Method Article
This protocol describes a simple Hybrid-Cut tissue sectioning method that is useful for recalcitrant plant tissues. Good quality tissue sections enable anatomical studies and other biological studies including in situ hybridization (ISH).
Maintaining plant section integrity is essential for studying detailed anatomical structures at the cellular, tissue, or even organ level. However, some plant cells have rigid cell walls, tough fibers and crystals (calcium oxalate, silica, etc.), and high water content that often disrupt tissue integrity during plant tissue sectioning.
This study establishes a simple Hybrid-Cut tissue sectioning method. This protocol modifies a paraffin-based sectioning technique and improves the integrity of tissue sections from different plants. Plant tissues were embedded in paraffin before sectioning in a cryostat at -16 °C. Sectioning under low temperature hardened the paraffin blocks, reduced tearing and scratching, and improved tissue integrity significantly. This protocol was successfully applied to calcium oxalate-rich Phalaenopsis orchid tissues as well as recalcitrant tissues such as reproductive organs and leaves of rice, maize, and wheat. In addition, the high quality of tissue sections from Hybrid-Cut could be used in combination with in situ hybridization (ISH) to provide spatial expression patterns of genes of interest. In conclusion, this protocol is particularly useful for recalcitrant plant tissue containing high crystal or silica content. Good quality tissue sections enable morphological and other biological studies.
The paraffin-based sectioning method is a widely-used technique for anatomical studies. Preservation of intact tissue anatomy is important for morphological and biological studies. The paraffin-embedded sectioning technique is advantageous because paraffin-embedding retains cell and tissue morphology. In addition, paraffin blocks can be stored conveniently for long periods of time. However, paraffin-embedded sectioning is not suitable for plant tissues containing intracellular crystals. Crystals within the cells often tear paraffin ribbons and damage tissue integrity during sectioning.
Unlike paraffin sectioning, cryosectioning is relatively fast and sections can be obtained without fixation, serial dehydration or embedding medium infiltration 1. Cryosections are compatible with many applications such as immunohistochemistry, in-situ hybridization, and enzyme histochemistry. The other advantage of cryosectioning is that this method does not go through a potential denaturation processes such as high temperature and chemical treatments, so cellular molecules are well preserved within the tissue sections 2. Cryosectioning is generally preferred over paraffin-based sectioning for studies in animal tissues. However, cryosectioning is not the first choice in plants because freezing temperature sometimes causes formation of ice crystals that affect the quality of section integrity. Although osmoregulation such as sucrose solutions, polyethylene glycol (PEG), or glycerol 3 have been reported to reduce crystal ice formation under freezing conditions, the improvement is less than optimal.
To adapt to different environments, different plants often have distinct tissue texture and plant cells have evolved to form rigid cell walls, tough fibers, and crystals 4,5. For example, insoluble calcium oxalate crystals and silica bodies are fairly common in plants 6. Silicate bodies/crystals have been reported to help maintain plant architecture, erectness, and prevent disease or pest in cereal plants 7-9.
The potted orchids and cut-flower orchid market is flourishing and it is a growing industry. Phalaenopsis aphrodite (moth orchid) is one of the most important export ornamental plants in Taiwan. Significant efforts have been made to understand the morphological and physiological changes of the flowering processes in Phalaenopsis orchids. Floral spikes of Phalaenopsis orchids are initiated from axillary buds at the leaf base. After a period of cool ambient temperature (approximately one and half months), axillary buds enlarge, break dormancy, and protrude from the leaf base to develop into young floral spikes. To understand the physiological, cellular, and molecular processes of spike initiation, it is essential to develop a robust anatomical technique to visualize tissues or markers in a timely manner. However, the presence of ubiquitous crystals in orchid tissues, particularly in axillary buds, makes anatomical work difficult.
