Nós gostaríamos de agradecer a Elizabeth Byrne, David Gootenberg, e Christina Gosmann para feedback crítico sobre o protocolo; Megan Baldridge, Scott Handley, Cindy Monaco, e Jason Norman para orientação preparação de amostras e demonstrações; Wendy Garrett, Curtis Huttenhower, Skip Virgin, e Bruce Walker para o conselho de protocolo e discussões frutíferas; e Jessica Hoisington-Lopez para seqüenciamento apoio. Este trabalho foi financiado pela Fundação Bill e Melinda Gates e o NIAID (1R01AI111918). DSK recebeu apoio adicional do Fundo Burroughs Wellcome. MNA foi apoiado pelo número prêmio T32GM007753 do NIGMS, eo Paul e Daisy Soros Fellowship. O conteúdo é da exclusiva responsabilidade dos autores e não representam necessariamente as opiniões oficiais da NIGMS ou do NIH.

<ol>
	<li>Huttenhower, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structure,+function+and+diversity+of+the+healthy+human+microbiome.">Structure, function and diversity of the healthy human microbiome.</a> Nature. 486, 207-214 (2012).</li><li>O'Hanlon, D. E., Moench, T. R., Cone, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaginal+pH+and+microbicidal+lactic+acid+when+lactobacilli+dominate+the+microbiota.">Vaginal pH and microbicidal lactic acid when lactobacilli dominate the microbiota.</a> PloS one. 8, e80074 (2013).</li><li>Aldunate, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaginal+concentrations+of+lactic+acid+potently+inactivate+HIV.">Vaginal concentrations of lactic acid potently inactivate HIV.</a> The Journal of antimicrobial chemotherapy. 68, 2015-2025 (2013).</li><li>Anahtar, M. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cervicovaginal+bacteria+are+a+major+modulator+of+host+inflammatory+responses+in+the+female+genital+tract.">Cervicovaginal bacteria are a major modulator of host inflammatory responses in the female genital tract.</a> Immunity. 42, 965-976 (2015).</li><li>Reyes, A., Wu, M., McNulty, N. P., Rohwer, F. L., Gordon, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gnotobiotic+mouse+model+of+phage-bacterial+host+dynamics+in+the+human+gut.">Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut.</a> Proceedings of the National Academy of Sciences of the United States of America. 110, 20236-20241 (2013).</li><li>Chomczynski, P., Sacchi, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-step+method+of+RNA+isolation+by+acid+guanidinium+thiocyanate-phenol-chloroform+extraction.">Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.</a> Analytical biochemistry. 162, 156-159 (1987).</li><li>Srinivasan, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+variability+of+human+vaginal+bacteria+and+relationship+with+bacterial+vaginosis.">Temporal variability of human vaginal bacteria and relationship with bacterial vaginosis.</a> PloS one. 5, e10197 (2010).</li><li>Dols, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microarray-based+identification+of+clinically+relevant+vaginal+bacteria+in+relation+to+bacterial+vaginosis.">Microarray-based identification of clinically relevant vaginal bacteria in relation to bacterial vaginosis.</a> American journal of obstetrics and gynecology. 204, 301-307 (2011).</li><li>Segata, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenomic+microbial+community+profiling+using+unique+clade-specific+marker+genes.">Metagenomic microbial community profiling using unique clade-specific marker genes.</a> Nature methods. 9, 811-814 (2012).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultra-high-throughput+microbial+community+analysis+on+the+Illumina+HiSeq+and+MiSeq+platforms.">Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms.</a> The ISME journal. 6, 1621-1624 (2012).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+patterns+of+16S+rRNA+diversity+at+a+depth+of+millions+of+sequences+per+sample.">Global patterns of 16S rRNA diversity at a depth of millions of sequences per sample.</a> Proceedings of the National Academy of Sciences of the United States of America. 108, 4516-4522 (2011).</li><li>Ravel, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vaginal+microbiome+of+reproductive-age+women.">Vaginal microbiome of reproductive-age women.</a> Proceedings of the National Academy of Sciences of the United States of America. 108, 4680-4687 (2011).</li><li>Srinivasan, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+communities+in+women+with+bacterial+vaginosis:+high+resolution+phylogenetic+analyses+reveal+relationships+of+microbiota+to+clinical+criteria.">Bacterial communities in women with bacterial vaginosis: high resolution phylogenetic analyses reveal relationships of microbiota to clinical criteria.</a> PloS one. 7, e37818 (2012).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=QIIME+allows+analysis+of+high-throughput+community+sequencing+data.">QIIME allows analysis of high-throughput community sequencing data.</a> Nature methods. 7, 335-336 (2010).</li><li>Schloss, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Introducing+mothur:+open-source,+platform-independent,+community-supported+software+for+describing+and+comparing+microbial+communities.">Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities.</a> Applied and environmental microbiology. 75, 7537-7541 (2009).</li><li>Edgar, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=UPARSE:+highly+accurate+OTU+sequences+from+microbial+amplicon+reads.">UPARSE: highly accurate OTU sequences from microbial amplicon reads.</a> Nature. 10, 996-998 (2013).</li><li>AllPrep DNA/RNA Mini Kit. Qiagen Available from: <a target="_blank" href="https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/">https://http://www.qiagen.com/us/shop/sample-technologies/rna-sample-technologies/dna-rna-protein/allprep-dnarna-mini-kit/</a> (2015)</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> Journal of visualized experiments. , (2012).</li><li>Quant-iT PicoGreen dsDNA Reagent. Invitrogen Available from: <a target="_blank" href="https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf">https://tools.thermofisher.com/content/sfs/manuals/mp07581.pdf</a> (2008)</li><li>DeSantis, T. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Greengenes,+a+chimera-checked+16S+rRNA+gene+database+and+workbench+compatible+with+ARB.">Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB.</a> Applied and environmental microbiology. 72, 5069-5072 (2006).</li><li>Vazquez-Baeza, Y., Pirrung, M., Gonzalez, A., Knight, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EMPeror:+a+tool+for+visualizing+high-throughput+microbial+community+data.">EMPeror: a tool for visualizing high-throughput microbial community data.</a> GigaScience. 2, 16 (2013).</li><li>Eren, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+diversity+of+Gardnerella+vaginalis+in+the+genitourinary+tract+microbiota+of+monogamous+couples+through+subtle+nucleotide+variation.">Exploring the diversity of Gardnerella vaginalis in the genitourinary tract microbiota of monogamous couples through subtle nucleotide variation.</a> PloS one. 6, e26732 (2011).</li><li>Langille, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Predictive+functional+profiling+of+microbial+communities+using+16S+rRNA+marker+gene+sequences.">Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences.</a> Nature biotechnology. 31, 814-821 (2013).</li></ol>

The authors have nothing to disclose.

