JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Immunology and Infection

Detection of SARS-CoV-2 Receptor-Binding Domain Antibody using a HiBiT-Based Bioreporter

Published: August 12th, 2021

DOI:

10.3791/62488

1Ottawa Hospital Research Institute, 2Department of Biochemistry, Microbiology and Immunology, University of Ottawa, 3Department of Biotechnology, University of Tehran

The outlined protocol describes the procedure for producing the HiBiT-receptor-binding domain protein complex and its application for fast and sensitive detection of SARS-CoV-2 antibodies.

The emergence of the COVID-19 pandemic has increased the need for better serological detection methods to determine the epidemiologic impact of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). The increasing number of SARS-CoV-2 infections raises the need for better antibody detection assays. Current antibody detection methods compromise sensitivity for speed or are sensitive but time-consuming. A large proportion of SARS-CoV-2-neutralizing antibodies target the receptor-binding domain (RBD), one of the primary immunogenic compartments of SARS-CoV-2. We have recently designed and developed a highly sensitive, bioluminescent-tagged RBD (NanoLuc HiBiT-RBD) to detect SARS-CoV-2 antibodies. The following text describes the procedure to produce the HiBiT-RBD complex and a fast assay to evaluate the presence of RBD-targeting antibodies using this tool. Due to the durability of the HiBiT-RBD protein product over a wide range of temperatures and the shorter experimental procedure that can be completed within 1 h, the protocol can be considered as a more efficient alternative to detect SARS-CoV-2 antibodies in patient serum samples.

The recent emergence of a new coronavirus, SARS-CoV21, has caused more than 2,800,000 fatalities and 128 million infections as of March 30th, 20212. Due to the lack of a reliable and well-established treatment procedure for SARS-CoV-2 clinical therapies, many endeavors have been made to restrict further viral transmission and more importantly, to develop an effective and robust treatment or a vaccine3. To date, there are more than 50 COVID-19 vaccine candidates in trials reported by the World Health Organization4. Detection of antibodies against SARS-CoV-2 is of ....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

NOTE: The protocol described below adheres to all ethics guidelines according to protocol code 20200371-01H.

1. Production and evaluation of the HiBiT-RBD bioreporter

  1. Producing a sufficient quantity of HiBiT-RBD bioreporter
    1. Prepare for cell culture
      1. Prepare complete Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum and 1% penicillin/streptomycin. Then, warm the media in a 37 °C water bath.
      2. Turn the biological saf.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

The signals from both the HiBit-RBD-containing cell lysate and supernatant of the transfected cells were recorded (Figure 2) to evaluate the appropriate protein source. HiBiT-RBD and LgBit were separately used as controls, and the data showed low background compared to a strong signal when both parts were combined. Hence, HiBiT-RBD interaction with LgBiT is necessary to generate active enzyme for substrate digestion and bioluminescence activity (Figure 1).

<.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

The increasing number of people infected with the SARS-CoV-2 and the ongoing effort for global vaccination necessitates sensitive and fast serologic tests that can be used in large-scale serosurveys. Recent research shows that split nanoluciferase-based bioreporters can be used to develop such assays. We recently developed the HiBiT-RBD bioreporter to design a test that can be used to detect SARS-CoV-2-specific antibodies in patient serum in a fast and reliable fashion (Figure 4C).

Log in or to access full content. Learn more about your institution’s access to JoVE content here