Here we sought to improve section integrity of recalcitrant plant tissues that have been hitherto regarded as technically challenging. Here we show an improved protocol named Hybrid-Cut. It is a paraffin-based sectioning method that is performed using a cryostat. Paraffin embedding resolves high water content in plant tissue. Sectioning under low temperature hardens the paraffin block, reduces crystal tearing problem, and improves tissue integrity significantly. This protocol significantly improves tissue integrity for recalcitrant plant samples.
1. Fixation and Embedding
2. Tissue Sectioning
3. Tissue Staining
4. In Situ Hybridization
Hybrid-Cut Improves the Integrity of Tissue Sections
Understanding the anatomy of the reproductive floral structure is important for investigating the underlying mechanism of flower initiation in orchids. However, the accumulation of intracellular calcium oxalate crystals in Phalaenopsis orchids makes such studies a challenging task. To circumvent the problems associated with tearing caused by crystals during the sectioning process (Figure 1), we developed a system we named Hybrid-Cut. This protocol combines traditional paraffin embedding and cryosection techniques. We first tested Hybrid-Cut in axillary buds of Phalaenopsis orchid because they are notorious for tissue rigidity and high crystal content. Axillary bud tissue was fixed in 4% PFA (see Protocol, step 1.3). After serial ethanol dehydration and paraffin wax infiltration, the axillary bud was embedded in a paraffin block. The block was trimmed to a suitable size before sectioning (Figure 2A). A small amount of OCT was then applied to the center of the cryostat stage (Figure 2B). The paraffin block was then adhered to the stage via OCT. The stage was incubated in a cryostat for 10 min to allow complete solidification of OCT before sectioning (Figure 2C) and then cryosection was performed in a -16 °C chamber (Figure 2D).
As a comparison, a paraffin block containing an axillary bud of Phalaenopsis orchid was subjected to regular microtome sectioning. As shown in Figure 1A, severe tearing of the paraffin ribbons was observed after microtome sectioning. The tissue integrity and cellular structure was also compromised (Figure 1B). Hybrid-Cut, on the other hand, produced intact tissue sections (Figure 3A) with preserved structural integrity (Figure 3B).
Application of Hybrid-Cut to Various Tissues of P. aphrodite
To further test the amenability of Hybrid-Cut, we tested different tissues of Phalaenopsis orchids. It is often difficult to obtain sections of seeds with good tissue integrity because of the hardened seed coats. Using this protocol, detailed structures of seeds were preserved after sectioning (Figure 4A). As shown in Figure 4A, protein bodies, the common storage products 14, could be clearly identified. Hybrid-Cut also worked successfully and showed the detailed structures of the shoot apical meristem of the one-month old protocorm (the germinated structure from a seed) (Figure 4B) and protocorm-like-bodies (PLBs, Figure 4C). The intracellular crystals were observed in sections of PLB. Phalaenopsis orchids have thick and succulent leaves and they perform Crassulacean acid metabolism (CAM)-type photosynthesis 15. The transverse section of leaf blade showed large mesophyll cells and vascular bundles containing xylem and phloem (Figure 4D). Few stomatal openings were observed on the abaxial leaf surface during the daytime (Figure 4D). In fact, CAM plants evolved to maximize carbon gain but simultaneously minimize water loss by opening their stomates in the night under arid conditions 15,16. The root apical meristem of P. aphrodite is shown in Figure 4E. The root tip cells appeared to contain a significant number of crystals, which were very well preserved after sectioning (Figure 4E). Longitudinal sections of young floral spikes provided information about the architecture of young floral primordials (Figure 4F). Moreover, sepals, petals, labellum, and pollinia could be clearly identified from the longitudinal section of young flower buds that have completed differentiation in this 5 mm flower bud (Figure 4G). Notice that crystals were accumulated in the sepals of young floral buds. In short, this protocol works consistently to maintain tissue integrity and produces intact morphology enabling anatomical and possible cellular studies.