Aqui nós descrevemos um protocolo para a identificação e caracterização de abundâncias bacterianas relativo dentro de um esfregaço vaginal humana. Este protocolo pode ser facilmente adaptado para outros tipos de amostras, tais como fezes e suabes de outros locais do corpo, e para amostras coletadas a partir de uma ampla variedade de fontes. A extracção de ácido nucleico de cordão-batendo numa solução tamponada de fenol e clorofórmio permite o isolamento de ambos o ADN e ARN, que é particularmente importante quando se trabalha com amostras preciosas recolhidos por meio de estudos clínicos. O DNA bacteriano isolado é excelente para a identificação taxonômica bacteriana e montagem genômica, enquanto a recolha simultânea de RNA fornece a oportunidade de determinar bacteriana funcional, anfitrião, e as contribuições virais através de RNA-seq. O protocolo descrito utiliza um conjunto validado de uma etapa de primer que foi implantado com sucesso em uma ampla gama de tipos de amostras, incluindo humano, canino, e amostras ambientais 10 </sup&gt;. A disponibilidade de milhares de primers com código de barras permite multiplexação das amostras e uma enorme poupança nos custos de seqüenciamento. O custo total (incluindo todos os reagentes, uma única corrida de seqüenciamento e primers, mas não equipamentos) é de cerca de US $ 20 por amostra quando 200 amostras são multiplexados. Além disso, não é muito elevada reprodutibilidade quando vários cotonetes a partir do mesmo local de amostra são processados ​​independentemente ao longo de todo o oleoduto. No geral, o protocolo é custo eficiente, flexível, confiável e repetível. A parte de extração de ácidos nucléicos deste protocolo é limitado pelas precauções de segurança necessárias quando se trabalha com fenol e clorofórmio, e os desafios da automatização do gasoduto para uma alta taxa de transferência, formato de placa de 96 poços. Adicionalmente, o batimento vigorosa grânulo usado para as tesouras lise mecânica do ADN bacteriano de cerca de 6 fragmentos de quilobases; se fragmentos de ADN mais longos são necessários para aplicações a jusante, a duração do talão batendo should ser encurtado. As limitações da porção de identificação bacteriana deste protocolo são inerentes a qualquer método que se baseia em seqüenciamento do gene 16S rRNA. 16S rRNA seqüenciamento é ideais para a identificação de bactérias para o nível de género e até mesmo espécies, mas raramente fornece a identificação do nível de tensão. Enquanto a região variável da V4 do gene 16S rRNA proporciona a discriminação entre a maioria das robusta 11 espécies bacterianas, métodos computacionais adicionais, tais como Oligotyping 31 pode precisar de ser usada para identificar com precisão certas espécies, tais como Lactobacillus crispatus. Finalmente, a informação sobre as capacidades funcionais bacterianos precisa dentro de uma determinada amostra não pode ser determinada por sequenciação de 16S rRNA gene sozinho, embora este protocolo permite a extracção do DNA do genoma e ARN que podem ser usadas para esta finalidade. O passo mais fundamental para garantir o sucesso com este protocolo está tomando grande cuidado para evitar contaminação during de recolha de amostras, a extracção de ácido nucleico, e a amplificação por PCR. Assegurar a esterilidade no momento da coleta da amostra através do uso de luvas limpas e usar compressas estéreis, tubos e tesoura. Para avaliar se há contaminação dos materiais de coleta, coletar swabs de controlo negativo, colocando compressas não utilizadas adicionais diretamente em tubos de transporte no momento da amostragem. No laboratório, executar todas as etapas de pré-amplificação em uma capa esterilizado contendo suprimentos única descontaminadas e usando apenas a nota molecular, reagentes isentos de ADN. Durante a extração de ácido nucleico, evitar a contaminação cruzada, usando novas pinças esterilizadas e luvas frescas com cada amostra, e mantendo todos os tubos fechados a menos em uso. Processamento swabs não utilizados em paralelo garante a esterilidade tanto da coleta de amostras e extração de ácido nucleico; os cotonetes não utilizados não devem produzir um pelete após precipitação isopropanol e lavagem de etanol. Se um pellet for exibido, execute a amplificação do gene 16S rRNA para determinar uma possível fonte dea contaminação (por exemplo, a presença de Streptococcus ou Staphylococcus iria indicar a contaminação da pele). Além disso, efectuar as amplificações de PCR de controlo sem reacções modelo em paralelo para assegurar que os reagentes e as reacções de PCR não ter sido contaminadas. Se aparecer uma faixa em um controle nenhum modelo, descarte os reagentes e repetir a amplificação com reagentes frescos. Tomando essas precauções irá garantir sequenciamento sucesso das bactérias de interesse. O passo de amplificação por PCR tende a necessitar de mais solução de problemas. Amplificando em conjuntos de doze exemplos proporciona um equilíbrio entre eficiência e consistência. A completa ausência de bandas em todas as amostras de um dado conjunto de amplificação indica uma falha sistemática, por exemplo, esquecendo-se adicionar um reagente ou incorrectamente programação do termociclador. A ausência de uma banda de algumas amostras é geralmente devido a erro humano, e as amplificações deve ser re-run com o mesmo emparelhamento de amostra e iniciador inverso. No caso da ausência de uma banda contínua, a amostra pode ser re-amplificada utilizando um iniciador reverso com um código de barras diferente. falhas repetidos de amplificação com múltiplos iniciadores inversos podem indicar um inibidor presente na amostra. Nesse caso, a limpeza do ADN com uma coluna, muitas vezes, remover inibidores sem alterar significativamente as abundâncias relativas bacterianas. Se várias bandas resultar após a amplificação, re-amplificar a amostra com um código de barras iniciador inverso diferente. Além de evitar a contaminação do ambiente e assegurar a amplificação de um único produto específico, a sequenciação de sucesso depende de cuidado quando se prepara a biblioteca piscina. O objectivo é combinar quantidades equimolares de fragmentos amplificados de cada amostra para assegurar aproximadamente o mesmo número de sequenciação leituras por amostra. Se as concentrações de ácido nucleico antes da amplificação são comparáveis, a simples adição de volumes iguais de cada saamplicons de mple é suficiente ao criar o pool de biblioteca. No entanto, se as concentrações de ácido nucleico são muito diferentes e adicionado em volume igual, a amostra com a baixa concentração de ácido nucleico irá estar mal representados com um número baixo de leituras. Nesta caso, é possível adicionar um volume maior de produtos de amplificação a partir da baixa concentração de amostra com base na intensidade relativa de a banda de gel. Em alternativa, é possível remover mais rigorosamente iniciadores a partir dos fragmentos amplificados individuais, quantificar a concentração amplicão de amostra individual, utilizando um kit de ADNcd quantificação fluorométrico, e precisamente combinam-se quantidades equimolares de cada amostra. Uma vez que uma piscina amplicon bem equilibrada é gerado, ele torna-se crítica para medir cuidadosamente a concentração da piscina. diluição cuidadosa subseqüente e spike-in com phix para aumentar a complexidade de leitura é fundamental para alcançar os melhores resultados de sequenciamento. sequenciadores de alto rendimento que usam sequencing por síntese são muito sensíveis à densidade do aglomerado na célula de fluxo. Carregando uma piscina biblioteca que é muito concentrada resultará em Overclustering, com menor pontuação de qualidade, saída de dados mais baixa, e demultiplexing imprecisa 32. Carregando um pool da biblioteca que é demasiado diluída também vai resultar na saída de dados de baixo. Cuidadosamente quantificar a piscina biblioteca antes da sequenciação irá garantir os melhores resultados. Seqüência do gene 16rRNA fornece uma avaliação abrangente das bactérias presentes dentro de uma dada amostra e é um primeiro passo absolutamente crítico na geração de hipóteses. A presença de um rico conjunto de metadados ainda permite que o pesquisador para testar associações entre espécies bacterianas específicas e fatores biológicos importantes. Além disso, a mesma informação 16S pode ser usada para inferir as funções bacterianas utilizando com ferramentas tais como PICRUSt 33. O objetivo final é usar 16S caracterização para identificar novos associações que podem serainda mais testado e validado em sistemas modelo, acrescentando à nossa crescente compreensão do impacto do microbioma bacteriana sobre a saúde humana e doenças.

