Clinical and Translational Science Award program of NCATS UL1 TR0000427 and KL2 TR000428 (Cengiz P), UL1TR000427 to the UW ICTR from NIH/NCATS and funds from Waisman Center (Cengiz P), K08 NS088563-01A1 from NINDS (Cengiz P) and NIH P30 HD03352 (Waisman Center), NIH/NINDS 1K08NS078113 (Ferrazzano P). We would like to thank Albee Messing, PhD, for providing us the GFAP knockout mice.

Not: Bu çalışma Ulusal Sağlık Enstitüsü Laboratuvar Hayvanları Bakım için Kılavuz önerisi ve Kullanımına uygun olarak gerçekleştirilmiştir. hayvan protokolü Wisconsin-Madison, Kurumsal Hayvan Bakımı ve Kullanımı Komitesi Üniversitesi tarafından onaylanmıştır. Burada sunulan birincil Astrosit Kültür protokolü Zhang Y 19 vd. Ve Cengiz P 20 vd tarafından sunulan protokolleri kabul edilir. Bazı değişikliklerle. 1. Hipokampal Diseksiyon ve Astrosit Kültür <ol><li> 2 ml Hank Dengeli Tuz Çözeltisi (HBSS) her ile dolu buz üzerinde cerrahi makas, düz ince forseps, düz uçlu forseps, kağıt havlu, çöp torbası,% 70 etanol ve 2 diseksiyon yemekler (3.5 cm çapında) de dahil olmak üzere gerekli tüm reaktifleri ve materyalleri hazırlamak . Emin olun cerrahi aletler en vardır (otoklav) prosedür öncesinde ve Astrosit orta kaplama (tüm diğer malzemeleri kullanın steril: DMEM +% 5 at serumu +% 1 ön steril olarak penisilin-streptomisin, at serumu, HBSS,% 0.25 tripsin, cam lamelleri, petri, 15/50 ml tüpler, T25 şişeleri, vs.). </li><li> Yavaşça tutun ve% 70 etanol ile baş ve fare yavru boyun sprey ve keskin steril makas kullanarak decapitate [Şekil 1 (1)]. </li><li> Beyin [Şekil 1 (2-3)] maruz derisi boyunca küçük makas ile kafatası anterior posterior orta hat kesi gerçekleştirin. </li><li> küçük makas ile burun boyun dikkatle kafatası kesti. Sonra kafa tabanı kafatası kesmek için beyincik için kafatası koku ampuller anterior ve inferior kesti. </li><li> Kafatasının dibinde küçük bir kesi yapmak ve orta hat boyunca kesilir. kafatasını uzak soyma steril düz uçlu forseps kullanabilir. kavisli bir forseps yardımıyla beyin sapı çıkarın. Kafatası beyin çıkarın ve birinci diseksiyon çanak içine yerleştirin [Şekil 1 (4-9)] 21. </li><li> Kavisli bir forseps kullanarak, beynin ventral yüzeyi yukarı bakacak şekilde beyin çevirin ve daha sonra keskin bir steril cerrahi bıçak [Şekil 1 (10,11)] ile her iki yarımkürede ayrı </li><li> Peel geri serebral hemisfer ve dikkatle hipokampus, medial temporal lob [Şekil 1 (12-14)], küçük bir denizatı şeklindeki yapıyı ortaya çıkarmak için steril bir düz kavisli bir forseps ile şişkin orta beyin ve talamik doku kaldırmak. </li><li> Hem hipokampal lobu [Şekil 1 (15,16)] çıkartın ve dikkatlice ince forseps ile çekerek lob gelen meninksler incelemek. Bu adım Meningeal hücreleri ve fibroblastlar tarafından nihai astrosit kültürü kirlenmesini önler. </li><li> HBSS ile dolu ikinci çanak içine hazırlanmış hipokampal lobları aktarın ve buz [Şekil 1 (17,18)] üzerine geri. hippo hazırlanması için - tek bir fare Pool hem hipokampal lob (P2 P0)campal astrosit kültürleri. Bu astrosit uygun yoğunluğunu verir. Keskin steril cerrahi bıçak (yaklaşık 4 kat) kullanarak hipokampal lobları kıyma. </li><li> Aspire HBSS, 15 ml steril konik tüp transferi ve yavaşça çalkalanarak 20 dakika boyunca 37 ° C&#39;de doku inkübe, karıştırın, çanak 1 ml pipet bağlanmış bir steril bir ucunu kullanarak ve% 0.25 tripsin 3 ml. </li><li> 5 dakika boyunca 300 xg&#39;de santrifüj tüpü. Aspire süpernatan dikkatle bir vakum hattına bağlanmış bir steril bir cam pipet kullanılarak. (- 30 kez 20) doku parçaları homojenize kadar yangın parlatılmış cam pipet kullanarak orta ve çiğnemek kaplama 10 ml astrocyte ekleyin. </li><li> 5 dakika boyunca 300 xg&#39;de santrifüj tüpü. Süpernatant aspire ve taze önceden ısıtılmış astrosit kaplama medya 2 mL ekleyin. Yeni 50 ml konik tüp içine 70 mikron örgü filtre (hücre süzgecinden) aracılığıyla hücrelere geçerler. </li><li> 3 mL içeren bir poli-D-Lisin / laminin kaplanmış steril T25 kültür şişelerinde Plaka tüm hücre süspansiyonuastrosit kaplama ortamı, daha sonra bir% 5 CO2 inkübatöründe 37 ° C&#39;de bir balon inkübe edin. </li><li> Gün-de aspire tüm ortam i, n-vitro (DIV) 1, DIV 3 ve DIV 7 ve taze astrosit kaplama medya 2 mL ile değiştirin. astrosit kaplama medya değiştirirken ışık mikroskobu altında her zaman ilerlemesi ve astrositik izdiham gözlemleyin. Not: DIV 1 &#39;de, tüm canlı astrositler kültür şişesi yüzeyi ve sinir yüzer yüzen dahil ölü veya ölmekte hücrelere eklenir. DIV 3 at, ekli hücreler astrositik hücre tabakası oluşturmak için bölünmeye başlar. elverişli koşullar yokluğunda, kültür bir nöronal büyüme hemen yoksundur. % 90 konfluent ve birkaç mikroglia olarak oligodendrosit ön-madde hücreleri, astrositik tabakanın üstünde bulunan edilir - DIV 7 &#39;de, astrosit tabaka yaklaşık 80&#39;dir. </li><li> durulama, şişesi kaplama orta aspire taze önceden ısıtılmış astrosit kaplama orta 2 mL eklemekastrositler birleşen ve kültürü alt hazır olduğunda nd, DIV 11 tekrar kaldırın. </li><li> yavaşça şişeye birkaç kez döndürmek ve aspire tripsin steril bir cam pipet kullanarak,% 0.25 tripsin 2 mL ekleyin. </li><li> % 0.25 tripsin 2 mL ekleyin ve şişe 4 doku kültürü kaputu bekletin - oda sıcaklığında 5 dakika. </li><li> Tripsin çıkarın ve 10 dakika boyunca bir% 5 CO2 inkübatöründe 37 ° C&#39;de bir balon tutun. 