We appreciate and thank the technical assistance of Xiaohong He, Ricardo Marius, Julia Petryk, Bradley Austin, and Christiano Tanese De Souza. We also thank Mina Ghahremani for Graphic Design. We would also like to thank all the individuals who participated and donated their blood samples for this study. DWC is supported in part by uOttawa Faculty and Department of Medicine.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
5x Passive Lysis Buffer Promega E194A 30 mL
Bio-Plex Handheld Magnetic Washer Bio-Rad 171020100
DMEM Sigma D6429-500ml
Dual-Glo luciferase Assay System Promega E2940 100 mL kit
Fetal Bovine Serum (FBS) Sigma F1051
HiBiT-RBD Plasmid gacggatcgggagatctcccgatcccctatggt gcactctcagtacaatctgctctgatgccgcata gttaagccagtatctgctccctgcttgtgtgttgg aggtcgctgagtagtgcgcgagcaaaattta agctacaacaaggcaaggcttgaccgacaa ttgcatgaagaatctgcttagggttaggcgttttg cgctgcttcgcgatgtacgggccagatatacgc gttgacattgattattgactagttattaatagt aatcaattacggggtcattagttcatagcccat atatggagttccgcgttacataacttacggtaa atggcccgcctggctgaccgcccaacgaccc ccgcccattgacgtcaataatgacgtatgttccc atagtaacgccaatagggactttccattgacgtc aatgggtggagtatttacggtaaactgcccact tggcagtacatcaagtgtatcatatgccaagta cgccccctattgacgtcaatgacggtaaatgg cccgcctggcattatgcccagtacatgaccttat gggactttcctacttggcagtacatctacgtat tagtcatcgctattaccatggtgatgcggtttt ggcagtacatcaatgggcgtggatagcggtttg actcacggggatttccaagtctccaccccattg acgtcaatgggagtttgttttggcaccaaaatc aacgggactttccaaaatgtcgtaacaactccg ccccattgacgcaaatgggcggtaggcgtgta cggtgggaggtctatataagcagagctctctgg ctaactagagaacccactgcttactggcttatcg aaattaatacgactcactatagggagacccaa gctggctagcgtttaaacttaagcttggtaccga gctcggatccgccaccATGGAGACAGA CACACTCCTGCTATGGGTACTGC TGCTCTGGGTTCCAGGTTCCAC TGGTGACtctggctctagcggctctggctct agcggcggcATGGTGAGCGGCTG GCGGCTGTTCAAGAAGATTAGC tctagcggcGACTACAAGGACC ACGACGGTGACTACAAGGACCA CGACATCGACTACAAGGACGAC GACGACAAGggcagcggctccggca gcagcggaggaggaggctctggaggagga ggctctagcggcggcaacatcacaaatctgtg cccattcggcgaggtgtttaacgccaccagat ttgccagcgtgtatgcctggaaccggaagaga atctctaattgcgtggccgactatagcgtgct gtacaatagcgcctccttctctacctttaagt gctatggcgtgtcccccacaaagctgaacgac ctgtgcttcaccaacgtgtacgccgactcttttgt gatcaggggcgatgaggtgcgccagatcgc acctggacagacaggcaagatcgccgactac aactataagctgccagacgatttcaccggct gcgtgatcgcctggaatagcaacaatctggatt ccaaagtgggcggcaactacaattatctgtac cggctgttcagaaagagcaacctgaagccctt tgagcgggatatcagcacagagatctaccag gcaggctccaccccttgcaacggagtggagg gcttcaattgttattttcccctgcagagctacggc ttccagcctacaaatggcgtgggctatcagcca tacagggtggtggtgctgtcctttgagctgctg cacgcacctgcaaccgtgtcctctggacacatc