O ser humano inferior trato reprodutivo, sistema gastrointestinal, trato respiratório e da pele são colonizados por comunidades bacterianas complexas que são fundamentais para a manutenção da homeostase do tecido e apoiar a saúde do hospedeiro 1. Por exemplo, certa lactobacilos criar um ambiente inóspito para patógenos por acidificação da cúpula vaginal, produzindo efetores antimicrobianos e modulação da imunidade host local 2-4. A apreciação crescente para a importância do microbioma bacteriana também tem aumentado o interesse na caracterização de comunidades bacterianas em muitos contextos clínicos. Aqui nós descrevemos um método para determinar a composição do microbioma bacteriano a partir de esfregaços genitais. O protocolo pode ser facilmente modificado para amostras de fezes e suabes coletados de outras localizações anatômicas e outras espécies hospedeiras. Devido às limitações inerentes ao número de amostras que podem ser recolhidos e armazenados a partir de um determinado pernoY participante, este protocolo foi concebido para extrair o ADN, ARN, e potencialmente ainda proteína a partir de uma única mecha com um fenol-clorofórmio com esferas batendo-5,6 método adaptado. A combinação de ruptura física das paredes das células bacterianas com talão-batimento e perturbações química com detergentes permite rápida de lise de bactérias Gram-positivas, Gram-negativas, e ácido-resistentes, sem etapas adicionais de digestão enzimática. Para obter o RNA de alta qualidade, é recomendado o uso de compressas secas que foram mantidas a ou abaixo de 4 ° C imediatamente após a colheita e durante o transporte para o laboratório (se aplicável), e armazenada a longo prazo a -80 ° C. Para determinar o microbioma bacteriana dentro de uma dada amostra, este procedimento utiliza 16S rRNA sequenciamento amplicon gene, que é atualmente o meio mais rentáveis ​​para atribuir de forma abrangente taxonomia bacteriana e realizar quantificação relativa. Os métodos alternativos incluem alvo qPCR 7, microarr personalizadoays 8, e de todo o sequenciamento do genoma 9. O gene 16S rRNA contém nove regiões hipervariáveis, e não há consenso sobre a região V ideal para sequenciar para estudos microbioma vaginais. Aqui usamos o conjunto de primers 515F / 806R e construir sobre o gasoduto projetado pelo Caporaso et al. 10-12. Caporaso et al &#39;s. 515F / 806R conjunto de iniciadores permite a multiplexação de centenas de amostras em uma única sequenciamento de execução devido à disponibilidade de milhares de primers barcoded validados e compatibilidade com plataformas de sequenciamento Illumina. Ao contrário de 27F / 338R cartilha do Projeto Microbioma Humano ajuste 13, 515F / 806R também amplifica efetivamente Bifidobacteriaceae e capta com precisão, assim, Gardnerella vaginalis, um membro importante da comunidade microbiana vaginal em algumas mulheres. Em alternativa, um par de iniciadores de 338F / 806R tem sido utilizado com sucesso para pyrosequencing de amostras vaginais 14 e um par de iniciadores de 515F / 926R tem recently se tornam disponíveis para a próxima geração de sequenciamento 12. Finalmente, este protocolo fornece instruções básicas para realizar 16S análise amplicon utilizando os Insights quantitativos em Ecologia Microbiana (QIIME) Pacote de software 15. A implementação bem sucedida dos comandos QIIME descritos aqui gera uma tabela contendo abundâncias taxonômicos de bactérias para cada amostra. Muitos passos adicionais de controlo de qualidade, os métodos de classificação taxonómica, e passos de análise podem ser incorporadas na análise, tal como descrito em detalhe no site da QIIME (http://qiime.org/index.html). Se a análise será realizada em um computador Apple, o pacote MacQIIME 16 oferece fácil instalação de QIIME e suas dependências. Pacotes de software alternativos para análise de sequência do gene 16S rRNA incluem Mothur 17 e UPARSE 18.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Equipment:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Mini-Beadbeater-16</td>
			<td>BioSpec</td>
			<td>607</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR workstation</td>
			<td></td>
			<td></td>
			<td>Any PCR hood can be used, e.g., the AirClean 600.</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td></td>
			<td></td>
			<td>Any thermal cycler with a heated lid can be used, e.g., MJ Research PTC-200.</td>
		</tr>
		<tr>
			<td>Electrophoresis system</td>
			<td></td>
			<td></td>
			<td>Any electrophoresis system can be used, e.g. the Thermo Scientific Owl EasyCast B1 Mini Gel Electrophoresis system.</td>
		</tr>
		<tr>
			<td>Nanodrop</td>
			<td>Thermo Scientific</td>
			<td>2000C</td>
			<td>Any other DNA quantification method will be sufficient</td>
		</tr>
		<tr>
			<td>Bioanalyzer</td>
			<td>Agilent</td>
			<td>2100</td>
			<td>An alternative is the Agilent 2200 TapeStation Instrument. Not absolutely necessary but very helpful.</td>
		</tr>
		<tr>
			<td>MiSeq or HiSeq</td>
			<td>Illumina</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Materials:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Catch-All Sample Collection swab</td>
			<td>Epibio</td>
			<td>QEC89100</td>
			<td>Other swabs can be used but the Catch-All swab is recommended by the Human Microbiome Project.&#160;</td>
		</tr>