5 ml orta kaplama astrocyte prewarmed ekleyin ve avucunuzun karşı balon dokunarak astrositik katmanı ayırmak - tam dekolmanı sağlamak ve bir 15 ml konik tüp astrositler toplamak için yumuşak ezilerek (3 4 kez). </li><li> Santrifüj tüp, 5 dakika boyunca 300 x g&#39;de, süpernatanı havalandırın, ve 1 mL taze astrosit kaplama ortamı ilave edin. </li><li> Bir hemasitometre hücre süspansiyonu 10 mcL ekleyin ve ters bir faz kontrast mikroskobu (10X objektif) kullanarak büyük merkezi Gridlenmiş alana (1 mm 2) hücreleri saymak. Multiply 10 4 tarafından mL başına hücre sayısını tahmin etmek. Bir T25 şişesi ~ 1 x 10 6 toplam ayrışmış hücreleri verecektir. Tohum ~ 1 x 10, 24 oyuklu bir kültür kabı oyuk bir 12 mm çaplı poli-D-Lisin önceden kaplanmış cam lamel 2 mL astrosit kaplama ortamı içinde 5 hücreleri. </li><li> % 5 CO2 inkübatörde 37 ° C&#39;de inkübe edin. 14 (bölüm 2) - DIV 12, OGD / REOX gerçekleştirin. </li><li> mikroglia yoksun hipokampal kültürleri isteniyorsa DIV 11 kadar, 5 mM L-lösin metil ester (LME) hidroklorür ile DIV 3 de astrosit kültürleri tedavi edin. LME inkübasyondan sonra (1 saat 300 rpm) sallayarak tabi kültürler mikroglia kirlenmesine neden kaldırmak için. Not: LME mikroglia 22 çoğalan ortadan kaldırmak için bir yöntem olarak yaygın bir şekilde kullanılmaktadır, bir mikroglial sitotoksik maddedir. </li></ol> 2. OGD / REOX Tedavisi <ol><li> Aspire yapışık astrosit kültürü içeren lamel medya (DIV 12 - 14) ve durulama 3 kezhafifçe lamel (mM olarak) 1 ml izotonik OGD çözeltisi (pH 7.4) bir kaç kez tutarak 24 oyuklu kültür çanak döndürerek 0 glükoz, 21 NaHCO 3, 120 NaCl, 5.36 KCI, 0.33 Na 2 HPO 4, 0.44 KH 2 PO 4, 1.27 CaCl2 ve 0.81 MgSO 4. </li><li> CO2 lamel kapak ve% 94 N2,% 1 O 2 ihtiva eden bir hipoksik inkübatörde 2 saat boyunca inkübe ve% 5 oyuğa 0.2 ml OGD solüsyonu eklenir. Yavaşça gaz değişimini kolaylaştırmak için hipoksi ilk 30 dakika boyunca orbital bir karıştırıcı (50 rpm) ile karıştırın. </li><li> 5.5 mM glukoz eklenmesi dışında OGD solüsyonuna denk bir tampon içinde% 5 CO2 ve atmosferik hava içinde, 2 saat boyunca normoksik kontrol hücrelerini inkübe edin. </li><li> ve REOX, aspirat OGD çözümü için orta kaplama astrosit 2 mL ekleyin. 5 saat boyunca 37 ° C &#39;de% 5 CO2 ve atmosferik hava içinde inkübe edin. </li></ol> 3. İmmünositokimyasal Boyama &lt;/ P&gt; <ol><li> bir vakum hattına bağlanmış bir steril cam pipet kullanılarak kültür ortamı aspire ve hızlı bir şekilde 0.1 M Tris tamponlu tuz (TBS) içinde 1 ml ekleyerek lamel kez yıkayın (154 mM NaCI, 16 mM Trizma bazı, 84 mM Tris-HCI, pH 7.4) kuyusuna. Aspire edin ve 1X fosfat tamponlu salin (PBS) içinde% 4 paraformaldehit (PFA) 2 ml. Oda sıcaklığında 15 dakika süreyle inkübe edilir. </li><li> Aspire ve 0.1 M TBS 1 ml, daha sonra 2 dakika süreyle sallanan bir sallayıcı üzerinde yerleştirin. 3 kez tekrarlayın. çözeltisi (% 10 keçi serumu, 0.1 M TBS içerisinde 10 mg / ml BSA,% 0.025 Triton X-100) bloke 1 ml ilave edilir ve sallanan bir sallayıcı üzerinde 37 ° C&#39;de 30 dakika inkübe edilir. </li><li> Aspire bloke etme çözeltisi ve primer fare monoklonal anti-GFAP antikoru ilave 60 dakika boyunca: Anti-HIF1α (200 1) veya tavşan poliklonal (1 0.2 mL: bloke etme çözeltisi 500 seyreltme) ve tavşan poliklonal anti-S100b (500 1) sallanan çalkalayıcı üzerinde 37 ° C&#39;de ilave edildi. </li><li> ve fare Pazartesi: Alternatif olarak, bazı astrositler tavşan poliklonal anti-IBA1 (200 1) ile inkübe ediliroclonal anti-MAP2 Kültür saflığı ulaşmak için. </li><li> Aspire birincil antikor ve 0.1 M TBS 1 mL eklenmesini ve 2 dakika sonra aspirasyon için bir sallanan çalkalayıcı üzerinde koyarak lamel durulayın. İki kez tekrarlayın. </li><li> sallanan çalkalayıcı üzerinde 37 ° C&#39;de 60 dakika süre ile çözelti bloke sekonder keçi anti-tavşan 488-konjuge anti-fare 568-konjüge edilmiş antikor 200 seyreltme: 1 0.2 ml ekleyin. </li><li> Aspire sekonder antikor ve 2 dakika sonra aspirasyon için bir sallanan çalkalayıcı üzerinde 0.1 M TBS 1 mL eklenmesini ve yer ile lamel durulayın. İki kez tekrarlayın. </li><li> Bir slayt-kurutucu üzerinde konumlandırılmış bir slayt üzerinde koyarak iyi ve kuru lamel çıkarın. Vectashield tek bir damla tersini yeni bir slayt Mount lamel DAPI (1.5 ng / ml) ile montaj orta hardset. </li><li> ya 20X kuru ya da 60X petrol hedefi kullanarak bir konfokal mikroskop görüntü lamelleri. DAPI (405 nm ex / 450 nm em) ve florokrom 488 görüntüleri (512 x 512) Edinme GFAP antikoru etiketli (488 nm ex / 515 nmem). 20X ve 60X grup içinde sürekli elde etme parametrelerini tutun. </li></ol> PCR kullanarak 4. Cinsiyet Tayini <ol><li> Isı yavru ayak ya da 50 mM NaOH, 45 dakika boyunca 95 ° C de parmak kırpıntıları ve 1 M Tris, pH 6.8 eşit hacmi ile nötralize. </li><li> Myog, Sry genleri için primerler 5 pmol, 1 x reaksiyon tamponu, 0.2 mM deoksinükleotid 8 U Taq polimeraz: Aşağıdaki karışım 19 uL edilen DNA çözeltisi 1 uL ekleyin. </li><li> primerleri dizilerini kullanın; Sry 5&#39;TCATGAGACTGCCAACCACAG3 &#39;5&#39;CATGACCACCACCACCACCAA3 &quot;ve Myog 5&#39;TTACGTCCATCGTGGACAGC3&#39; 5&#39;TGGGCTGGGTGTTAGTCTTA3 &#39;23. </li><li> 1 dakika boyunca 72 ° C&#39;de 15 saniye boyunca 58 ° C &#39;de 15 saniye, tavlama için 95 ° C&#39; de 3 dakika boyunca denatürasyon, sonra 30 döngü 95 ° C, ve uzama: Aşağıdaki PCR protokolü gerçekleştirin. Bu 30 döngü sonra, reaksiyon 1 dakika boyunca son bir 72 ° C uzatma ile son bulur. </li><li> ayrı PCR ürünleri elektroforetik etidyum bromür ihtiva eden% 2 agaroz jeli üzerinde ve UV aydınlatması altında görselleştirmek. (Şekil 2A.) DİKKAT! Ethidium bromür potansiyel bir kanserojen ve dikkatle ele ve kurumun düzenlemelerine uygun olarak düzgün bir şekilde bertaraf edilmelidir. </li></ol>

<ol>
	<li>Powell, E. M., Geller, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+astrocyte-mediated+cues+in+neuronal+guidance+and+process+extension.">Dissection of astrocyte-mediated cues in neuronal guidance and process extension.</a> Glia. 26, 73-83 (1999).</li><li>Koehler, R. C., Roman, R. J., Harder, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytes+and+the+regulation+of+cerebral+blood+flow.">Astrocytes and the regulation of cerebral blood flow.</a> Trends in neurosciences. 32, 160-169 (2009).</li><li>Seifert, G., Schilling, K., Steinhauser, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocyte+dysfunction+in+neurological+disorders:+a+molecular+perspective.">Astrocyte dysfunction in neurological disorders: a molecular perspective.</a> Nature reviews. Neuroscience. 7, 194-206 (2006).</li><li>Ballabh, P., Braun, A., Nedergaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+blood-brain+barrier:+an+overview:+structure,+regulation,+and+clinical+implications.">The blood-brain barrier: an overview: structure, regulation, and clinical implications.</a> Neurobiology of disease. 16, 1-13 (2004).</li><li>Araque, A., Parpura, V., Sanzgiri, R. P., Haydon, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tripartite+synapses:+glia,+the+unacknowledged+partner.">Tripartite synapses: glia, the unacknowledged partner.</a> Trends in neurosciences. 22, 208-215 (1999).</li><li>Anderson, M. A., Ao, Y., Sofroniew, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+reactive+astrocytes.">Heterogeneity of reactive astrocytes.</a> Neuroscience letters. 565, 23-29 (2014).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Na+/H++exchanger+isoform+1+is+neuroprotective+in+neonatal+hypoxic+ischemic+brain+injury.">Inhibition of Na+/H+ exchanger isoform 1 is neuroprotective in neonatal hypoxic ischemic brain injury.</a> Antioxidants &amp; redox signaling. 14, 1803-1813 (2011).</li><li>Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+brain+injury.">Neonatal brain injury.</a> The New England journal of medicine. 351, 1985-1995 (2004).</li><li>Hill, C. A., Fitch, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+differences+in+mechanisms+and+outcome+of+neonatal+hypoxia-ischemia+in+rodent+models:+implications+for+sex-specific+neuroprotection+in+clinical+neonatal+practice.">Sex differences in mechanisms and outcome of neonatal hypoxia-ischemia in rodent models: implications for sex-specific neuroprotection in clinical neonatal practice.</a> Neurol Res Int. , 1-9 (2012).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERalpha+Signaling+Is+Required+for+TrkB-Mediated+Hippocampal+Neuroprotection+in+Female+Neonatal+Mice+after+Hypoxic+Ischemic+Encephalopathy(1,2,3).">ERalpha Signaling Is Required for TrkB-Mediated Hippocampal Neuroprotection in Female Neonatal Mice after Hypoxic Ischemic Encephalopathy(1,2,3).</a> eNeuro. 3, (2016).</li><li>Uluc, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TrkB+receptor+agonist+7,+8+dihydroxyflavone+triggers+profound+gender-+dependent+neuroprotection+in+mice+after+perinatal+hypoxia+and+ischemia.">TrkB receptor agonist 7, 8 dihydroxyflavone triggers profound gender- dependent neuroprotection in mice after perinatal hypoxia and ischemia.</a> CNS Neurol Disord Drug Targets. 12, 360-370 (2013).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+microglia+activation+after+hypoxia-ischemia+results+in+age-dependent+improvements+in+neurologic+injury.">Suppression of microglia activation after hypoxia-ischemia results in age-dependent improvements in neurologic injury.</a> J Neuroimmunol. 291, 18-27 (2016).</li><li>McQuillen, P. S., Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+vulnerability+in+the+developing+central+nervous+system.">Selective vulnerability in the developing central nervous system.</a> Pediatr Neurol. 30, 227-235 (2004).</li><li>Morken, T. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+astrocyte-neuronal+interactions+after+hypoxia-ischemia+in+the+neonatal+brain+in+female+and+male+rats.">Altered astrocyte-neuronal interactions after hypoxia-ischemia in the neonatal brain in female and male rats.</a> Stroke; a journal of cerebral circulation. 45, 2777-2785 (2014).</li><li>Chisholm, N. C., Sohrabji, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytic+response+to+cerebral+ischemia+is+influenced+by+sex+differences+and+impaired+by+aging.">Astrocytic response to cerebral ischemia is influenced by sex differences and impaired by aging.</a> Neurobiology of disease. 85, 245-253 (2016).</li><li>Liu, M., Oyarzabal, E. A., Yang, R., Murphy, S. J., Hurn, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+assessing+sex-specific+and+genotype-specific+response+to+injury+in+astrocyte+culture.">A novel method for assessing sex-specific and genotype-specific response to injury in astrocyte culture.</a> Journal of neuroscience methods. 171, 214-217 (2008).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+biological+contributions+to+human+health:+does+sex+matter?.">Exploring the biological contributions to human health: does sex matter?.</a> Journal of women's health &amp; gender-based. 10, 433-439 (2001).</li><li>Collins, F. S., Tabak, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Policy:+NIH+plans+to+enhance+reproducibility.">Policy: NIH plans to enhance reproducibility.</a> Nature. 505, 612-613 (2014).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78, 785-798 (2013).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+Na+/H++exchanger+activation+promotes+gliotransmitter+release+from+reactive+hippocampal+astrocytes+following+oxygen-glucose+deprivation.">Sustained Na+/H+ exchanger activation promotes gliotransmitter release from reactive hippocampal astrocytes following oxygen-glucose deprivation.</a> PloS one. 9, e84294 (2014).</li><li>Landis, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+call+for+transparent+reporting+to+optimize+the+predictive+value+of+preclinical+research.">A call for transparent reporting to optimize the predictive value of preclinical research.</a> Nature. 490, 187-191 (2012).</li><li>Hamby, M. E., Uliasz, T. F., Hewett, S. J., Hewett, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+an+improved+procedure+for+the+removal+of+microglia+from+confluent+monolayers+of+primary+astrocytes.">Characterization of an improved procedure for the removal of microglia from confluent monolayers of primary astrocytes.</a> J Neurosci Methods. 150, 128-137 (2006).</li><li>McClive, P. J., Sinclair, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+DNA+extraction+and+PCR-sexing+of+mouse+embryos.">Rapid DNA extraction and PCR-sexing of mouse embryos.</a> Molecular reproduction and development. 60, 225-226 (2001).</li><li>Wolterink-Donselaar, I. G., Meerding, J. M., Fernandes, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gender+determination+in+newborn+dark+pigmented+mice.">A method for gender determination in newborn dark pigmented mice.</a> Lab Anim (NY). 38, 35-38 (2009).</li><li>Uliasz, T. F., Hamby, M. E., Jackman, N. A., Hewett, J. A., Hewett, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+primary+astrocyte+cultures+devoid+of+contaminating+microglia.">Generation of primary astrocyte cultures devoid of contaminating microglia.</a> Methods Mol Biol. 814, 61-79 (2012).</li><li>Raponi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=S100B+expression+defines+a+state+in+which+GFAP-expressing+cells+lose+their+neural+stem+cell+potential+and+acquire+a+more+mature+developmental+stage.">S100B expression defines a state in which GFAP-expressing cells lose their neural stem cell potential and acquire a more mature developmental stage.</a> Glia. 55, 165-177 (2007).</li><li>Souza, D. G., Bellaver, B., Souza, D. O., Quincozes-Santos, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+adult+rat+astrocyte+cultures.">Characterization of adult rat astrocyte cultures.</a> PloS one. 8, e60282 (2013).</li><li>Puschmann, T. B., Dixon, K. J., Turnley, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+differences+in+reactivity+of+mouse+and+rat+astrocytes+in+vitro.">Species differences in reactivity of mouse and rat astrocytes in vitro.</a> Neuro-Signals. 18, 152-163 (2010).</li><li>Schildge, S., Bohrer, C., Beck, K., Schachtrup, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+mouse+cortical+astrocytes.">Isolation and culture of mouse cortical astrocytes.</a> Journal of visualized experiments : JoVE. , (2013).</li><li>Saura, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglial+cells+in+astroglial+cultures:+a+cautionary+note.">Microglial cells in astroglial cultures: a cautionary note.</a> J Neuroinflammation. 4 (26), (2007).</li></ol>

yazarların hiçbiri rakip veya çakışan çıkarları var.

Fizyolojik ve patolojik koşullar altında astrositlerin cinsiyet özelliklerinin farklılıkları ve fonksiyon çalışma için, hücre kültürü içinde cinsiyette primer astrositler hazırlanması kullanılması için önemli bir araçtır. Bu çalışmada in vitro yenidoğan cinsiyetli hipokampal astrosit yüksek zenginleştirilmiş homojen nüfus (P0-P2) C57BL / 6 (vahşi tip) veya K19F (GFAP null) fare yavrular bir yüksek verimli ve kültürüne bir tekrarlanabilir bir yöntem sunduk. Bu metodoloji olu?...

Astrositler merkezi sinir sistemi (MSS) en önemli anahtar oyunculardan biri bulunmaktadır. kanıt Büyüyen vücut astrositlerin rolleri nöronal destek sağlama daha olduğunu gösterir. Aslında, fizyolojik koşullar altında astrositlerin rolleri gibi, merkezi sinir sistemi, kan akışını düzenleyen 2, gelişmekte olan aksonlar 1 göçünü yol sinaptik dokulararası sıvının 3 pH homeostazını sürdürmek ve kan-beyin bariyerinin katılmak gibi çok karmaşık olabilir 4 ve sinaptik iletim 5. Patolojik koşullar altında, astrositler astrositler ve fonksiyon (zedelenmesinden mesafeye göre) morfolojisi, sayı, yer, topografya heterojen bir şekilde 6,7 değişebilir olan reaktif astrogliasis adı verilen bir işlem ile hasara yanıt. belki yenidoğanların morbidite ve mortalite katkıda yenidoğan hipoksik iskemik ensefalopati aşağıdaki görüldü astrogliasis <s&gt; 8 yukarı. Son klinik ve deneysel çalışmalar, beyin hasarı şiddeti ile karşılaştırıldığında erkek yenidoğanlarda daha ciddi nörolojik sonuçlara neden hipoksi / iskemi (HI) ile ilgili beyin hasarı etkilerine daha duyarlı olduğunu seks bağımlı gibi görünüyor ve olduğunu göstermektedir karşılaştırılabilir beyin yaralanması 9-11 ile kadın. Yaralanma lokalizasyonu gestasyonel yaş ve süresi ve hakaret şiddetine bağlıdır rağmen, hipokampus dönem yenidoğan HI sonra MSS en çok etkilenen bölgelerden biri olan ve hipokampal astrogliasis up-regülasyonu ile teyit edilmiştir arttı Glial fibriller asidik protein (GFAP) yenidoğan HI 7,10,12,13 sonra 3 gün. Astrosit fonksiyonunda cinsiyet farklılıkları serebral iskemi 14,15 sonrasında yenidoğanlarda ve yetişkin kemirgenlerde gösterilmiştir. Buna ek olarak, in vitro iskemi erkek astrositik hassasiyeti yükselttiği cel ile gösterilmiştirKültür 16 dişi kortikal astrositler göre l ölümü. Cinsiyet farklılıkları in utero başlar ve ölüm 17 kadar devam eder. Son on yılda, hücre kültürü ve in vivo çalışmalarda deneysel koşullarda cinsiyete dahil önemi Tıp ve NIH Enstitüsü vurgu fizyolojik ve patolojik durumlarda 17,18 görülen cinsiyet farklılıkları temel bilgiyi aramak olmuştur . yalıtmak ve cinsiyette hipokampal astrosit popülasyonlarının korumak için güvenilir yöntemlerin geliştirilmesi neonatal HI patolojik sonuçları cinsiyet farklılıklarının hücresel temelini anlamak için esastır. Bu çalışma Oksijen / Glikoz Yoksunluk (OGD) ve reoksijenasyon (REOX), indükleyici aşağıdaki GFAP-immünoreaktif astrositler rollerini değerlendirmek için yeni doğmuş farelerden zenginleştirilmiş cinsiyete özgü hipokampal astrosit kültürleri hazırlamak için teknikler sağlamak için tasarlanmıştırHücre kültürü ortamı, HI. Bu teknik normoksik ve iskemik koşullarda yenidoğan kadın ve erkeklerde hipokampal astrositler ile ilgili tüm hipotezi test etmek için kullanılabilir.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Astrocyte culture media</td>
		</tr>
		<tr>
			<td>DMEM, high glucose</td>
			<td>cellgro</td>
			<td>10-013-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Horse serum</td>
			<td>Gibco</td>
			<td>26050-070</td>
			<td>Final Concentration: 10%</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin</td>
			<td>Cellgro&#160;</td>
			<td>30-002-CI</td>
			<td>Final Concentration: 1%</td>
		</tr>
		<tr>
			<td rowspan="2">L-Leucine methyl ester hydrochloride</td>
			<td rowspan="2">Aldrich</td>
			<td rowspan="2">L1002-25G</td>
			<td rowspan="2">Final Concentration: 5 mM</td>
		</tr>
		<tr>
		</tr>
		<tr>
			<td colspan="4">Solution for brain tissue digestion</td>
		</tr>
		<tr>
			<td>HBSS</td>
			<td>Life Technologies</td>
			<td>14170-088</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin</td>
			<td>cellgro</td>
			<td>25-050-CI</td>
			<td>Final Concentration: 0.25%</td>
		</tr>
		<tr>
			<td colspan="4">Other</td>
		</tr>
		<tr>
			<td>70% (vol/vol) ethanol</td>
			<td>Roth</td>
			<td>9065.2</td>
			<td></td>
		</tr>
		<tr>
			<td>Poly-D-Lysine 12mm round coverslips&#160;</td>
			<td>Corning</td>
			<td>354087</td>
			<td></td>
		</tr>
		<tr>
			<td>Water</td>
			<td>Sigma</td>
			<td>W3500</td>
			<td>cell culture grade</td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>cellgro</td>
			<td>21-040-CV</td>
			<td>cell culture grade</td>
		</tr>
		<tr>
			<td>0.05% Trypsin-EDTA&#160;</td>
			<td>Life Technologies</td>
			<td>25300-062</td>
			<td></td>
		</tr>
		<tr>
			<td>70 &#956;m Sterile cell strainer&#160;</td>
			<td>Fisher scientific</td>
			<td>22363548</td>
			<td></td>
		</tr>
		<tr>
			<td>3.5 cm petri dish</td>
			<td>BD Falcon</td>
			<td>353001</td>
			<td></td>
		</tr>
		<tr>
			<td>15 ml Falcon tube</td>
			<td>BD Falcon</td>
			<td>352096</td>
			<td></td>
		</tr>
		<tr>
			<td>50 ml Falcon tube</td>
			<td>BD Falcon</td>
			<td>352070</td>
			<td></td>
		</tr>
		<tr>
			<td>Forceps, fine&#160;</td>
			<td>Dumont</td>
			<td>2-1032; 2-1033</td>
			<td># 3c; # 5</td>
		</tr>
		<tr>
			<td>Forceps, flat tip</td>
			<td>KLS Martin</td>
			<td>12-120-11</td>
			<td></td>
		</tr>
		<tr>
			<td>13 cm surgical scissors</td>
			<td>Aesculap</td>
			<td>BC-140-R</td>
			<td></td>
		</tr>
		<tr>
			<td>Confocal Microscope</td>
			<td>Nikon</td>
			<td>A1RSi&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5805000.017</td>
			<td>Centrifuge5804R</td>
		</tr>
		<tr>
			<td>Orbital Shaker</td>
			<td>Thermo Scientific</td>
			<td>SHKE 4450-1CE</td>
			<td>MaxQ 4450&#160;</td>
		</tr>
		<tr>
			<td>Anti-IBA1</td>
			<td>Wako</td>
			<td>019-19741</td>
			<td>Rabbit monoclonal</td>
		</tr>
		<tr>
			<td>Anti-MAP2</td>
			<td>Sigma</td>
			<td>M2320</td>
			<td>Mouse monoclonal</td>
		</tr>
		<tr>
			<td>Anti-HIF1alpha</td>
			<td>abcam</td>
			<td>ab179483</td>
			<td>rabbit monoclonal</td>
		</tr>
		<tr>
			<td>Anti-S100B</td>
			<td>Sigma</td>
			<td>HPA015768</td>
			<td>Rabbit polyclonal</td>
		</tr>
		<tr>
			<td>Anti-GFAP (cocktail)</td>
			<td>Biolegend</td>
			<td>837602</td>
			<td></td>
		</tr>
		<tr>
			<td>VECTASTAIN Elite ABC Kit (Rabbit IgG)</td>
			<td>Vector Labs</td>
			<td>PK-6101</td>
			<td>Contains 4 Reagents&#160;</td>
		</tr>
		<tr>
			<td>Goat Anti Rabbit Alexa-Fluor 488</td>
			<td>Invitrogen</td>
			<td>A11070</td>
			<td></td>
		</tr>
		<tr>
			<td>Goat Anti Mouse Alexa-Fluor 568</td>
			<td>Invitrogen</td>
			<td>A11004</td>
			<td></td>
		</tr>
	</tbody>
</table>

sex differences in mouse hippocampal astrocytes after in-vitro ischemia

hipoksi / iskemi (HI) ile ilgili beyin hasarını takiben astrogliasis yenidoğanlarda artmış morbidite ve mortalite bir rol oynar. Son klinik çalışmalar beyin hasarının şiddeti seks bağımlı gibi görünen gösterir ve erkek yenidoğanlarda karşılaştırılabilir beyin hasarı olan kadınlara kıyasla daha ciddi nörolojik sonuçlara yol açan, HI-ilişkili beyin hasarının etkilerine daha duyarlı olduğunu. yalıtmak ve cinsiyette hipokampal astrosit zenginleştirilmiş popülasyonları korumak için güvenilir yöntemlerin geliştirilmesi neonatal HI patolojik sonuçları cinsiyet farklılıklarının hücresel temelini anlamak için esastır. Bu çalışmada, reoksijenasyonun ardından in vitro iskemi, oksijen glukoz yoksunluk bir model maruz cinsiyete spesifik hipokampal astrosit kültürleri oluşturmak için bir yöntem tarif eder. Daha sonra reaktif astrogliasis immunostai ile incelendiGlial fibriller asidik protein (GFAP) ve S100B için Ning. Bu yöntem ayrıca, yenidoğan HI aşağıdaki erkek ve kadın hipokampal astrositler rolünü incelemek için yararlı bir araç sağlar.

Fizyolojik veya patofizyolojik koşullarda cinsiyetli astrosit fonksiyonlarının rolleri anlamak gayet in vitro koşullarda bu kültür hücreleri tarafından da elde edilmiştir. cinsiyetli Kültürleme gerçekleştirme önemli yönü önce kullanımına fare yavru seks belirlemektir. Biz genetik olarak PCR ile ve görsel değerlendirilmesi (Şekil 2) 16 ile fare seks belirlendi. PCR kullanılarak cinsiyet tayini metodolojisi McClive ve Sinclair gel...

Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Astrositler merkezi sinir sistemi (MSS) en önemli anahtar oyunculardan biri bulunmaktadır. Burada, sonra in vitro iskemi erkek ve kadın yeni doğan yavrular astrosit fonksiyonu altında yatan mekanizmaları araştırmak için cinsiyetli hipokampal astrosit kültürü protokolünün pratik bir yöntem bildiriliyor.

Fare Hipokampal Astrositler Seks Farkları sonra<em&gt; In-Vitro</em&gt; İskemi

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies ...

sex-differences-mouse-hippocampal-astrocytes-after-vitro

Research

JoVE Journal

Neuroscience

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

13.3K Görüntüleme.  University of Wisconsin.  Astrositler merkezi sinir sistemi (MSS) en önemli anahtar oyunculardan biri bulunmaktadır. Burada, sonra in vitro iskemi erkek ve kadın yeni doğan yavrular astrosit fonksiyonu altında yatan mekanizmaları araştırmak için cinsiyetli hipokampal astrosit kültürü protokolünün pratik bir yöntem bildiriliyor. 

Video: Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Fluorescence Recovery After Photobleaching (FRAP) of Fluorescence Tagged Proteins in Dendritic Spines of Cultured Hippocampal Neurons

FRAP has been used to quantify the mobility of GFP-tagged proteins. Using a strong excitation laser, the fluorescence of a GFP-tagged protein is bleached in the region of interest. The fluorescence of the region recovers when the unbleached GFP-tagged protein from outside of the region diffuses into the region of interest. The mobility of the protein is then analyzed by measuring the fluorescence recovery rate. This technique could be used to characterize protein mobility and turnover rate.
In this study, we express the (enhanced green fluorescent protein) EGFP vector in cultured hippocampal neurons. Using the Zeiss 710 confocal microscope, we photobleach the fluorescence signal of the GFP protein in a single spine, and then take time lapse images to record the fluorescence recovery after photobleaching. Finally, we estimate the percentage of mobile and immobile fractions of the GFP in spines, by analyzing the imaging data using ImageJ and Graphpad softwares.
This FRAP protocol shows how to perform a basic FRAP experiment as well as how to analyze the data.

Fluorescence Recovery After Photobleaching FRAP of Fluorescence Tagged Proteins in Dendritic Spines of Cultured Hippocampal Neurons

FRAP has been used to quantify the mobility of Green Fluorescence Protein (GFP)-tagged proteins in cultured cells. We examined the mobile/immobile fractions of the GFP by analyzing the fluorescence recovery percentage after photobleaching. In this study, FRAP was performed at spines of hippocampal neurons.

Kültür Hipokampal Nöronlar Dendritik Spine Floresan Takip edilen Proteinler Photobleaching sonra Floresan Kurtarma (sıkı bağlamak)

FRAP has been used to quantify the mobility of GFP-tagged proteins. Using a strong excitation laser, the fluorescence of a GFP-tagged protein is bleached ...

Nörobilim

Dual Electrophysiological Recordings of Synaptically-evoked Astroglial and Neuronal Responses in Acute Hippocampal Slices

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs through activation of their ion channels and neurotransmitter receptors, and process information in part through activity-dependent release of gliotransmitters. Furthermore, astrocytes constitute the main uptake system for glutamate, contribute to potassium spatial buffering, as well as to GABA clearance. These cells therefore constantly monitor synaptic activity, and are thereby sensitive indicators for alterations in synaptically-released glutamate, GABA and extracellular potassium levels. Additionally, alterations in astroglial uptake activity or buffering capacity can have severe effects on neuronal functions, and might be overlooked when characterizing physiopathological situations or knockout mice. Dual recording of neuronal and astroglial activities is therefore an important method to study alterations in synaptic strength associated to concomitant changes in astroglial uptake and buffering capacities. Here we describe how to prepare hippocampal slices, how to identify stratum radiatum astrocytes, and how to record simultaneously neuronal and astroglial electrophysiological responses. Furthermore, we describe how to isolate pharmacologically the synaptically-evoked astroglial currents.

The preparation of acute brain slices from isolated hippocampi, as well as the simultaneous electrophysiological recordings of astrocytes and neurons in stratum radiatum during stimulation of schaffer collaterals is described. The pharmacological isolation of astroglial potassium and glutamate transporter currents is demonstrated.

Akut Hipokampal Dilimler içinde Synaptically-uyarılmış astroglial ve Nöronal Cevaplarının İkili Elektrofizyolojik Kayıtlar

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs ...

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Fare Kortikal astrositlerde İzolasyon ve Kültür

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms responsible for those differences remain unclear. Primary disassociated embryonic neuronal culture provides a simplified experimental model with which to investigate the neuronal cell signaling involved in cell death as a result of ischemia or disease; however, most neuronal cultures used in research today are mixed sex. Researchers can and do test the effects of sex steroid treatment in mixed sex neuronal cultures in models of neuronal injury and disease, but accumulating evidence suggests that the female brain responds to androgens, estrogens, and progesterone differently than the male brain. Furthermore, neonate male and female rodents respond differently to ischemic injury, with males experiencing greater injury following cerebral ischemia than females. Thus, mixed sex neuronal cultures might obscure and confound the experimental results; important information might be missed. For this reason, the Herson Lab at the University of Colorado School of Medicine routinely prepares sex-stratified primary disassociated embryonic neuronal cultures from both hippocampus and cortex. Embryos are sexed before harvesting of brain tissue and male and female tissue are disassociated separately, plated separately, and maintained separately. Using this method, the Herson Lab has demonstrated a male-specific role for the ion channel TRPM2 in ischemic cell death. In this manuscript, we share and discuss our protocol for sexing embryonic mice and preparing sex-stratified hippocampal primary disassociated neuron cultures. This method can be adapted to prepare sex-stratified cortical cultures and the method for embryo sexing can be used in conjunction with other protocols for any study in which sex is thought to be an important determinant of outcome.

Primary disassociated embryonic hippocampal neuronal cultures are useful for investigating the signaling mechanisms involved in neuron death. Sexing the embryos before the isolation and dissociation of the hippocampus allows the preparation of separate male and female cultures, which enables the researcher to identify and investigate sex-specific cell signaling.

İskemik Hücre Ölümü Pathways Eğitim için seks Katmanlı Nöronal Kültürleri

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms ...

Modeling Astrocytoma Pathogenesis In Vitro and In Vivo Using Cortical Astrocytes or Neural Stem Cells from Conditional, Genetically Engineered Mice

Current astrocytoma models are limited in their ability to define the roles of oncogenic mutations in specific brain cell types during disease pathogenesis and their utility for preclinical drug development. In order to design a better model system for these applications, phenotypically wild-type cortical astrocytes and neural stem cells (NSC) from conditional, genetically engineered mice (GEM) that harbor various combinations of floxed oncogenic alleles were harvested and grown in culture. Genetic recombination was induced in vitro using adenoviral Cre-mediated recombination, resulting in expression of mutated oncogenes and deletion of tumor suppressor genes. The phenotypic consequences of these mutations were defined by measuring proliferation, transformation, and drug response in vitro. Orthotopic allograft models, whereby transformed cells are stereotactically injected into the brains of immune-competent, syngeneic littermates, were developed to define the role of oncogenic mutations and cell type on tumorigenesis in vivo. Unlike most established human glioblastoma cell line xenografts, injection of transformed GEM-derived cortical astrocytes into the brains of immune-competent littermates produced astrocytomas, including the most aggressive subtype, glioblastoma, that recapitulated the histopathological hallmarks of human astrocytomas, including diffuse invasion of normal brain parenchyma. Bioluminescence imaging of orthotopic allografts from transformed astrocytes engineered to express luciferase was utilized to monitor in vivo tumor growth over time. Thus, astrocytoma models using astrocytes and NSC harvested from GEM with conditional oncogenic alleles provide an integrated system to study the genetics and cell biology of astrocytoma pathogenesis in vitro and in vivo and may be useful in preclinical drug development for these devastating diseases.

Modeling Astrocytoma Pathogenesis In Vitro and In Vivo Using Cortical Astrocytes or Neural Stem Cells from Conditional, Genetically Engineered Mice

Phenotypically wild-type astrocytes and neural stem cells harvested from mice engineered with floxed, conditional oncogenic alleles and transformed via viral Cre-mediated recombination can be used to model astrocytoma pathogenesis in vitro and in vivo by orthotopic injection of transformed cells into brains of syngeneic, immune-competent littermates.

Modelleme Astrositom Patogenez<em&gt; İn Vitro</em&gt; Ve<em&gt; In Vivo</em&gt; Kortikal Astrositler veya Şartlı, Genetiği fareler ile Nöral Kök Hücreler kullanma

Current astrocytoma models are limited in their ability to define the roles of oncogenic mutations in specific brain cell types during disease ...

Immunohistochemical Visualization of Hippocampal Neuron Activity After Spatial Learning in a Mouse Model of Neurodevelopmental Disorders

Induction of phosphorylated extracellular-regulated kinase (pERK) is a reliable molecular readout of learning-dependent neuronal activation. Here, we describe a pERK immunohistochemistry protocol to study the profile of hippocampal neuron activation following exposure to a spatial learning task in a mouse model characterized by cognitive deficits of neurodevelopmental origin. Specifically, we used pERK immunostaining to study neuronal activation following Morris water maze (MWM, a classical hippocampal-dependent learning task) in Engrailed-2 knockout (En2-/-) mice, a model of autism spectrum disorders (ASD). As compared to wild-type (WT) controls, En2-/- mice showed significant spatial learning deficits in the MWM. After MWM, significant differences in the number of pERK-positive neurons were detected in specific hippocampal subfields of En2-/- mice, as compared to WT animals. Thus, our protocol can robustly detect differences in pERK-positive neurons associated to hippocampal-dependent learning impairment in a mouse model of ASD. More generally, our protocol can be applied to investigate the profile of hippocampal neuron activation in both genetic or pharmacological mouse models characterized by cognitive deficits.

We describe an immunohistochemistry protocol to study the profile of hippocampal neuron activation following exposure to a spatial learning task in a mouse model characterized by cognitive deficits of neurodevelopmental origin. This protocol can be applied to both genetic or pharmacological mouse models characterized by cognitive deficits.

Nörogelişimsel Bozukluklar Fare Modeli Mekansal Öğrenme ardından Hipokampal Nöron Faaliyet immünohistokimyasal Görselleştirme

Induction of phosphorylated extracellular-regulated kinase (pERK) is a reliable molecular readout of learning-dependent neuronal activation. Here, we ...

Protocol for Three-dimensional Confocal Morphometric Analysis of Astrocytes

As glial cells in the brain, astrocytes have diverse functional roles in the central nervous system. In the presence of harmful stimuli, astrocytes modify their functional and structural properties, a condition called reactive astrogliosis. Here, a protocol for assessment of the morphological properties of astrocytes is presented. This protocol includes quantification of 12 different parameters i.e. the surface area and volume of the tissue covered by an astrocyte (astrocyte territory), the entire astrocyte including branches, cell body, and nucleus, as well as total length and number of branches, the intensity of fluorescence immunoreactivity of antibodies used for astrocyte detection, and astrocyte density (number/1,000 &#181;m2). For this purpose three-dimensional (3D) confocal microscopic images were created, and 3D image analysis software such as Volocity 6.3 was used for measurements. Rat brain tissue exposed to amyloid beta1-40 (A&#946;1-40) with or without a therapeutic&#160;intervention was used to present the method. This protocol can also be used for 3D morphometric analysis of other cells from either in vivo or in vitro conditions.

Astrocytes in the CNS change their functional and structural properties in response to harmful stimuli. This report presents a protocol for assessment of three-dimensional astrocyte morphology in diseased conditions or after therapeutic interventions.

Astrositler Üç boyutlu Konfokal Morfometrik Analizi Protokolü

As glial cells in the brain, astrocytes have diverse functional roles in the central nervous system. In the presence of harmful stimuli, astrocytes modify ...

Tuning in the Hippocampal Theta Band In Vitro: Methodologies for Recording from the Isolated Rodent Septohippocampal Circuit

This protocol outlines the procedures for preparing and recording from the isolated whole hippocampus, of WT and transgenic mice, along with recent improvements in methodologies and applications for the study of theta oscillations. A simple characterization of the isolated hippocampal preparation is presented whereby the relationship between internal hippocampal theta oscillators is examined together with the activity of pyramidal cells, and GABAergic interneurons, of the cornu ammonis-1 (CA1) and subiculum (SUB) areas. Overall, we show that the isolated hippocampus is capable of generating intrinsic theta oscillations in vitro and that rhythmicity generated within the hippocampus can be precisely manipulated by optogenetic stimulation of parvalbumin-positive (PV) interneurons. The in vitro isolated hippocampal preparation offers a unique opportunity to use simultaneous field and intracellular patch-clamp recordings from visually-identified neurons to better understand the mechanisms underlying theta rhythm generation.

Tuning in the Hippocampal Theta Band In Vitro: Methodologies for Recording from the Isolated Rodent Septohippocampal Circuit

Here, we present a protocol for recording rhythmic neuronal network theta and gamma oscillations from an isolated whole hippocampal preparation. We describe the experimental steps from extraction of the hippocampus to details of field, unitary and whole-cell patch clamp recordings as well as optogenetic pacing of the theta rhythm.

Hipokampal Theta Bandında Tuning<em&gt; In vitro</em&gt;: İzole edilmiş Kemirgen Protokokal Circüse Kayıt için Metodolojiler

This protocol outlines the procedures for preparing and recording from the isolated whole hippocampus, of WT and transgenic mice, along with recent ...

In Utero Electroporation of Multiaddressable Genome-Integrating Color (MAGIC) Markers to Individualize Cortical Mouse Astrocytes

Protoplasmic astrocytes (PrA) located in the mouse cerebral cortex are tightly juxtaposed, forming an apparently continuous three-dimensional matrix at adult stages. Thus far, no immunostaining strategy can single them out and segment their morphology in mature animals and over the course of corticogenesis. Cortical PrA originate from progenitors located in the dorsal pallium and can easily be targeted using in utero electroporation of integrative vectors. A protocol is presented here to label these cells with the multiaddressable genome-integrating color (MAGIC) Markers strategy, which relies on piggyBac/Tol2 transposition and Cre/lox recombination to stochastically express distinct fluorescent proteins (blue, cyan, yellow, and red) addressed to specific subcellular compartments. This multicolor fate mapping strategy enables to mark in situ nearby cortical progenitors with combinations of color markers prior to the start of gliogenesis and to track their descendants, including astrocytes, from embryonic to adult stages at the individual cell level. Semi-sparse labeling achieved by adjusting the concentration of electroporated vectors and color contrasts provided by the Multiaddressable Genome-Integrating Color Markers (MAGIC Markers or MM) enable to individualize astrocytes and single out their territory and complex morphology despite their dense anatomical arrangement. Presented here is a comprehensive experimental workflow including the details of the electroporation procedure, multichannel image stacks acquisition by confocal microscopy, and computer-assisted three-dimensional segmentation that will enable the experimenter to assess individual PrA volume and morphology. In summary, electroporation of MAGIC Markers provides a convenient method to individually label numerous astrocytes and gain access to their anatomical features at different developmental stages. This technique will be useful to analyze cortical astrocyte morphological properties in various mouse models without resorting to complex crosses with transgenic reporter lines.

In Utero Electroporation of Multiaddressable Genome-Integrating Color MAGIC Markers to Individualize Cortical Mouse Astrocytes

Astrocytes tile the cerebral cortex uniformly, making the analysis of their complex morphology challenging at the cellular level. The protocol provided here uses multicolor labeling based on in utero electroporation to single out cortical astrocytes and analyze their volume and morphology with a user-friendly image analysis pipeline.

Kortikal Fare Astrositlerini Bireyselleştirmek için Çok Elbiseli Genom Bütünleştirici Renk (MAGIC) İşaretçilerinin Utero Elektroporasyonunda

Protoplasmic astrocytes (PrA) located in the mouse cerebral cortex are tightly juxtaposed, forming an apparently continuous three-dimensional matrix at ...

Neuronal Differentiation from Mouse Embryonic Stem Cells In vitro

The neural differentiation of mouse embryonic stem cells (mESCs) is a potential tool for elucidating the key mechanisms involved in neurogenesis and potentially aid in regenerative medicine. Here, we established an efficient and low cost method for neuronal differentiation from mESCs in vitro, using the strategy of combinatorial screening. Under the conditions defined here, the 2-day embryoid body formation + 6-day retinoic acid induction protocol permits fast and efficient differentiation from mESCs into neural precursor cells (NPCs), as seen by the formation of well-stacked and neurite-like A2lox and 129 derivatives that are Nestin positive. The healthy state of embryoid bodies and the timepoint at which retinoic acid (RA) is applied, as well as the RA concentrations, are critical in the process. In the subsequent differentiation from NPCs into neurons, N2B27 medium II (supplemented by Neurobasal medium) could better support the long term maintenance and maturation of neuronal cells. The presented method is highly efficiency, low cost and easy to operate, and can be a powerful tool for neurobiology and developmental biology research.

Here, we established a low cost and easy to operate method that directs fast and efficient differentiation from embryonic stem cells into neurons. This method is suitable for popularization among laboratories and can be a useful tool for neurological research.

Fare Embriyonik Kök Hücre in vitro nöronal farklılaşma

The neural differentiation of mouse embryonic stem cells (mESCs) is a potential tool for elucidating the key mechanisms involved in neurogenesis and ...