gagggccgccacatgctggagatgggccatc atcaccatcatcaccaccaccaccactgatag cggccgctcgagtctagagggcccgtttaaac ccgctgatcagcctcgactgtgccttctagtt gccagccatctgttgtttgcccctcccccgtg ccttccttgaccctggaaggtgccactcccac tgtcctttcctaataaaatgaggaaattgcat cgcattgtctgagtaggtgtcattctattctgggg ggtggggtggggcaggacagcaaggggga ggattgggaagacaatagcaggcatgctggg gatgcggtgggctctatggcttctgaggcggaa agaaccagctggggctctagggggtatcccca cgcgccctgtagcggcgcattaagcgcggcg ggtgtggtggttacgcgcagcgtgaccgctac acttgccagcgccctagcgcccgctcctttcg ctttcttcccttcctttctcgccacgttcgccggctt tccccgtcaagctctaaatcgggggctcccttta gggttccgatttagtgctttacggcacctcgacc ccaaaaaacttgattagggtgatggttcacgta gtgggccatcgccctgatagacggtttttcgcc ctttgacgttggagtccacgttctttaatagtg gactcttgttccaaactggaacaacactcaacc ctatctcggtctattcttttgatttataagggatttt gccgatttcggcctattggttaaaaaatgagctg atttaacaaaaatttaacgcgaattaattctgt ggaatgtgtgtcagttagggtgtggaaagtccc caggctccccagcaggcagaagtatgcaaag catgcatctcaattagtcagcaaccaggtgtgg aaagtccccaggctccccagcaggcagaagt atgcaaagcatgcatctcaattagtcagcaac catagtcccgcccctaactccgcccatcccgc ccctaactccgcccagttccgcccattctccgcc ccatggctgactaattttttttatttatgcagaggc cgaggccgcctctgcctctgagctattccagaa gtagtgaggaggcttttttggaggcctaggcttttg caaaaagctcccgggagcttgtatatccattttc ggatctgatcaagagacaggatgaggatcgttt cgcatgattgaacaagatggattgcacgcagg ttctccggccgcttgggtggagaggctattcggc tatgactgggcacaacagacaatcggctgctct gatgccgccgtgttccggctgtcagcgcagggg cgcccggttctttttgtcaagaccgacctgtccgg tgccctgaatgaactgcaggacgaggcagcg cggctatcgtggctggccacgacgggcgttcct tgcgcagctgtgctcgacgttgtcactgaagcg ggaagggactggctgctattgggcgaagtgcc ggggcaggatctcctgtcatctcaccttgctcctg ccgagaaagtatccatcatggctgatgcaatg cggcggctgcatacgcttgatccggctacctgc ccattcgaccaccaagcgaaacatcgcatcg agcgagcacgtactcggatggaagccggtct tgtcgatcaggatgatctggacgaagagcat caggggctcgcgccagccgaactgttcgcca ggctcaaggcgcgcatgcccgacggcgagg atctcgtcgtgacccatggcgatgcctgcttg ccgaatatcatggtggaaaatggccgctttt ctggattcatcgactgtggccggctgggtgt ggcggaccgctatcaggacatagcgttggct acccgtgatattgctgaagagcttggcggcg aatgggctgaccgcttcctcgtgctttacgg tatcgccgctcccgattcgcagcgcatcgcc ttctatcgccttcttgacgagttcttctgagcg ggactctggggttcgaaatgaccgaccaag cgacgcccaacctgccatcacgagatttcgat tccaccgccgccttctatgaaaggttgggctt cggaatcgttttccgggacgccggctggatga tcctccagcgcggggatctcatgctggagt tcttcgcccaccccaacttgtttattgcagctta taatggttacaaataaagcaatagcatcacaa atttcacaaataaagcatttttttcactgcatt ctagttgtggtttgtccaaactcatcaatgtat cttatcatgtctgtataccgtcgacctctagct agagcttggcgtaatcatggtcatagctgtttc ctgtgtgaaattgttatccgctcacaattccacac aacatacgagccggaagcataaagtgtaaag cctggggtgcctaatgagtgagctaactcacat