		<tr>
			<td>ELIMINase</td>
			<td>Fisher</td>
			<td>04-355-31</td>
			<td></td>
		</tr>
		<tr>
			<td>SteriFlip 50 mL filtration device (0.22 &#181;m)</td>
			<td>EMD Millipore</td>
			<td>SCGP00525</td>
			<td></td>
		</tr>
		<tr>
			<td>0.1 mm glass beads</td>
			<td>BioSpec</td>
			<td>11079101</td>
			<td></td>
		</tr>
		<tr>
			<td>2 mL screw-cap tubes</td>
			<td>Sarstedt</td>
			<td>72.694.006</td>
			<td>For bead beating</td>
		</tr>
		<tr>
			<td>UltraPure 5M NaCl</td>
			<td>Life Technologies</td>
			<td>24740-011</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr>
			<td>1 M Tris-HCl</td>
			<td>Ambion (Invitrogen)</td>
			<td>AM9856</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr>
			<td>0.5 M EDTA</td>
			<td>Ambion (Invitrogen)</td>
			<td>AM9260G</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr>
			<td>Sodium Dodecyl Sulfate, 20% Solution</td>
			<td>Fisher</td>
			<td>BP1311-200</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr>
			<td>UltraPure DNase/RNase-free distilled water</td>
			<td>Ambion</td>
			<td>10977-015</td>
			<td>Molecular Biology Grade, for buffer preparation</td>
		</tr>
		<tr>
			<td>2-Propanol BioReagent, for molecular biology, &#8805;99.5%</td>
			<td>Sigma</td>
			<td>I9516-500ML</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr>
			<td>Phenol:Chloroform:IAA, 25:24:1</td>
			<td>Invitrogen</td>
			<td>AM9730</td>
			<td>Warning: Toxic</td>
		</tr>
		<tr>
			<td>3 M Sodium Acetate, pH 5.5</td>
			<td>Life Technologies</td>
			<td>AM9740</td>
			<td>Molecular Biology Grade</td>
		</tr>
		<tr>
			<td>Disposable sterile polystyrene forceps, PS</td>
			<td>Cole Parmer</td>
			<td>EW-06443-20</td>
			<td></td>
		</tr>
		<tr>
			<td>1.5 mL, clear, PCR clean tubes</td>
			<td>Eppendorf</td>
			<td>22364120</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR grade water</td>
			<td>MoBio</td>
			<td>17000-11</td>
			<td>For PCR</td>
		</tr>
		<tr>
			<td>Phusion High-Fidelity DNA Polymerase</td>
			<td>New England Biolabs</td>
			<td>M0530S</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTP mix</td>
			<td>Sigma</td>
			<td>D7295-0.5mL</td>
			<td></td>
		</tr>
		<tr>
			<td>0.2 ml PCR 8-tube with attached clear flat caps, natural</td>
			<td>USA Scientific</td>
			<td>1492-3900</td>
			<td>Any 8-tube strips that are DNase, RNase, DNA, and PCR inhibitor free will work</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>BioExpress</td>
			<td>E-3121-25</td>
			<td></td>
		</tr>
		<tr>
			<td>50X TAE buffer</td>
			<td>Lonza</td>
			<td>51216</td>
			<td></td>
		</tr>
		<tr>
			<td>DNA gel stain</td>
			<td>Invitrogen</td>
			<td>S33102</td>
			<td></td>
		</tr>
		<tr>
			<td>6X DNA Loading Dye</td>
			<td>Thermo (Fisher)</td>
			<td>R0611</td>
			<td></td>
		</tr>
		<tr>
			<td>50bp GeneRuler Ladder</td>
			<td>Thermo (Fisher)</td>
			<td>SM0373</td>
			<td></td>
		</tr>
		<tr>
			<td>AllPrep DNA/RNA kit</td>
			<td>Qiagen</td>
			<td>80284</td>
			<td></td>
		</tr>
		<tr>
			<td>UltraClean PCR Clean-up Kit</td>
			<td>MoBio</td>
			<td>12500-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Quant-iT PicoGreen dsDNA Assay Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>P11496</td>
			<td>An alternative is Qubit Fluorometric Quantification (Life Technologies)</td>
		</tr>
		<tr>
			<td>Name</td>
			<td>Company</td>
			<td>Catalog Number</td>
			<td>Comments</td>
		</tr>
		<tr>
			<td>Primers:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>515F (forward primer) 5&#39;-AATGATACGGCGACCACCGAG 
			ATCTACACTATGGTAATTGT 
			GTGCCAGCMGCCGCGGTAA-3&#39;</td>
			<td></td>
			<td></td>
			<td>Order at 100 nmole; Purification: Standard Desalting. Resuspend at 100 &#181;M. **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**</td>
		</tr>
		<tr>
			<td>Reverse primers, see the Supplemental Code File and: ftp://ftp.metagenomics.anl.gov/data/misc/EMP/SupplementaryFile1_barcoded 
			_primers_515F_806R.txt</td>
			<td>IDT is recommended</td>
			<td></td>
			<td>If ordering large sets of primers, order as a 96-well plate at the 100 nmole scale. Resuspend at 100 &#956;M. Full directions for primer ordering and resuspension at http://www.earthmicrobiome.org/files/2013/04/EMP_primer_ordering_and 
			_resuspension.doc.&#160; **Critical: primers must be resuspended with MoBio PCR Grade Water (see above) in a hood to avoid contamination.**</td>
		</tr>
		<tr>
			<td>Read 1 Sequencing Primer 5&#39;-TAT GGT AAT TGT GTG CCA GCM GCC GCG GTA A-3&#39;</td>
			<td></td>
			<td></td>
			<td>25 nmole; Purification: Standard Desalting. Resuspend at 100 &#181;M.</td>
		</tr>
		<tr>
			<td>Read 2 Sequencing Primer 5&#39;-AGT CAG TCA GCC GGA CTA CHV GGG TWT CTA AT-3&#39;</td>
			<td></td>
			<td></td>
			<td>26 nmole; Purification: Standard Desalting. Resuspend at 100 &#181;M.</td>
		</tr>
		<tr>
			<td>Index Sequencing Primer 5&#39;-ATT AGA WAC CCB DGT AGT CCG GCT GAC TGA CT-3&#39;</td>
			<td></td>
			<td></td>
			<td>27 nmole; Purification: Standard Desalting. Resuspend at 100 &#181;M.</td>
		</tr>
		<tr>
			<td>PhiX Control v3</td>
			<td>Illumina</td>
			<td>FC-110-3001</td>
			<td>Required if performing the sequencing in-house. If the sequencing will be performed by a third-party sequencing center, they will already have PhiX.</td>
		</tr>
	</tbody>
</table>

