Name: sex differences in mouse hippocampal astrocytes after in-vitro ischemia
Uploaded: 2016-10-25T12:30:00.000+00:00
Duration: 8 min 32 s
Description: Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Clinical and Translational Science Award program of NCATS UL1 TR0000427 and KL2 TR000428 (Cengiz P), UL1TR000427 to the UW ICTR from NIH/NCATS and funds from Waisman Center (Cengiz P), K08 NS088563-01A1 from NINDS (Cengiz P) and NIH P30 HD03352 (Waisman Center), NIH/NINDS 1K08NS078113 (Ferrazzano P). We would like to thank Albee Messing, PhD, for providing us the GFAP knockout mice.

Not: Bu çalışma Ulusal Sağlık Enstitüsü Laboratuvar Hayvanları Bakım için Kılavuz önerisi ve Kullanımına uygun olarak gerçekleştirilmiştir. hayvan protokolü Wisconsin-Madison, Kurumsal Hayvan Bakımı ve Kullanımı Komitesi Üniversitesi tarafından onaylanmıştır. Burada sunulan birincil Astrosit Kültür protokolü Zhang Y 19 vd. Ve Cengiz P 20 vd tarafından sunulan protokolleri kabul edilir. Bazı değişikliklerle. 1. Hipokampal Diseksiyon ve Astrosit Kültür <ol><li> 2 ml Hank Dengeli Tuz Çözeltisi (HBSS) her ile dolu buz üzerinde cerrahi makas, düz ince forseps, düz uçlu forseps, kağıt havlu, çöp torbası,% 70 etanol ve 2 diseksiyon yemekler (3.5 cm çapında) de dahil olmak üzere gerekli tüm reaktifleri ve materyalleri hazırlamak . Emin olun cerrahi aletler en vardır (otoklav) prosedür öncesinde ve Astrosit orta kaplama (tüm diğer malzemeleri kullanın steril: DMEM +% 5 at serumu +% 1 ön steril olarak penisilin-streptomisin, at serumu, HBSS,% 0.25 tripsin, cam lamelleri, petri, 15/50 ml tüpler, T25 şişeleri, vs.). </li><li> Yavaşça tutun ve% 70 etanol ile baş ve fare yavru boyun sprey ve keskin steril makas kullanarak decapitate [Şekil 1 (1)]. </li><li> Beyin [Şekil 1 (2-3)] maruz derisi boyunca küçük makas ile kafatası anterior posterior orta hat kesi gerçekleştirin. </li><li> küçük makas ile burun boyun dikkatle kafatası kesti. Sonra kafa tabanı kafatası kesmek için beyincik için kafatası koku ampuller anterior ve inferior kesti. </li><li> Kafatasının dibinde küçük bir kesi yapmak ve orta hat boyunca kesilir. kafatasını uzak soyma steril düz uçlu forseps kullanabilir. kavisli bir forseps yardımıyla beyin sapı çıkarın. Kafatası beyin çıkarın ve birinci diseksiyon çanak içine yerleştirin [Şekil 1 (4-9)] 21. </li><li> Kavisli bir forseps kullanarak, beynin ventral yüzeyi yukarı bakacak şekilde beyin çevirin ve daha sonra keskin bir steril cerrahi bıçak [Şekil 1 (10,11)] ile her iki yarımkürede ayrı </li><li> Peel geri serebral hemisfer ve dikkatle hipokampus, medial temporal lob [Şekil 1 (12-14)], küçük bir denizatı şeklindeki yapıyı ortaya çıkarmak için steril bir düz kavisli bir forseps ile şişkin orta beyin ve talamik doku kaldırmak. </li><li> Hem hipokampal lobu [Şekil 1 (15,16)] çıkartın ve dikkatlice ince forseps ile çekerek lob gelen meninksler incelemek. Bu adım Meningeal hücreleri ve fibroblastlar tarafından nihai astrosit kültürü kirlenmesini önler. </li><li> HBSS ile dolu ikinci çanak içine hazırlanmış hipokampal lobları aktarın ve buz [Şekil 1 (17,18)] üzerine geri. hippo hazırlanması için - tek bir fare Pool hem hipokampal lob (P2 P0)campal astrosit kültürleri. Bu astrosit uygun yoğunluğunu verir. Keskin steril cerrahi bıçak (yaklaşık 4 kat) kullanarak hipokampal lobları