Hybrid-Cut Preserves Tissue Integrity in Cereal Crops
We also tested Hybrid-Cut on cereal crops such as rice, wheat and maize that contain high silica content 17,18. As shown in Figure 5, the tissue integrity of transverse sections of rice, wheat, and maize leaves were significantly improved by the Hybrid-Cut method. Xylem, phloem, mesophyll cells, stomates, and bulliform cells that control rolling of the leaf blade to avoid water loss were clearly identified from sections of rice leaves. The Kranz anatomy, mesophyll cells, and vascular bundles of the maize leaf 19,20 were clearly identified. It was intriguing to find a high density of stomates on both the adaxial and abaxial sides of maize leaves (Figure 5). The ratio of adaxial and abaxial stomata of 0.7 in maize has been reported previously 21. In addition, this protocol also worked successfully to provide the detailed cell morphology of spikelets from rice, wheat, and maize (Figure 6). Spikelets are known to contain abundant silica 9. Normally, that causes difficulty in conducting tissue sectioning.
In Situ Hybridization
Genomic and transcriptomic approaches are commonly used to annotate the functions of genes. Providing spatial distribution of transcripts of the genes of interest in developmental or environmental contexts is important to add new insight into the possible functions of the genes. In-situ hybridization (ISH) has been developed to localize gene expression patterns at the tissue level 11,22-25. In addition, ISH can provide cellular, and in some cases sub-cellular, resolution of mRNA distribution in multicellular organisms 26. During ISH, RNA and tissue integrity is essential to obtain reliable spatial information about the selected transcript. We tested ISH using the Hybrid-Cut protocol. Actin gene (PATC157348) was cloned using primers 5'-GGCAGAGTATGATGAATCTGGTCC-3' and 5'- AGGACAGAAGTTCGGCTGGC -3' to get 242 bp PCR amplicon. Cyclin B1:1 (PATC146999) gene specific coding sequence using primers 5'-TCGTAGCAAGGTTGCTTGTG-3' and 5'- ATGAGCATGGCGCTAATACC-3' to get 327 bp PCR amplicon. After ISH, Actin and Cyclin B1:1 gene expression was monitored in young and mature axillary buds (Figure 7). Both genes were expressed in meristematic cells of 2nd and 3rd axillary buds, with stronger signals detected in 3rd axillary buds. These results demonstrated that Hybrid-Cut retain good anatomy and provide spatial gene expression pattern.
Figure 1: Traditional Paraffin Section Causes Severe Tearing of Tissue. A paraffin block containing an axillary bud of Phalaenopsis orchid was subjected to regular microtome sectioning. Severe tearing of the paraffin ribbons was observed after traditional microtome sectioning (A). The tissue integrity and cellular structure was also compromised (B). The arrows show the severe tearing of the tissue slice. Arrowhead shows the crystal bodies. Scale bar 100 µm. Please click here to view a larger version of this figure.
Figure 2: Hybrid-Cut Sectioning Method. An axillary bud tissue was fixed in PFA and tissues were dehydrated, infiltrated with paraffin wax, and embedded in a paraffin block. The paraffin block was trimmed to an appropriate size (A). Optimal Cutting Temperature compound (OCT) was applied to the center of the cryostat stage (B). The paraffin block was attached to the OCT on the cryostat stage. Under low temperature, the paraffin block was adhered to the cryostat stage via OCT (C). Tissue slices were sectioned in the cryostat chamber at -16 °C (D). Scale bars represent 0.5 cm (A), and 1 cm (B-D). Please click here to view a larger version of this figure.
Figure 3: Hybrid-Cut Improves Section Integrity. A paraffin block containing an axillary bud of Phalaenopsis orchid was subjected to Hybrid-Cut sectioning (A) and the Hybrid-Cut method produced sections with excellent tissue integrity (B). The arrowhead shows the endogenous crystal bodies embedded in the axillary bud tissue. Scale bar 100 µm. Please click here to view a larger version of this figure.