efficient nucleic acid extraction and 16s rrna gene sequencing for bacterial community characterization

Existe uma crescente valorização para o papel das comunidades microbianas como moduladores críticos da saúde humana e doenças. tecnologias de sequenciação de alto rendimento têm permitido a caracterização rápida e eficiente de comunidades bacterianas usando rRNA 16S de sequenciação de genes a partir de uma variedade de fontes. Embora ferramentas prontamente disponíveis para seqüenciamento do gene 16S rRNA têm fluxos de trabalho computacionais padronizadas, processamento de amostras para extração de DNA continua a ser uma fonte contínua de variabilidade entre os estudos. Aqui nós descrevemos um método eficiente, robusto e rentável para extrair ácidos nucleicos a partir de esfregaços. Também delinear métodos jusante para sequenciamento de genes 16S rRNA, incluindo a geração de bibliotecas de sequenciamento, controle de qualidade de dados e análise de sequência. O fluxo de trabalho pode acomodar vários tipos de amostras, incluindo fezes e suabes coletados a partir de uma variedade de locais anatômicos e espécies hospedeiras. Além disso, recuperou ADN e ARN podem ser separados e utilizadospara outras aplicações, incluindo a sequenciação do genoma total ou RNA-seq. O método descrito permite uma abordagem processamento comum para vários tipos de amostras e acomoda análise a jusante da informação genómica, metagenômica e transcrição.

<html> A visão geral do protocolo, que permite a determinação da abundância de bactérias relativas de uma mecha usando 16S rRNA seqüenciamento de genes, é mostrado na Figura protocolo 1 .O foi optimizada para secreção vaginal humanos, mas pode ser facilmente adaptado para a maioria dos locais de amostragem da mucosa e outros hospedeiros. a Figura 2 demonstra o ADN de alta qualidade e ARN que pode ser isolado utilizando o protocolo de talão-batimento. a Figura 3 ilustra uma amplificação por PCR bem sucedida de 12 amostras, onde cada amplificação com uma amostra produziu uma única banda forte da correcta tamanho e cada controle de água não deu uma banda. a Figura 4 ilustra a quantificação do conjunto final da biblioteca antes da sequenciação. a Figura 5 mostra um perfil típico de qualidade sequência após uma única ponta 300 pb MiSeq prazo. &quot;Src =&quot; / files / ftp_upload / 53939 / 53939fig1.jpg &quot;/&gt; A Figura 1. Visão geral esquemática do protocolo. Em primeiro lugar, o ácido nucleico que é extraída a partir de uma zaragatoa por grânulo-batendo numa solução tamponada que contém fenol, clorofórmio, ea álcool isoamílico. região variável 4 do gene de ARNr 16S é então amplificado a partir do ácido nucleico utilizando PCR resultante. amplicons de PCR de até centenas de amostras são então combinados sequenciado e em uma única corrida. As sequências resultantes são comparadas com uma base de dados de referência para determinar abundâncias bacterianas relativos. O protocolo completo pode ser realizado em aproximadamente três dias. <a href="https://www.jove.com/files/ftp_upload/53939/53939fig1large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 2" src="/files/ftp_upload/53939/53939fig2.jpg" /> Figura 2. alta qualidade de Ácido Nucleico extraído utilizando o Fenol: Clorofórmio Bead batendo Método. (A) a qualidade do DNA, tal como avaliado utilizando um espectrofotómetro. Uma razão A260 / A280 de 1,8 ea 2,0 indica ácido nucleico puro que não está contaminada com fenol ou proteína. (B) Depois de uma coluna de limpeza, este protocolo pode produzir ARN de alta qualidade, indicada por fortes picos de 16S e 23S rRNA. (C) a degradação de ARN pode ocorrer se a amostra não é mantido frio após a coleta (durante o transporte e armazenamento) ou se RNases estão presentes durante o processamento. <a href="https://www.jove.com/files/ftp_upload/53939/53939fig2large.jpg" target="_blank">por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 3" src="/files/ftp_upload/53939/53939fig3.jpg" /> Figura 3. A confirmação do sucesso 16S rRNA Gene Amplification Usando a 515F e 806R Barcoded Primer Set. Topo) A electroforese em gel é usado para confirmar a presença de uma única banda de cerca de 380 pares de bases IN a cada amostra que foi amplificada com o molde. A ausência de uma banda indica a amplificação sem sucesso; Isso geralmente é devido a erro humano e a reação de PCR a partir dessa amostra deve ser repetido. inferior) no modelo (de água) controles correr em paralelo com o mesmo par de primers não deve ter uma banda de presente. A presença de uma banda no controle da água indica reagentes contaminados; descartar as reagentes que podem ser contaminados e re-fazer as amplificações da PCR, tanto do modelo e água controle para esse par de primers. <a href="https://www.jove.com/files/ftp_upload/53939/53939fig3large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 4" src="/files/ftp_upload/53939/53939fig4.jpg" /> Figura 4. Quantificação da concentração Biblioteca final Piscina e Validação do tamanho da biblioteca. Depois reunindo os fragmentos amplificados de amostras individuais, the concentração da piscina biblioteca final deve ser determinada. A piscina biblioteca deve então ser diluída para atingir uma concentração de 2 nM. <a href="https://www.jove.com/files/ftp_upload/53939/53939fig4large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 5" src="/files/ftp_upload/53939/53939fig5.jpg" /> Figura 5. Representante Bar Plot da sequência de Índices de qualidade em cada posição do Ler. É normal que a qualidade sequência a cair depois de 200 pares de bases, mas o escore médio de qualidade deve permanecer acima de 30. <a href="https://www.jove.com/files/ftp_upload/53939/53939fig5large.jpg" target="_blank">Por favor, clique aqui para ver uma versão maior desta figura.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> #SampleID </td><td colspan="2"> Código de barras <br/&gt; Sequência </td><td colspan="3"> LinkerPrimer Seqüência </td><td> rcbcPrimer </td><td> SampleType </td><td> Extração fornada </td><td> Amplificação prato </td><td> Descrição </td></tr><tr><td> arquivo de exemplo mapeamento #An podem ser encontradas em: http://qiime.org/_static/Examples/File_ formatos / Exemplo_ Mapeamento_ file.txt </td><td colspan="2"></td><td colspan="3"></td><td></td><td></td><td></td><td></td><td></td></tr><tr><td> AG2350 </td><td colspan="2"> TCCCTTGTCTCC </td><td colspan="3"> CCGGACTACHVGGGTWTCTAAT </td><td> rcbc000 </td><td> Cervical Cotonete </td><td> 1 </td><td> UMA </td><td></td></tr></tbody></table> Tabela 1. Mapeamento de arquivo de modelo. Creating um arquivo de mapeamento preciso e completo é essencial para a execução com sucesso o protocolo. O arquivo de mapeamento não só é necessária para a execução de QIIME, mas também permite que o pesquisador de manter a ligação entre o código de barras da amostra e metadados, para analisar os dados para quaisquer desvios sistemáticos (por exemplo, de lote para lote variação), e para determinar correlações interessantes entre os metadados e as populações bacterianas. Um arquivo de mapeamento de nu-ossos é fornecido, mas usuários são encorajados a adicionar tantas colunas contendo metadados possível. Exemplos de metadados adicionais para um esfregaço vaginal inclui a idade, a data / hora do participante da coleta de swab, tipo de contraceptivo hormonal (se aplicável), infecção sexualmente transmissíveis resultados dos testes, etc. <img alt="suppliment 1" src="/files/ftp_upload/53939/53939suppliment.jpg" /> Suplementar arquivo 1. Lista de códigos de barra dos iniciador inverso Sequências 10 </sup&gt;. As três primeiras colunas pode ser usada para completar o arquivo de mapeamento, e a última coluna fornece toda a sequência de iniciador para fins de encomendar. <a href="https://www.jove.com/files/ftp_upload/53939/Supplemental_Code_File.xlsx" target="_blank">Por favor clique aqui para baixar esse arquivo.</a>