kıyma. </li><li> Aspire HBSS, 15 ml steril konik tüp transferi ve yavaşça çalkalanarak 20 dakika boyunca 37 ° C&#39;de doku inkübe, karıştırın, çanak 1 ml pipet bağlanmış bir steril bir ucunu kullanarak ve% 0.25 tripsin 3 ml. </li><li> 5 dakika boyunca 300 xg&#39;de santrifüj tüpü. Aspire süpernatan dikkatle bir vakum hattına bağlanmış bir steril bir cam pipet kullanılarak. (- 30 kez 20) doku parçaları homojenize kadar yangın parlatılmış cam pipet kullanarak orta ve çiğnemek kaplama 10 ml astrocyte ekleyin. </li><li> 5 dakika boyunca 300 xg&#39;de santrifüj tüpü. Süpernatant aspire ve taze önceden ısıtılmış astrosit kaplama medya 2 mL ekleyin. Yeni 50 ml konik tüp içine 70 mikron örgü filtre (hücre süzgecinden) aracılığıyla hücrelere geçerler. </li><li> 3 mL içeren bir poli-D-Lisin / laminin kaplanmış steril T25 kültür şişelerinde Plaka tüm hücre süspansiyonuastrosit kaplama ortamı, daha sonra bir% 5 CO2 inkübatöründe 37 ° C&#39;de bir balon inkübe edin. </li><li> Gün-de aspire tüm ortam i, n-vitro (DIV) 1, DIV 3 ve DIV 7 ve taze astrosit kaplama medya 2 mL ile değiştirin. astrosit kaplama medya değiştirirken ışık mikroskobu altında her zaman ilerlemesi ve astrositik izdiham gözlemleyin. Not: DIV 1 &#39;de, tüm canlı astrositler kültür şişesi yüzeyi ve sinir yüzer yüzen dahil ölü veya ölmekte hücrelere eklenir. DIV 3 at, ekli hücreler astrositik hücre tabakası oluşturmak için bölünmeye başlar. elverişli koşullar yokluğunda, kültür bir nöronal büyüme hemen yoksundur. % 90 konfluent ve birkaç mikroglia olarak oligodendrosit ön-madde hücreleri, astrositik tabakanın üstünde bulunan edilir - DIV 7 &#39;de, astrosit tabaka yaklaşık 80&#39;dir. </li><li> durulama, şişesi kaplama orta aspire taze önceden ısıtılmış astrosit kaplama orta 2 mL eklemekastrositler birleşen ve kültürü alt hazır olduğunda nd, DIV 11 tekrar kaldırın. </li><li> yavaşça şişeye birkaç kez döndürmek ve aspire tripsin steril bir cam pipet kullanarak,% 0.25 tripsin 2 mL ekleyin. </li><li> % 0.25 tripsin 2 mL ekleyin ve şişe 4 doku kültürü kaputu bekletin - oda sıcaklığında 5 dakika. </li><li> Tripsin çıkarın ve 10 dakika boyunca bir% 5 CO2 inkübatöründe 37 ° C&#39;de bir balon tutun. 5 ml orta kaplama astrocyte prewarmed ekleyin ve avucunuzun karşı balon dokunarak astrositik katmanı ayırmak - tam dekolmanı sağlamak ve bir 15 ml konik tüp astrositler toplamak için yumuşak ezilerek (3 4 kez). </li><li> Santrifüj tüp, 5 dakika boyunca 300 x g&#39;de, süpernatanı havalandırın, ve 1 mL taze astrosit kaplama ortamı ilave edin. </li><li> Bir hemasitometre hücre süspansiyonu 10 mcL ekleyin ve ters bir faz kontrast mikroskobu (10X objektif) kullanarak büyük merkezi Gridlenmiş alana (1 mm 2) hücreleri saymak. Multiply 10 4 tarafından mL başına hücre sayısını tahmin etmek. Bir T25 şişesi ~ 1 x 10 6 toplam ayrışmış hücreleri verecektir. Tohum ~ 1 x 10, 24 oyuklu bir kültür kabı oyuk bir 12 mm çaplı poli-D-Lisin önceden kaplanmış cam lamel 2 mL astrosit kaplama ortamı içinde 5 hücreleri. </li><li> % 5 CO2 inkübatörde 37 ° C&#39;de inkübe edin. 14 (bölüm 2) - DIV 12, OGD / REOX gerçekleştirin. </li><li> mikroglia yoksun hipokampal kültürleri isteniyorsa DIV 11 kadar, 5 mM L-lösin metil ester (LME) hidroklorür ile DIV 3 de astrosit kültürleri tedavi edin. LME inkübasyondan sonra (1 saat 300 rpm) sallayarak tabi kültürler