Figure 4: Application of Hybrid-Cut to Various Tissue Sections of Phalaenopsis orchid. Different orchid tissues were sectioned using the Hybrid-Cut method, such as longitudinal section of orchid seed during the mature stage (A), longitudinal section of protocorm (B), longitudinal section of protocorm-like bodies (PLB) (C), transverse section of leaf blade (D), longitudinal section of root (E), longitudinal section of young flower spike (F), and longitudinal section of young flower buds (G). Tissue sections were stained by hematoxylin. SC, seed coat; PB, protein body; M, meristem; MP, mother PLB; DP, daughter PLB; Ad, adaxial leaf surface; Ab, abaxial leaf surface; St, stomata; MC, mesophyll cell; VB, vascular bundle; RC, root cap; fb, flower bud; Se, sepal; Pe, petal; La, labellum; Po, pollinia; Ro, rostellum; Ca, callus. Arrowheads show crystals. Scale bars represent 20 µm (A-E) and 200 µm (F-G). Please click here to view a larger version of this figure.
Figure 5: Hybrid-Cut Preserves Leaf Tissue Integrity in Several Cereal Crops. Comparison of leaf tissue using the traditional paraffin method (left-hand panel) and the Hybrid-Cut technique developed in this study (right-hand panel). Images show leaf transverse sections of rice, wheat, and maize. MC, mesophyll cell; Ph, phloem; St, stomata; BC, bulliform cell. Arrows show the tearing of tissue slice. Arrowheads show silica bodies. The blue dashed circles indicate Kranz anatomy in C4 maize. Scale bars 20 µm. Please click here to view a larger version of this figure.
Figure 6: Hybrid-Cut Preserves Spikelet Tissue Integrity in Several Cereal Crops. Comparison of tissue integrity of spikelet sections between traditional paraffin and Hybrid-Cut methods. Arrows show the tearing of tissue slice. Arrowheads indicate silica bodies. Scale bars 20 µm (rice), and 200 µm (wheat and maize). Please click here to view a larger version of this figure.
Figure 7: In Situ Hybridization of Actin and CyclinB1;1 Expression Patterns in the Axillary Bud of Phalaenopsis orchid. Tissue slices of the 2nd axillary buds and 3rd axillary bud were prepared using the Hybrid-Cut method. A total of 40 ng of Actin and CyclinB1;1 dig-labeled probe were used for hybridization. The sense probe was used as a negative control. Arrows indicate the reproductive meristem of axillary bud. Scale bars 100 µm. Please click here to view a larger version of this figure.
Plant cells have rigid cell walls, tough fibers, crystals, and high water content that cause tissue tearing problems during plant tissue sectioning. Even though paraffin-based sectioning is frequently used for plant tissues, the endogenous crystals often lacerate the plant tissue during sectioning (Figure 1). Because of the inherently high water content within the plant cells, cryostat-based sectioning often causes broken cells and cracked tissue sections.
In the present study, a combined paraffin-embedding and cryosection protocol named Hybrid-Cut was developed and good quality tissue sections were obtained. This protocol resolves the problem associated with high water content by introducing paraffin embedding, and reduces the tearing effect by hardening paraffin wax under low temperature during sectioning (Figure 3). Therefore, this modified protocol is advantageous over either paraffin-based sectioning or cryosectioning for preserving plant tissue integrity.
This manuscript demonstrates that the Hybrid-Cut method preserves tissue integrity in many tissues of Phalaenopsis orchid such as axillary bud, seed, and PLB, etc. that contain high levels of crystals (Figures 3-4). Moreover, this protocol is amenable to cereal crops such as reproductive organs and leaves of rice, maize, and wheat that contain high silica (Figures 5-6). Presumably, this protocol may be applied to woody plants containing high fiber.
In general, fixing tissue thoroughly is very important for Hybrid-Cut. We found that formaldehyde-alcohol-acidic acid (FAA) fixative is better than PFA to preserve the tissue integrity of some recalcitrant tissues such as axially buds, roots, etc. However, PFA works better than FAA in preserving the RNA integrity. Therefore PFA is recommended to fix sample for in situ hybridization (ISH) work. The protocol described here is designed for RNA ISH experiment. Therefore, all reagents were prepared to avoid RNA degradation by eliminating RNase contamination by DEPC treatment. If Hybrid-Cut section is for anatomical studies, regular reverse osmosis (RO) water and its derived buffer or reagents are acceptable.