Watch this Scientific Journal Video about Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization at JoVE.com

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

Nós descrevemos um método eficiente, robusto e de baixo custo para extração de ácidos nucleicos de cotonetes para a caracterização das comunidades bacterianas usando 16S rRNA amplicon gene seqüenciamento. O método permite uma abordagem comum para processamento de múltiplos tipos de amostras e acomoda uma série de processos analíticos jusante.

Eficiente de Ácido Nucleico Extração e sequenciamento genético 16S rRNA para Bacteriana Comunidade Caracterização

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...

efficient-nucleic-acid-extraction-16s-rrna-gene-sequencing-for

Research

JoVE Journal

Biology

38.2K visualizações.  Massachusetts General Hospital.  Nós descrevemos um método eficiente, robusto e de baixo custo para extração de ácidos nucleicos de cotonetes para a caracterização das comunidades bacterianas usando 16S rRNA amplicon gene seqüenciamento. O método permite uma abordagem comum para processamento de múltiplos tipos de amostras e acomoda uma série de processos analíticos jusante. 

Vídeo: Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

Bacterial Gene Expression Analysis Using Microarrays

Análise de Expressão Gênica Utilizando bacteriana Microarrays

Biologia

Electricity-Free, Sequential Nucleic Acid and Protein Isolation

Traditional and emerging pathogens such as Enterohemorrhagic Escherichia coli (EHEC), Yersinia pestis, or prion-based diseases are of significant concern for governments, industries and medical professionals worldwide. For example, EHECs, combined with Shigella, are responsible for the deaths of approximately 325,000 children each year and are particularly prevalent in the developing world where laboratory-based identification, common in the United States, is unavailable 1. The development and distribution of low cost, field-based, point-of-care tools to aid in the rapid identification and/or diagnosis of pathogens or disease markers could dramatically alter disease progression and patient prognosis. We have developed a tool to isolate nucleic acids and proteins from a sample by solid-phase extraction (SPE) without electricity or associated laboratory equipment 2. The isolated macromolecules can be used for diagnosis either in a forward lab or using field-based point-of-care platforms. Importantly, this method provides for the direct comparison of nucleic acid and protein data from an un-split sample, offering a confidence through corroboration of genomic and proteomic analysis.
Our isolation tool utilizes the industry standard for solid-phase nucleic acid isolation, the BOOM technology, which isolates nucleic acids from a chaotropic salt solution, usually guanidine isothiocyanate, through binding to silica-based particles or filters 3. CUBRC's proprietary solid-phase extraction chemistry is used to purify protein from chaotropic salt solutions, in this case, from the waste or flow-thru following nucleic acid isolation4.
By packaging well-characterized chemistries into a small, inexpensive and simple platform, we have generated a portable system for nucleic acid and protein extraction that can be performed under a variety of conditions. The isolated nucleic acids are stable and can be transported to a position where power is available for PCR amplification while the protein content can immediately be analyzed by hand held or other immunological-based assays. The rapid identification of disease markers in the field could significantly alter the patient's outcome by directing the proper course of treatment at an earlier stage of disease progression. The tool and method described are suitable for use with virtually any infectious agent and offer the user the redundancy of multi-macromolecule type analyses while simultaneously reducing their logistical burden.