mikroglia kirlenmesine neden kaldırmak için. Not: LME mikroglia 22 çoğalan ortadan kaldırmak için bir yöntem olarak yaygın bir şekilde kullanılmaktadır, bir mikroglial sitotoksik maddedir. </li></ol> 2. OGD / REOX Tedavisi <ol><li> Aspire yapışık astrosit kültürü içeren lamel medya (DIV 12 - 14) ve durulama 3 kezhafifçe lamel (mM olarak) 1 ml izotonik OGD çözeltisi (pH 7.4) bir kaç kez tutarak 24 oyuklu kültür çanak döndürerek 0 glükoz, 21 NaHCO 3, 120 NaCl, 5.36 KCI, 0.33 Na 2 HPO 4, 0.44 KH 2 PO 4, 1.27 CaCl2 ve 0.81 MgSO 4. </li><li> CO2 lamel kapak ve% 94 N2,% 1 O 2 ihtiva eden bir hipoksik inkübatörde 2 saat boyunca inkübe ve% 5 oyuğa 0.2 ml OGD solüsyonu eklenir. Yavaşça gaz değişimini kolaylaştırmak için hipoksi ilk 30 dakika boyunca orbital bir karıştırıcı (50 rpm) ile karıştırın. </li><li> 5.5 mM glukoz eklenmesi dışında OGD solüsyonuna denk bir tampon içinde% 5 CO2 ve atmosferik hava içinde, 2 saat boyunca normoksik kontrol hücrelerini inkübe edin. </li><li> ve REOX, aspirat OGD çözümü için orta kaplama astrosit 2 mL ekleyin. 5 saat boyunca 37 ° C &#39;de% 5 CO2 ve atmosferik hava içinde inkübe edin. </li></ol> 3. İmmünositokimyasal Boyama &lt;/ P&gt; <ol><li> bir vakum hattına bağlanmış bir steril cam pipet kullanılarak kültür ortamı aspire ve hızlı bir şekilde 0.1 M Tris tamponlu tuz (TBS) içinde 1 ml ekleyerek lamel kez yıkayın (154 mM NaCI, 16 mM Trizma bazı, 84 mM Tris-HCI, pH 7.4) kuyusuna. Aspire edin ve 1X fosfat tamponlu salin (PBS) içinde% 4 paraformaldehit (PFA) 2 ml. Oda sıcaklığında 15 dakika süreyle inkübe edilir. </li><li> Aspire ve 0.1 M TBS 1 ml, daha sonra 2 dakika süreyle sallanan bir sallayıcı üzerinde yerleştirin. 3 kez tekrarlayın. çözeltisi (% 10 keçi serumu, 0.1 M TBS içerisinde 10 mg / ml BSA,% 0.025 Triton X-100) bloke 1 ml ilave edilir ve sallanan bir sallayıcı üzerinde 37 ° C&#39;de 30 dakika inkübe edilir. </li><li> Aspire bloke etme çözeltisi ve primer fare monoklonal anti-GFAP antikoru ilave 60 dakika boyunca: Anti-HIF1α (200 1) veya tavşan poliklonal (1 0.2 mL: bloke etme çözeltisi 500 seyreltme) ve tavşan poliklonal anti-S100b (500 1) sallanan çalkalayıcı üzerinde 37 ° C&#39;de ilave edildi. </li><li> ve fare Pazartesi: Alternatif olarak, bazı astrositler tavşan poliklonal anti-IBA1 (200 1) ile inkübe ediliroclonal anti-MAP2 Kültür saflığı ulaşmak için. </li><li> Aspire birincil antikor ve 0.1 M TBS 1 mL eklenmesini ve 2 dakika sonra aspirasyon için bir sallanan çalkalayıcı üzerinde koyarak lamel durulayın. İki kez tekrarlayın. </li><li> sallanan çalkalayıcı üzerinde 37 ° C&#39;de 60 dakika süre ile çözelti bloke sekonder keçi anti-tavşan 488-konjuge anti-fare 568-konjüge edilmiş antikor 200 seyreltme: 1 0.2 ml ekleyin. </li><li> Aspire sekonder antikor ve 2 dakika sonra aspirasyon için bir sallanan çalkalayıcı üzerinde 0.1 M TBS 1 mL eklenmesini ve yer ile lamel durulayın. İki kez tekrarlayın. </li><li> Bir slayt-kurutucu üzerinde konumlandırılmış bir slayt üzerinde koyarak iyi ve kuru lamel çıkarın. Vectashield tek bir damla tersini yeni bir slayt Mount lamel DAPI (1.5 ng / ml) ile montaj orta hardset. </li><li> ya 20X kuru ya da 60X petrol hedefi kullanarak bir konfokal mikroskop görüntü lamelleri. DAPI (405 nm ex / 450 nm em) ve florokrom 488 görüntüleri (512 x 512) Edinme GFAP antikoru etiketli (488 nm ex / 515 nmem). 