Reducing specimen size and thickness to less than 3 mm is helpful for infiltration. Moreover, increasing immersion time for dehydration and infiltration are necessary for hard texture tissues. Limitation of this protocol might due to problems caused by inadequate fixation, dehydration, and infiltration of specimen. Therefore, adjustment of processing time for each step is critical to produce good quality paraffin block. Normally, harder tissue needs longer processing time than softer tissue.
In addition, we showed that Hybrid-Cut worked successfully in combination with ISH to provide spatial distribution of the selected transcripts (Figure 7). In summary, this protocol is useful for the study of plant anatomy and provides a tissue-specific RNA map of the selected genes. In addition it may be applied to other molecular studies such as terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay, fluorescence in situ hybridization (FISH), and immunostaining techniques. In conclusion, this improved tissue sectioning protocol is both useful and helpful for researchers in plant communities.
No conflicts of interest declared.
We are grateful to the technical support from Ms. Hong Xian Hsing, Mr. Min Jeng Li, and Mr. Eric C. P. Wu. We express our appreciation to Miranda Loney for English editing.
Name | Company | Catalog Number | Comments |
Embedding Center model EC780-1 | CSA | ||
Microtome model RM2255 | Leica | ||
Cryostat model CM 1950 | Leica | ||
Axio Scope A1 microscope | Zeiss | ||
Murashige & Skoog medium including vitamins | Duchefa Biochemia | M0222.0050 | |
RNase free surface decontaminant | Apex | 10-228 | |
Diethyl pyrocarbonate (DEPC) | Bio Basic Inc. | D801154 | |
Sodium chloride (NaCl) | MDBio, Inc. | 101-7647-14-5 | |
Potassium chloride, crystal (KCl) | J.T. Baker | 7447-40-7 | |
Sodium phosphate dibasic (Na2HPO4) | Sigma-Aldrich | 7558-79-4 | |
Potassium phosphate monobasic (KH2PO4) | Sigma-Aldrich | 7778-77-0 | |
Paraformaldehyde (PFA) | Sigma-Aldrich | 16005 | |
Sodium hydroxide (NaOH) | Showa | 19430160 | |
Sulfuric acid (H2SO4) | Sigma-Aldrich | 7664-93-9 | |
Glutaraldehyde solution | Sigma-Aldrich | 111-30-8 | |
Polyoxyethylene 20 sorbitan monolaurate (Tween 20) | J.T. Baker | 9005-64-5 | |
Octyl Phenol Ethoxylate (Triton X100) | J.T. Baker | 9002-93-1 | |
Glass scintillation vials | Newastar | DG60805-00020 | |
Desiccator vacuum | Violet Bioscience Inc. | TS-402030 | |
Rotary vane pump RZ2.5 | Vacuubrand | 36149406 | |
Ethanol | J.T. Baker | 64-17-5 | |
Sub-X | Leica Surgipath | 3803670 | Xylene substitute |
Paraplast Plus | Leica Surgipath | 39602004 | Tissue embedding paraffin |
SUPERFROST micro slide glass | Matsunami | S7441 | |
FSC 22 Clear | Leica Surgipath | 3801480 | Optimal Cutting Temperature compound (OCT) |
Xylenes, Purified | Leica Surgipath | 3803665 | |
Hematoxylin | Merck | HX305311 | |
Hydrochloric acid (HCl) | Sigma-Aldrich | 7647-01-0 | |
Micromount | Leica Surgipath | 3801731 | Mounting medium |
pGEM T-easy vector | Promega | A1360 | |
Proteinase K | Roche | 3115879001 | |
SP6/T7 DIG RNA Labeling Kit | Roche | 11175025910 | |
NBT/BCIP stock solution | Roche | 11681451001 |
Request permission to reuse the text or figures of this JoVE article
Request PermissionThis article has been published
Video Coming Soon
Copyright © 2025 MyJoVE Corporation. All rights reserved