A tool and chemistries are described to sequentially isolate nucleic acids followed by proteins from a sample without the need for electricity. The tool consists of a sorbent held within a transfer pipette while the isolation chemistries are based on solid-phase extraction principles. The isolated macromolecules can be analyzed by immuno-based and PCR-based assays.

Electricidade-Free, Ácido Nucleico seqüencial e isolamento de proteínas

Traditional and emerging pathogens such as Enterohemorrhagic Escherichia coli (EHEC), Yersinia pestis, or prion-based diseases are of significant concern ...

Analyzing and Building Nucleic Acid Structures with 3DNA

The 3DNA software package is a popular and versatile bioinformatics tool with capabilities to analyze, construct, and visualize three-dimensional nucleic acid structures. This article presents detailed protocols for a subset of new and popular features available in 3DNA, applicable to both individual structures and ensembles of related structures. Protocol 1 lists the set of instructions needed to download and install the software. This is followed, in Protocol 2, by the analysis of a nucleic acid structure, including the assignment of base pairs and the determination of rigid-body parameters that describe the structure and, in Protocol 3, by a description of the reconstruction of an atomic model of a structure from its rigid-body parameters. The most recent version of 3DNA, version 2.1, has new features for the analysis and manipulation of ensembles of structures, such as those deduced from nuclear magnetic resonance (NMR) measurements and molecular dynamic (MD) simulations; these features are presented in Protocols 4 and 5. In addition to the 3DNA stand-alone software package, the w3DNA web server, located at <a href="http://w3dna.rutgers.edu" target="_blank">http://w3dna.rutgers.edu</a>, provides a user-friendly interface to selected features of the software. Protocol 6 demonstrates a novel feature of the site for building models of long DNA molecules decorated with bound proteins at user-specified locations.

The 3DNA software package is a popular and versatile bioinformatics tool with capabilities to analyze, construct, and visualize three-dimensional nucleic acid structures. This article presents detailed protocols for a subset of new and popular features available in 3DNA, applicable to both individual structures and ensembles of related structures.

Análise e construção de estruturas de Ácido Nucleico com 3DNA

The 3DNA software package is a popular and versatile bioinformatics tool with capabilities to analyze, construct, and visualize three-dimensional nucleic ...

Next-generation Sequencing of 16S Ribosomal RNA Gene Amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the long-lasting gold standards is to sequence 16S ribosomal RNA (rRNA) gene amplicons generated by domain-level PCR reactions amplifying from genomic DNA. Traditionally, this was performed by cloning and Sanger (capillary electrophoresis) sequencing of PCR amplicons. The advent of next-generation sequencing has tremendously simplified and increased the sequencing depth for 16S rRNA gene sequencing. The introduction of benchtop sequencers now allows small labs to perform their 16S rRNA sequencing in-house in a matter of days. Here, an approach for 16S rRNA gene amplicon sequencing using a benchtop next-generation sequencer is detailed. The environmental DNA is first amplified by PCR using primers that contain sequencing adapters and barcodes. They are then coupled to spherical particles via emulsion PCR. The particles are loaded on a disposable chip and the chip is inserted in the sequencing machine after which the sequencing is performed. The sequences are retrieved in fastq format, filtered and the barcodes are used to establish the sample membership of the reads. The filtered and binned reads are then further analyzed using publically available tools. An example analysis where the reads were classified with a taxonomy-finding algorithm within the software package Mothur is given. The method outlined here is simple, inexpensive and straightforward and should help smaller labs to take advantage from the ongoing genomic revolution.

Characterizing microbial community has been a longstanding goal in environmental microbiology. Next-generation sequencing methods now allow for the characterization of microbial communities at an unprecedented depth with minimal cost and labor. We detail here our approach to sequence bacterial 16S ribosomal RNA genes using a benchtop sequencer.

O sequenciamento de próxima geração de 16S RNA ribossomal Gene amplicons

One of the major questions in microbial ecology is &#8220;who is there?&#8221; This question can be answered using various tools, but one of the ...

Highly Efficient Ligation of Small RNA Molecules for MicroRNA Quantitation by High-Throughput Sequencing

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide resolution. This technique captures miRNAs by attaching 3&#8217; and 5&#8217; oligonucleotide adapters to miRNA molecules and allows de novo miRNA discovery. Coupling with powerful next-generation sequencing platforms, miR-Seq has been instrumental in the study of miRNA biology. However, significant biases introduced by oligonucleotide ligation steps have prevented miR-Seq from being employed as an accurate quantitation tool. Previous studies demonstrate that biases in current miR-Seq methods often lead to inaccurate miRNA quantification with errors up to 1,000-fold for some miRNAs1,2. To resolve these biases imparted by RNA ligation, we have developed a small RNA ligation method that results in ligation efficiencies of over 95% for both 3&#8217; and 5&#8242; ligation steps. Benchmarking this improved library construction method using equimolar or differentially mixed synthetic miRNAs, consistently yields reads numbers with less than two-fold deviation from the expected value. Furthermore, this high-efficiency miR-Seq method permits accurate genome-wide miRNA profiling from in vivo total RNA samples2.

MicroRNAs (miRNAs) are a widely conserved class of regulatory molecules. Here we describe a miRNA cloning method that relies upon two potent ligation steps followed by high-throughput sequencing. Our method permits accurate genome-wide quantitation of miRNAs.

Ligadura altamente eficiente de pequeno RNA moléculas microRNA para quantificação por sequenciamento de alto rendimento

MiRNA cloning and high-throughput sequencing, termed miR-Seq, stands alone as a transcriptome-wide approach to quantify miRNAs with single nucleotide ...

Simple Bulk Readout of Digital Nucleic Acid Quantification Assays

Digital assays are powerful methods that enable detection of rare cells and counting of individual nucleic acid molecules. However, digital assays are still not routinely applied, due to the cost and specific equipment associated with commercially available methods. Here we present a simplified method for readout of digital droplet assays using a conventional real-time PCR instrument to measure bulk fluorescence of droplet-based digital assays.
We characterize the performance of the bulk readout assay using synthetic droplet mixtures and a droplet digital multiple displacement amplification (MDA) assay. Quantitative MDA particularly benefits from a digital reaction format, but our new method&#160;applies to any digital assay. For established digital assay protocols such as digital PCR, this method serves to speed up and simplify assay readout.
Our bulk readout methodology brings the advantages of partitioned assays without the need for specialized readout instrumentation. The principal limitations of the bulk readout methodology are reduced dynamic range compared with droplet-counting platforms and the need for a standard sample, although the requirements for this standard are less demanding than for a conventional real-time experiment. Quantitative whole genome amplification (WGA) is used to test for contaminants in WGA reactions and is the most sensitive way to detect the presence of DNA fragments with unknown sequences, giving the method great promise in diverse application areas including pharmaceutical quality control and astrobiology.