taattgcgttgcgctcactgcccgctttccagtc gggaaacctgtcgtgccagctgcattaatgaa tcggccaacgcgcggggagaggcggtttgcg tattgggcgctcttccgcttcctcgctcactgactc gctgcgctcggtcgttcggctgcggcgagcggt atcagctcactcaaaggcggtaatacggttatc cacagaatcaggggataacgcaggaaagaa catgtgagcaaaaggccagcaaaaggccag gaaccgtaaaaaggccgcgttgctggcgtttt tccataggctccgcccccctgacgagcatcac aaaaatcgacgctcaagtcagaggtggcgaa acccgacaggactataaagataccaggcgtt tccccctggaagctccctcgtgcgctctcctgtt ccgaccctgccgcttaccggatacctgtccgcc tttctcccttcgggaagcgtggcgctttctcat agctcacgctgtaggtatctcagttcggtgtag gtcgttcgctccaagctgggctgtgtgcacgaa ccccccgttcagcccgaccgctgcgccttatcc ggtaactatcgtcttgagtccaacccggtaag acacgacttatcgccactggcagcagccactg gtaacaggattagcagagcgaggtatgtaggc ggtgctacagagttcttgaagtggtggcctaact acggctacactagaagaacagtatttggtatc tgcgctctgctgaagccagttaccttcggaaa aagagttggtagctcttgatccggcaaacaaa ccaccgctggtagcggtggtttttttgtttgca agcagcagattacgcgcagaaaaaaaggat ctcaagaagatcctttgatcttttctacggggt ctgacgctcagtggaacgaaaactcacgttaa gggattttggtcatgagattatcaaaaaggatct tcacctagatccttttaaattaaaaatgaagtt ttaaatcaatctaaagtatatatgagtaaactt ggtctgacagttaccaatgcttaatcagtgagg cacctatctcagcgatctgtctatttcgttcatcca tagttgcctgactccccgtcgtgtagataactac gatacgggagggcttaccatctggccccagtg ctgcaatgataccgcgagacccacgctcacc ggctccagatttatcagcaataaaccagccag ccggaagggccgagcgcagaagtggtcctg caactttatccgcctccatccagtctattaattgtt gccgggaagctagagtaagtagttcgccagtt aatagtttgcgcaacgttgttgccattgctacag gcatcgtggtgtcacgctcgtcgtttggtatgg cttcattcagctccggttcccaacgatcaaggc gagttacatgatcccccatgttgtgcaaaaaag cggttagctccttcggtcctccgatcgttgtca gaagtaagttggccgcagtgttatcactcatggt tatggcagcactgcataattctcttactgtcatg ccatccgtaagatgcttttctgtgactggtgagta ctcaaccaagtcattctgagaatagtgtatgcg gcgaccgagttgctcttgcccggcgtcaatacg ggataataccgcgccacatagcagaactttaa aagtgctcatcattggaaaacgttcttcggggc gaaaactctcaaggatcttaccgctgttgagat ccagttcgatgtaacccactcgtgcacccaact gatcttcagcatcttttactttcaccagcgtttc tgggtgagcaaaaacaggaaggcaaaatgc cgcaaaaaagggaataagggcgacacgga aatgttgaatactcatactcttcctttttcaat attattgaagcatttatcagggttattgtc tcatgagcggatacatatttgaatgtattt agaaaaataaacaaataggggttccgcgca catttccccgaaaagtgccacctgacgtc
LgBiT Promega N3030
penicillin Streptomycin Thermo Fisher Scientific 15140122
Pierce Protein G Magnetic Beads Thermo Fisher Scientific 88848
PolyJet In Vitro DNA Transfection Reagent Signagen SL100688.5
SARS-CoV-2 (2019-nCoV) Spike Neutralizing Antibody, Mouse Mab SinoBiological 40592-MM57
Synergy Mx Microplate Reader BioTek 96-well plate reader luminometer
Trypsin-EDTA Thermo Fisher Scientific 2520056 0.25%