20X ve 60X grup içinde sürekli elde etme parametrelerini tutun. </li></ol> PCR kullanarak 4. Cinsiyet Tayini <ol><li> Isı yavru ayak ya da 50 mM NaOH, 45 dakika boyunca 95 ° C de parmak kırpıntıları ve 1 M Tris, pH 6.8 eşit hacmi ile nötralize. </li><li> Myog, Sry genleri için primerler 5 pmol, 1 x reaksiyon tamponu, 0.2 mM deoksinükleotid 8 U Taq polimeraz: Aşağıdaki karışım 19 uL edilen DNA çözeltisi 1 uL ekleyin. </li><li> primerleri dizilerini kullanın; Sry 5&#39;TCATGAGACTGCCAACCACAG3 &#39;5&#39;CATGACCACCACCACCACCAA3 &quot;ve Myog 5&#39;TTACGTCCATCGTGGACAGC3&#39; 5&#39;TGGGCTGGGTGTTAGTCTTA3 &#39;23. </li><li> 1 dakika boyunca 72 ° C&#39;de 15 saniye boyunca 58 ° C &#39;de 15 saniye, tavlama için 95 ° C&#39; de 3 dakika boyunca denatürasyon, sonra 30 döngü 95 ° C, ve uzama: Aşağıdaki PCR protokolü gerçekleştirin. Bu 30 döngü sonra, reaksiyon 1 dakika boyunca son bir 72 ° C uzatma ile son bulur. </li><li> ayrı PCR ürünleri elektroforetik etidyum bromür ihtiva eden% 2 agaroz jeli üzerinde ve UV aydınlatması altında görselleştirmek. (Şekil 2A.) DİKKAT! Ethidium bromür potansiyel bir kanserojen ve dikkatle ele ve kurumun düzenlemelerine uygun olarak düzgün bir şekilde bertaraf edilmelidir. </li></ol>

<ol>
	<li>Powell, E. M., Geller, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+astrocyte-mediated+cues+in+neuronal+guidance+and+process+extension.">Dissection of astrocyte-mediated cues in neuronal guidance and process extension.</a> Glia. 26, 73-83 (1999).</li><li>Koehler, R. C., Roman, R. J., Harder, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytes+and+the+regulation+of+cerebral+blood+flow.">Astrocytes and the regulation of cerebral blood flow.</a> Trends in neurosciences. 32, 160-169 (2009).</li><li>Seifert, G., Schilling, K., Steinhauser, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocyte+dysfunction+in+neurological+disorders:+a+molecular+perspective.">Astrocyte dysfunction in neurological disorders: a molecular perspective.</a> Nature reviews. Neuroscience. 7, 194-206 (2006).</li><li>Ballabh, P., Braun, A., Nedergaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+blood-brain+barrier:+an+overview:+structure,+regulation,+and+clinical+implications.">The blood-brain barrier: an overview: structure, regulation, and clinical implications.</a> Neurobiology of disease. 16, 1-13 (2004).</li><li>Araque, A., Parpura, V., Sanzgiri, R. P., Haydon, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tripartite+synapses:+glia,+the+unacknowledged+partner.">Tripartite synapses: glia, the unacknowledged partner.</a> Trends in neurosciences. 22, 208-215 (1999).</li><li>Anderson, M. A., Ao, Y., Sofroniew, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+reactive+astrocytes.">Heterogeneity of reactive astrocytes.</a> Neuroscience letters. 565, 23-29 (2014).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Na+/H++exchanger+isoform+1+is+neuroprotective+in+neonatal+hypoxic+ischemic+brain+injury.">Inhibition of Na+/H+ exchanger isoform 1 is neuroprotective in neonatal hypoxic ischemic brain injury.</a> Antioxidants &amp; redox signaling. 14, 1803-1813 (2011).</li><li>Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+brain+injury.">Neonatal brain injury.</a> The New England journal of medicine. 351, 1985-1995 (2004).