We describe an endpoint digital assay for quantifying nucleic acids with a simplified (analog) readout. We measure bulk fluorescence of droplet-based digital assays using a standard qPCR machine rather than specialized instrumentation and confirm our results by microscopy.

Simples massa de Leitura Digital de Ácido Nucleico Quantificação Assays

Digital assays are powerful methods that enable detection of rare cells and counting of individual nucleic acid molecules. However, digital assays are ...

Targeted RNA Sequencing Assay to Characterize Gene Expression and Genomic Alterations

RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding RNAs. Standard RNAseq requires 30 - 100 million sequencing reads and can include multiple RNA products such as mRNA and noncoding RNAs. We demonstrate how targeted RNAseq (capture) permits a focused study on selected RNA products using a desktop sequencer. RNAseq capture can characterize unannotated, low, or transiently expressed transcripts that may otherwise be missed using traditional RNAseq methods. Here we describe the extraction of RNA from cell lines, ribosomal RNA depletion, cDNA synthesis, preparation of barcoded libraries, hybridization and capture of targeted transcripts and multiplex sequencing on a desktop sequencer. We also outline the computational analysis pipeline, which includes quality control assessment, alignment, fusion detection, gene expression quantification and identification of single nucleotide variants. This assay allows for targeted transcript sequencing to characterize gene expression, gene fusions, and mutations.

We describe a targeted RNA sequencing-based method that includes preparation of indexed cDNA libraries, hybridization and capture with custom probes and data analysis to interrogate selected transcripts for gene expression, mutations, and gene fusions. Targeted RNAseq permits cost-effective, rapid evaluation of selected transcripts on a desktop sequencer.

Targeted RNA Sequenciação Ensaio para Caracterizar expressão gênica e genômica Alterações

RNA sequencing (RNAseq) is a versatile method that can be utilized to detect and characterize gene expression, mutations, gene fusions, and noncoding ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

Isolamento de filtração de Ácidos Nucleicos: Um Método de extracção de DNA simples e rápido

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Guided Protocol for Fecal Microbial Characterization by 16S rRNA-Amplicon Sequencing

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. Deviations from what is considered a healthy microbiota composition (dysbiosis) may impair vital functions leading to pathologic conditions. Recent and ongoing research efforts have been directed toward the characterization of associations between microbial composition and human health and disease.
Advances in high-throughput sequencing technologies enable characterization of the gut microbial composition. These methods include 16S rRNA-amplicon sequencing and shotgun sequencing. 16S rRNA-amplicon sequencing is used to profile taxonomical composition, while shotgun sequencing provides additional information about gene predictions and functional annotation. An advantage in using a targeted sequencing method of the 16S rRNA gene variable region is its substantially lower cost compared to shotgun sequencing. Sequence differences in the 16S rRNA gene are used as a microbial fingerprint to identify and quantify different taxa within an individual sample.
Major international efforts have enlisted standards for 16S rRNA-amplicon sequencing. However, several studies report a common source of variation caused by batch effect. To minimize this effect, uniformed protocols for sample collection, processing, and sequencing must be implemented. This protocol proposes the integration of broadly used protocols starting from fecal sample collection to data analyses. This protocol includes a column-free, direct-PCR approach that enables simultaneous handling and DNA extraction of large numbers of fecal samples, along with PCR amplification of the V4 region. In addition, the protocol describes the analysis pipeline and provides a script using the latest version of QIIME (QIIME 2 version 2017.7.0 and DADA2). This step-by-step protocol is aimed to guide those interested in initiating the use of 16S rRNA-amplicon sequencing in a robust, reproductive, easy to use, detailed way.

This manuscript describes a detailed standardized protocol of high-throughput 16S rRNA-amplicon sequencing. The protocol introduces an integrated, uniformed, feasible, and inexpensive protocol starting from fecal sample collection through data analyses. This protocol enables analysis of large numbers of samples with rigorous standards and several controls.

Protocolo guiado para caracterização microbiana Fecal de 16S rRNA-Amplicon sequenciação

The human intestinal microbiome plays a central role in protecting cells from injury, in processing energy and nutrients, and in promoting immunity. ...

Tick Microbiome Characterization by Next-Generation 16S rRNA Amplicon Sequencing

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective and widely available vaccines are lacking for a majority of these diseases, necessitating the development of novel disease mitigation strategies. To this end, a promising avenue of disease control involves targeting the vector microbiome, the community of microbes inhabiting the vector. The vector microbiome plays a pivotal role in pathogen dynamics, and manipulations of the microbiome have led to reduced vector abundance or pathogen transmission for a handful of vector-borne diseases. However, translating these findings into disease control applications requires a thorough understanding of vector microbial ecology, historically limited by insufficient technology in this field. The advent of next-generation sequencing approaches has enabled rapid, highly parallel sequencing of diverse microbial communities. Targeting the highly-conserved 16S rRNA gene has facilitated characterizations of microbes present within vectors under varying ecological and experimental conditions. This technique involves amplification of the 16S rRNA gene, sample barcoding via PCR, loading samples onto a flow cell for sequencing, and bioinformatics approaches to match sequence data with phylogenetic information. Species or genus-level identification for a high number of replicates can typically be achieved through this approach, thus circumventing challenges of low detection, resolution, and output from traditional culturing, microscopy, or histological staining techniques. Therefore, this method is well-suited for characterizing vector microbes under diverse conditions but cannot currently provide information on microbial function, location within the vector, or response to antibiotic treatment. Overall, 16S next-generation sequencing is a powerful technique for better understanding the identity and role of vector microbes in disease dynamics.

Here we present a next-generation sequencing protocol for 16S rRNA sequencing which enables identification and characterization of microbial communities within vectors. This method involves DNA extraction, amplification and barcoding of samples through PCR, sequencing on a flow-cell, and bioinformatics to match sequence data to phylogenetic information.

Caracterização de Microbiome carrapato de próxima geração 16S rRNA Amplicon sequenciação

In recent decades, vector-borne diseases have re-emerged and expanded at alarming rates, causing considerable morbidity and mortality worldwide. Effective ...