  1. Ullah, H., Ullah, A., Gul, A., Mousavi, T., Khan, M. W. Novel coronavirus 2019 (COVID-19) pandemic outbreak: A comprehensive review of the current literature. Vacunas. , (2020).
  2. Coronavirus update (Live). Worldometer Available from: https://www.worldometers.info/coronavirus/ (2021)
  3. Cacciapaglia, G., Cot, C., Sannino, F. Second wave COVID-19 pandemics in Europe: a temporal playbook. Scientific Reports. 10 (1), 15514 (2020).
  4. COVID-19 vaccines. World Health Organization Available from: https://www.who.int/emergencies/diseases/novel-coronavirus-2019/covid-19-vaccines (2021)
  5. Hueston, L., et al. The antibody response to SARS-CoV-2 infection. Open Forum Infectious Diseases. 7 (9), (2020).
  6. Lan, J., et al. Structure of the SARS-CoV-2 spike receptor-binding domain bound to the ACE2 receptor. Nature. 581 (7807), 215-220 (2020).
  7. Azad, T., et al. Implications for SARS-CoV-2 vaccine design: fusion of Spike glycoprotein transmembrane domain to receptor-binding domain induces trimerization. Membranes. 10 (9), 215 (2020).
  8. Piccoli, L., et al. Mapping neutralizing and immunodominant sites on the SARS-CoV-2 Spike receptor-binding domain by structure-guided high-resolution serology. Cell. 183 (4), 1024-1042 (2020).
  9. Premkumar, L., et al. The receptor-binding domain of the viral spike protein is an immunodominant and highly specific target of antibodies in SARS-CoV-2 patients. Science Immunology. 5 (48), (2020).
  10. Walls, A. C., et al. Elicitation of potent neutralizing antibody responses by designed protein nanoparticle vaccines for SARS-CoV-2. Cell. 183 (5), 1367-1382 (2020).
  11. Azad, T. Nanoluciferase complementation-based biosensor reveals the importance of N- linked glycosylation of SARS-CoV-2 Spike for viral entry. Mol Ther. , 0074-0075 (2021).
  12. Bastos, M. L., et al. Diagnostic accuracy of serological tests for covid-19: systematic review and meta-analysis. BMJ. 370, 2516 (2020).
  13. Bioluminescent Reporters | Reporter Gene Applications | An Introduction to Reporter Genes. Promega Available from: https://www.promega.ca/resources/guides/cell-biology/bioluminescent-reporters/#references-6d127eb8-eeae-40b7-86e9-fe300545e8fa (2021)
  14. Fleiss, A., Sarkisyan, K. S. A brief review of bioluminescent systems. Current Genetics. 65 (4), 877-882 (2019).
  15. Nouri, K., et al. A kinome-wide screen using a NanoLuc LATS luminescent biosensor identifies ALK as a novel regulator of the Hippo pathway in tumorigenesis and immune evasion. The FASEB Journal. 33 (11), 12487-12499 (2019).
  16. Boute, N., et al. NanoLuc Luciferase - a multifunctional tool for high throughput antibody screening. Frontiers in Pharmacology. 7, 27 (2016).
  17. Nouri, K., et al. Identification of celastrol as a novel YAP-TEAD inhibitor for cancer therapy by high throughput screening with ultrasensitive YAP/TAZ-TEAD biosensors. Cancers. 11 (10), 1596 (2019).
  18. Azad, T., et al. SARS-CoV-2 S1 NanoBiT: A nanoluciferase complementation-based biosensor to rapidly probe SARS-CoV-2 receptor recognition. Biosensors and Bioelectronics. 180, 113122 (2021).
  19. Brown, E. E. F., et al. Characterization of critical determinants of ACE2-SARS CoV-2 RBD interaction. International Journal of Molecular Sciences. 22 (5), 2268 (2021).
  20. Azad, T., et al. A gain-of-functional screen identifies the Hippo pathway as a central mediator of receptor tyrosine kinases during tumorigenesis. Oncogene. 39 (2), 334-355 (2020).
  21. Schwinn, M. K., et al. CRISPR-Mediated tagging of endogenous proteins with a luminescent peptide. ACS Chemical Biology. 13 (2), 467-474 (2018).
  22. Azad, T., et al. A high-throughput NanoBiT-based serological assay detects SARS-CoV-2 seroconversion. Nanomaterials. 11 (3), 807 (2021).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved