1983).  Within these microbial populations are bacteria, methanogenic archaea and, in some ("lower") termites, eukaryotic protozoa. Thus, termites are excellent research subjects for studying the interactions among microbial species and the numerous biochemical functions they perform to the benefit of their host.  The species composition of microbial populations in termite guts as well as key genes involved in various biochemical processes has been explored using molecular techniques (Kudo et al., 1998; Schmit-Wagner et al., 2003; Salmassi &amp; Leadbetter, 2003). These techniques depend on the extraction and purification of high-quality nucleic acids from the termite gut environment.  The extraction technique described in this video is a modified compilation of protocols developed for extraction and purification of nucleic acids from environmental samples (Mor  et al., 1994; Berthelet et al., 1996; Purdy et al., 1996; Salmassi &amp; Leadbetter, 2003; Ottesen et al. 2006) and it produces DNA from termite hindgut material suitable for use as template for polymerase chain reaction (PCR).

Extracting DNA from the Gut Microbes of the Termite Zootermopsis Angusticollis and Visualizing Gut Microbes

This video illustrates the technique for extracting DNA from the species of microbes resident in the termite hindgut. The preparation of a wet mount slide, which is useful for visualizing the gut microbial community is also illustrated, and a tour through the species-rich gut environment is given.

Extração de DNA a partir do Micróbios Gut da térmita (Zootermopsis Angusticollis) e Visualizing micróbios do intestino

Termites are among the few animals known to have the capacity to subsist solely by consuming wood.  The termite gut tract contains a dense and ...

Biologia

DNA Stable-Isotope Probing (DNA-SIP)

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and nutrients into cellular biomass. As such, this cultivation-independent technique has been an important methodology for assigning metabolic function to the diverse communities inhabiting a wide range of terrestrial and aquatic environments. Following the incubation of an environmental sample with stable-isotope labelled compounds, extracted nucleic acid is subjected to density gradient ultracentrifugation and subsequent gradient fractionation to separate nucleic acids of differing densities. Purification of DNA from cesium chloride retrieves labelled and unlabelled DNA for subsequent molecular characterization (e.g. fingerprinting, microarrays, clone libraries, metagenomics). This JoVE video protocol provides visual step-by-step explanations of the protocol for density gradient ultracentrifugation, gradient fractionation and recovery of labelled DNA. The protocol also includes sample SIP data and highlights important tips and cautions that must be considered to ensure a successful DNA-SIP analysis.

DNA Stable-Isotope Probing DNA-SIP

DNA stable-isotope probing is a cultivation-independent method to identify and characterize active communities of microorganisms that are capable of utilizing specific substrates. Assimilation of substrate enriched in heavy isotope leads to incorporation of labelled atoms into microbial biomass. Density gradient ultracentrifugation retrieves labelled DNA for downstream molecular analyses.

DNA-Stable Isotope Probing (DNA-SIP)

DNA stable-isotope probing (DNA-SIP) is a powerful technique for identifying active microorganisms that assimilate particular carbon substrates and ...

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.
Telomerase is a specialized reverse transcriptase1 that adds short DNA repeats, called telomeres, to the 3' end of linear chromosomes2 that serve to protect them from end-to-end fusion and degradation. Following DNA replication, a short segment is lost at the end of the chromosome3 and without telomerase, cells continue dividing until eventually reaching their Hayflick Limit4. Additionally, telomerase is dormant in most somatic cells5 in adults, but is active in cancer cells6 where it promotes cell immortality7.
The minimal telomerase enzyme consists of two core components: the protein subunit (TERT), which comprises the catalytic subunit of the enzyme and an integral RNA component (TER), which contains the template TERT uses to synthesize telomeres8,9. Prior to 2008, only structures for individual telomerase domains had been solved10,11. A major breakthrough in this field came from the determination of the crystal structure of the active12, catalytic subunit of T. castaneum telomerase, TcTERT1.
Here, we present methods for producing large quantities of the active, soluble TcTERT for structural and biochemical studies, and the reconstitution of the telomerase RNP complex in vitro for telomerase activity assays. An overview of the experimental methods used is shown in Figure 1.

In vitro Reconstitution of the Active T. castaneum Telomerase

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more than a decade. Here, we present methods for the isolation of the recombinant Tribolium castaneum TERT (TcTERT) and the reconstitution of the active T. castaneum telomerase ribonucleoprotein (RNP) complex in vitro.

Na reconstituição in vitro da atividade T. Telomerase castaneum

Efforts to isolate the catalytic subunit of telomerase, TERT, in sufficient quantities for structural studies, have been met with limited success for more ...

Visualization of DNA Replication in the Vertebrate Model System DT40 using the DNA Fiber Technique

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not only ensure faithful genome duplication in the face of endogenous and exogenous DNA damage but also prevent genomic instability, a recognized causative factor in tumor development.
Here, we describe a simple and cost-effective fluorescence microscopy-based method to visualize DNA replication in the avian B-cell line DT40. This cell line provides a powerful tool to investigate protein function in vivo by reverse genetics in vertebrate cells1. DNA fiber fluorography in DT40 cells lacking a specific gene allows one to elucidate the function of this gene product in DNA replication and genome stability. Traditional methods to analyze replication fork dynamics in vertebrate cells rely on measuring the overall rate of DNA synthesis in a population of pulse-labeled cells. This is a quantitative approach and does not allow for qualitative analysis of parameters that influence DNA synthesis. In contrast, the rate of movement of active forks can be followed directly when using the DNA fiber technique2-4. In this approach, nascent DNA is labeled in vivo by incorporation of halogenated nucleotides (Fig 1A). Subsequently, individual fibers are stretched onto a microscope slide, and the labeled DNA replication tracts are stained with specific antibodies and visualized by fluorescence microscopy (Fig 1B). Initiation of replication as well as fork directionality is determined by the consecutive use of two differently modified analogues. Furthermore, the dual-labeling approach allows for quantitative analysis of parameters that influence DNA synthesis during the S-phase, i.e. replication structures such as ongoing and stalled forks, replication origin density as well as fork terminations. Finally, the experimental procedure can be accomplished within a day, and requires only general laboratory equipment and a fluorescence microscope.

DT40, a model vertebrate genetic system, provides a powerful tool to analyze protein function. Here we describe a simple method that allows qualitative analysis of parameters that influence DNA synthesis during the S-phase in DT40 cells at the single molecule level.

Visualização de replicação de DNA no DT40 Vertebrados Modelo de Sistema utilizando a técnica de DNA Fibra

Maintenance of replication fork stability is of utmost importance for dividing cells to preserve viability and prevent disease. The processes involved not ...

Robust 3D DNA FISH Using Directly Labeled Probes

3D DNA FISH has become a major tool for analyzing three-dimensional organization of the nucleus, and several variations of the technique have been published. In this article we describe a protocol which has been optimized for robustness, reproducibility, and ease of use. Brightly fluorescent directly labeled probes are generated by nick-translation with amino-allyldUTP followed by chemical coupling of the dye. 3D DNA FISH is performed using a freeze-thaw step for cell permeabilization and a heating step for simultaneous denaturation of probe and nuclear DNA. The protocol is applicable to a range of cell types and a variety of probes (BACs, plasmids, fosmids, or Whole Chromosome Paints) and allows for high-throughput automated imaging. With this method we routinely investigate nuclear localization of up to three chromosomal regions.

We describe a robust and versatile protocol for analyzing nuclear architecture by 3D DNA FISH using directly labeled fluorescent probes.

Robust FISH DNA 3D utilizando sondas Diretamente rotuladas

3D DNA FISH has become a major tool for  analyzing three-dimensional organization of the nucleus, and several variations  of the technique have been ...

Identification of Post-translational Modifications of Plant Protein Complexes

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to infection via the recruitment and activation of immune complexes. Activation of immune complexes is associated with post-translational modifications (PTMs) of proteins, such as phosphorylation, glycosylation, or ubiquitination. Understanding how these PTMs are choreographed will lead to a better understanding of how resistance is achieved.
Here we describe a protein purification method for nucleotide-binding leucine-rich repeat (NB-LRR)-interacting proteins and the subsequent identification of their post-translational modifications (PTMs). With small modifications, the protocol can be applied for the purification of other plant protein complexes. The method is based on the expression of an epitope-tagged version of the protein of interest, which is subsequently partially purified by immunoprecipitation and subjected to mass spectrometry for identification of interacting proteins and PTMs.
This protocol demonstrates that: i). Dynamic changes in PTMs such as phosphorylation can be detected by mass spectrometry; ii). It is important to have sufficient quantities of the protein of interest, and this can compensate for the lack of purity of the immunoprecipitate; iii). In order to detect PTMs of a protein of interest, this protein has to be immunoprecipitated to get a sufficient quantity of protein.

We describe here a protocol for the purification and characterization of plant protein complexes. We demonstrate that by immunoprecipitating a single protein within a complex, so we can identify its post-translational modifications and its interacting partners.

Identificação de modificações pós-translacionais de Complexos de proteína vegetal

Plants adapt quickly to changing environments due to elaborate perception and signaling systems. During pathogen attack, plants rapidly respond to ...

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and silencing of genes mediate the response of plants to environmental signals and developmental cues. Therefore, insights into the mechanisms that control plant gene expression are essential to gain a deep understanding of how biological processes are regulated in plants. The chromatin immunoprecipitation (ChIP) technique described here is a procedure to identify the DNA-binding sites of proteins in genes or genomic regions of the model species Arabidopsis thaliana. The interactions with DNA of proteins of interest such as transcription factors, chromatin proteins or posttranslationally modified versions of histones can be efficiently analyzed with the ChIP protocol. This method is based on the fixation of protein-DNA interactions in vivo, random fragmentation of chromatin, immunoprecipitation of protein-DNA complexes with specific antibodies, and quantification of the DNA associated with the protein of interest by PCR techniques. The use of this methodology in Arabidopsis has contributed significantly to unveil transcriptional regulatory mechanisms that control a variety of plant biological processes. This approach allowed the identification of the binding sites of the Arabidopsis chromatin protein EBS to regulatory regions of the master gene of flowering FT. The impact of this protein in the accumulation of particular histone marks in the genomic region of FT was also revealed through ChIP analysis.

Chromatin Immunoprecipitation Assay for the Identification of Arabidopsis Protein-DNA Interactions In Vivo

Chromatin immunoprecipitation is a powerful technique for the identification of DNA binding sites of Arabidopsis proteins in vivo. This procedure includes chromatin cross-linking and fragmentation, immunoprecipitation with selective antibodies against the protein of interest, and qPCR analysis of bound DNA. We describe a simple ChIP assay optimized for Arabidopsis plants.

Ensaio para imunoprecipitação da cromatina a identificação de Arabidopsis interações proteína-ADN<em&gt; In Vivo</em

Intricate gene regulatory networks orchestrate biological processes and developmental transitions in plants. Selective transcriptional activation and ...

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Amplificação, sequenciamento de próxima geração, e Genomic DNA Mapeamento das retrovirais Integração Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

Isolamento de filtração de Ácidos Nucleicos: Um Método de extracção de DNA simples e rápido

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

Emergent properties and external factors (population-level and ecosystem-level interactions, in particular) play important roles in mediating ecologically-important endpoints, though they are rarely considered in toxicological studies. D. melanogaster is emerging as a toxicology model for the behavioral, neurological, and genetic impacts of toxicants, to name a few. More importantly, species in the genus Drosophila can be utilized as a model system for an integrative framework approach to incorporate emergent properties and answer ecologically-relevant questions in&#160;toxicology research. The aim of this paper is to provide a protocol for exposing species in the genus Drosophila to pollutants to be used as a model system for a range of phenotypic outputs and ecologically-relevant questions. More specifically, this protocol can be used to 1) link multiple biological levels of organization and understand the impact of toxicants on both individual- and population-level fitness; 2) test the impact of toxicants at different stages of developmental exposure; 3) test multigenerational and evolutionary implications of pollutants; and 4) test multiple contaminants and stressors simultaneously.

Experimental Protocol for Using Drosophila As an Invertebrate Model System for Toxicity Testing in the Laboratory

In this paper, we provide a detailed protocol for exposing species in the genus Drosophila to pollutants with the goal of studying the impact of exposure on a range of phenotypic outputs at different developmental stages and for more than one generation.