</li><li>Hill, C. A., Fitch, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+differences+in+mechanisms+and+outcome+of+neonatal+hypoxia-ischemia+in+rodent+models:+implications+for+sex-specific+neuroprotection+in+clinical+neonatal+practice.">Sex differences in mechanisms and outcome of neonatal hypoxia-ischemia in rodent models: implications for sex-specific neuroprotection in clinical neonatal practice.</a> Neurol Res Int. , 1-9 (2012).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERalpha+Signaling+Is+Required+for+TrkB-Mediated+Hippocampal+Neuroprotection+in+Female+Neonatal+Mice+after+Hypoxic+Ischemic+Encephalopathy(1,2,3).">ERalpha Signaling Is Required for TrkB-Mediated Hippocampal Neuroprotection in Female Neonatal Mice after Hypoxic Ischemic Encephalopathy(1,2,3).</a> eNeuro. 3, (2016).</li><li>Uluc, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TrkB+receptor+agonist+7,+8+dihydroxyflavone+triggers+profound+gender-+dependent+neuroprotection+in+mice+after+perinatal+hypoxia+and+ischemia.">TrkB receptor agonist 7, 8 dihydroxyflavone triggers profound gender- dependent neuroprotection in mice after perinatal hypoxia and ischemia.</a> CNS Neurol Disord Drug Targets. 12, 360-370 (2013).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+microglia+activation+after+hypoxia-ischemia+results+in+age-dependent+improvements+in+neurologic+injury.">Suppression of microglia activation after hypoxia-ischemia results in age-dependent improvements in neurologic injury.</a> J Neuroimmunol. 291, 18-27 (2016).</li><li>McQuillen, P. S., Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+vulnerability+in+the+developing+central+nervous+system.">Selective vulnerability in the developing central nervous system.</a> Pediatr Neurol. 30, 227-235 (2004).</li><li>Morken, T. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+astrocyte-neuronal+interactions+after+hypoxia-ischemia+in+the+neonatal+brain+in+female+and+male+rats.">Altered astrocyte-neuronal interactions after hypoxia-ischemia in the neonatal brain in female and male rats.</a> Stroke; a journal of cerebral circulation. 45, 2777-2785 (2014).</li><li>Chisholm, N. C., Sohrabji, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytic+response+to+cerebral+ischemia+is+influenced+by+sex+differences+and+impaired+by+aging.">Astrocytic response to cerebral ischemia is influenced by sex differences and impaired by aging.</a> Neurobiology of disease. 85, 245-253 (2016).</li><li>Liu, M., Oyarzabal, E. A., Yang, R., Murphy, S. J., Hurn, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+assessing+sex-specific+and+genotype-specific+response+to+injury+in+astrocyte+culture.">A novel method for assessing sex-specific and genotype-specific response to injury in astrocyte culture.</a> Journal of neuroscience methods. 171, 214-217 (2008).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+biological+contributions+to+human+health:+does+sex+matter?.">Exploring the biological contributions to human health: does sex matter?.</a> Journal of women's health &amp; gender-based. 10, 433-439 (2001).</li><li>Collins, F. S., Tabak, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Policy:+NIH+plans+to+enhance+reproducibility.">Policy: NIH plans to enhance reproducibility.</a> Nature. 505, 612-613 (2014).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78, 785-798 (2013).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+Na+/H++exchanger+activation+promotes+gliotransmitter+release+from+reactive+hippocampal+astrocytes+following+oxygen-glucose+deprivation.">Sustained Na+/H+ exchanger activation promotes gliotransmitter release from reactive hippocampal astrocytes following oxygen-glucose deprivation.</a> PloS one. 9, e84294 (2014).</li><li>Landis, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+call+for+transparent+reporting+to+optimize+the+predictive+value+of+preclinical+research.">A call for transparent reporting to optimize the predictive value of preclinical research.</a> Nature. 490, 187-191 (2012).</li><li>Hamby, M. E., Uliasz, T. F., Hewett, S. J., Hewett, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+an+improved+procedure+for+the+removal+of+microglia+from+confluent+monolayers+of+primary+astrocytes.">Characterization of an improved procedure for the removal of microglia from confluent monolayers of primary astrocytes.</a> J Neurosci Methods. 150, 128-137 (2006).</li><li>McClive, P. J., Sinclair, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+DNA+extraction+and+PCR-sexing+of+mouse+embryos.">Rapid DNA extraction and PCR-sexing of mouse embryos.</a> Molecular reproduction and development. 60, 225-226 (2001).</li><li>Wolterink-Donselaar, I. G., Meerding, J. M., Fernandes, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gender+determination+in+newborn+dark+pigmented+mice.">A method for gender determination in newborn dark pigmented mice.</a> Lab Anim (NY). 38, 35-38 (2009).</li><li>Uliasz, T. F., Hamby, M. E., Jackman, N. A., Hewett, J. A., Hewett, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+primary+astrocyte+cultures+devoid+of+contaminating+microglia.">Generation of primary astrocyte cultures devoid of contaminating microglia.</a> Methods Mol Biol. 814, 61-79 (2012).</li><li>Raponi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=S100B+expression+defines+a+state+in+which+GFAP-expressing+cells+lose+their+neural+stem+cell+potential+and+acquire+a+more+mature+developmental+stage.">S100B expression defines a state in which GFAP-expressing cells lose their neural stem cell potential and acquire a more mature developmental stage.</a> Glia. 55, 165-177 (2007).</li><li>Souza, D. G., Bellaver, B., Souza, D. O., Quincozes-Santos, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+adult+rat+astrocyte+cultures.">Characterization of adult rat astrocyte cultures.</a> PloS one. 8, e60282 (2013).</li><li>Puschmann, T. B., Dixon, K. J., Turnley, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+differences+in+reactivity+of+mouse+and+rat+astrocytes+in+vitro.">Species differences in reactivity of mouse and rat astrocytes in vitro.</a> Neuro-Signals. 18, 152-163 (2010).</li><li>Schildge, S., Bohrer, C., Beck, K., Schachtrup, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+mouse+cortical+astrocytes.">Isolation and culture of mouse cortical astrocytes.</a> Journal of visualized experiments : JoVE. , (2013).</li><li>Saura, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglial+cells+in+astroglial+cultures:+a+cautionary+note.">Microglial cells in astroglial cultures: a cautionary note.</a> J Neuroinflammation. 4 (26), (2007).</li></ol>

yazarların hiçbiri rakip veya çakışan çıkarları var.

Fizyolojik ve patolojik koşullar altında astrositlerin cinsiyet özelliklerinin farklılıkları ve fonksiyon çalışma için, hücre kültürü içinde cinsiyette primer astrositler hazırlanması kullanılması için önemli bir araçtır. Bu çalışmada in vitro yenidoğan cinsiyetli hipokampal astrosit yüksek zenginleştirilmiş homojen nüfus (P0-P2) C57BL / 6 (vahşi tip) veya K19F (GFAP null) fare yavrular bir yüksek verimli ve kültürüne bir tekrarlanabilir bir yöntem sunduk. Bu metodoloji olu?...

Astrositler merkezi sinir sistemi (MSS) en önemli anahtar oyunculardan biri bulunmaktadır. kanıt Büyüyen vücut astrositlerin rolleri nöronal destek sağlama daha olduğunu gösterir. Aslında, fizyolojik koşullar altında astrositlerin rolleri gibi, merkezi sinir sistemi, kan akışını düzenleyen 2, gelişmekte olan aksonlar 1 göçünü yol sinaptik dokulararası sıvının 3 pH homeostazını sürdürmek ve kan-beyin bariyerinin katılmak gibi çok karmaşık olabilir 4 ve sinaptik iletim 5. Patolojik koşullar altında, astrositler astrositler ve fonksiyon (zedelenmesinden mesafeye göre) morfolojisi, sayı, yer, topografya heterojen bir şekilde 6,7 değişebilir olan reaktif astrogliasis adı verilen bir işlem ile hasara yanıt. belki yenidoğanların morbidite ve mortalite katkıda yenidoğan hipoksik iskemik ensefalopati aşağıdaki görüldü astrogliasis <s&gt; 8 yukarı. Son klinik ve deneysel çalışmalar, beyin hasarı şiddeti ile karşılaştırıldığında erkek yenidoğanlarda daha ciddi nörolojik sonuçlara neden hipoksi / iskemi (HI) ile ilgili beyin hasarı etkilerine daha duyarlı olduğunu seks bağımlı gibi görünüyor ve olduğunu göstermektedir karşılaştırılabilir beyin yaralanması 9-11 ile kadın. Yaralanma lokalizasyonu gestasyonel yaş ve süresi ve hakaret şiddetine bağlıdır rağmen, hipokampus dönem yenidoğan HI sonra MSS en çok etkilenen bölgelerden biri olan ve hipokampal astrogliasis up-regülasyonu ile teyit edilmiştir arttı Glial fibriller asidik protein (GFAP) yenidoğan HI 7,10,12,13 sonra 3 gün. Astrosit fonksiyonunda cinsiyet farklılıkları serebral iskemi 14,15 sonrasında yenidoğanlarda ve yetişkin kemirgenlerde gösterilmiştir. Buna ek olarak, in vitro iskemi erkek astrositik hassasiyeti yükselttiği cel ile gösterilmiştirKültür 16 dişi kortikal astrositler göre l ölümü. Cinsiyet farklılıkları in utero başlar ve ölüm 17 kadar devam eder. Son on yılda, hücre kültürü ve in vivo çalışmalarda deneysel koşullarda cinsiyete dahil önemi Tıp ve NIH Enstitüsü vurgu fizyolojik ve patolojik durumlarda 17,18 görülen cinsiyet farklılıkları temel bilgiyi aramak olmuştur . yalıtmak ve cinsiyette hipokampal astrosit popülasyonlarının korumak için güvenilir yöntemlerin geliştirilmesi neonatal HI patolojik sonuçları cinsiyet farklılıklarının hücresel temelini anlamak için esastır. Bu çalışma Oksijen / Glikoz Yoksunluk (OGD) ve reoksijenasyon (REOX), indükleyici aşağıdaki GFAP-immünoreaktif astrositler rollerini değerlendirmek için yeni doğmuş farelerden zenginleştirilmiş cinsiyete özgü hipokampal astrosit kültürleri hazırlamak için teknikler sağlamak için tasarlanmıştırHücre kültürü ortamı, HI. Bu teknik normoksik ve iskemik koşullarda yenidoğan kadın ve erkeklerde hipokampal astrositler ile ilgili tüm hipotezi test etmek için kullanılabilir.

<table><tbody><tr><td>&lt;strong&gt;&lt;em&gt;Astrocyte culture media&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DMEM, high glucose</td><td>cellgro</td><td>10-013-CV</td><td></td></tr><tr><td>Horse Serum</td><td>Gibco</td><td>26050-070</td><td>Final Concentration: 10%</td></tr><tr><td>Penicillin-Streptomycin</td><td>Cellgro&amp;nbsp;</td><td>30-002-CI</td><td>Final Concentration: 1%</td></tr><tr><td>L-Leucine methyl ester hydrochloride</td><td>Aldrich</td><td>L1002-25G</td><td>Final Concentration: 5 mM</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Solution for brain tissue digestion&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HBSS</td><td>Life Technologies</td><td>14170-088</td><td></td></tr><tr><td>Trypsin</td><td>cellgro</td><td>25-050-CI</td><td>Final Concentration: 0.25%</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Other&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>70% (vol/vol) ethanol</td><td>Roth</td><td>9065.2</td><td></td></tr><tr><td>Poly-D-Lysine (PDL) 12 mm round coverslips&amp;nbsp;</td><td>Corning</td><td>354087</td><td></td></tr><tr><td>Water</td><td>Sigma</td><td>W3500</td><td>Cell-culture grade</td></tr><tr><td>PBS</td><td>cellgro</td><td>21-040-CV</td><td>Cell-culture grade</td></tr><tr><td>0.05% Trypsin-EDTA&amp;nbsp;</td><td>Life Technologies</td><td>25300-062</td><td></td></tr><tr><td>70 &amp;mu;m Sterile cell strainer&amp;nbsp;</td><td>Fisher scientific</td><td>22363548</td><td></td></tr><tr><td>3.5 cm Petri dish</td><td>BD Falcon</td><td>353001</td><td></td></tr><tr><td>15 mL Falcon tube</td><td>BD Falcon</td><td>352096</td><td></td></tr><tr><td>50 mL Falcon tube</td><td>BD Falcon</td><td>352070</td><td></td></tr><tr><td>Forceps, fine&amp;nbsp;</td><td>Dumont</td><td>2-1032; 2-1033</td><td># 3c; # 5</td></tr><tr><td>Forceps, flat tip</td><td>KLS Martin</td><td>12-120-11</td><td></td></tr><tr><td>13 cm surgical scissors</td><td>Aesculap</td><td>BC-140-R</td><td></td></tr><tr><td>Confocal Microscope</td><td>Nikon</td><td>A1RSi&amp;nbsp;</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5805000.017</td><td>5804R</td></tr><tr><td>Orbital Shaker</td><td>Thermo Scientific</td><td>SHKE 4450-1CE</td><td>MaxQ 4450&amp;nbsp;</td></tr><tr><td>Anti-IBA1</td><td>Wako</td><td>019-19741</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-MAP2</td><td>Sigma</td><td>M2320</td><td>Mouse monoclonal</td></tr><tr><td>Anti-HIF1alpha</td><td>abcam</td><td>ab179483</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-S100B</td><td>Sigma</td><td>HPA015768</td><td>Rabbit polyclonal</td></tr><tr><td>Anti-GFAP (cocktail)</td><td>Biolegend</td><td>837602</td><td></td></tr><tr><td>VECTASTAIN Elite ABC Kit (Rabbit IgG)</td><td>Vector Labs</td><td>PK-6101</td><td>Contains 4 Reagents&amp;nbsp;</td></tr><tr><td>Goat Anti Rabbit Alexa-Fluor 488</td><td>Invitrogen</td><td>A11070</td><td></td></tr><tr><td>Goat Anti Mouse Alexa-Fluor 568</td><td>Invitrogen</td><td>A11004</td><td></td></tr></tbody></table>

sex differences in mouse hippocampal astrocytes after in-vitro ischemia

hipoksi / iskemi (HI) ile ilgili beyin hasarını takiben astrogliasis yenidoğanlarda artmış morbidite ve mortalite bir rol oynar. Son klinik çalışmalar beyin hasarının şiddeti seks bağımlı gibi görünen gösterir ve erkek yenidoğanlarda karşılaştırılabilir beyin hasarı olan kadınlara kıyasla daha ciddi nörolojik sonuçlara yol açan, HI-ilişkili beyin hasarının etkilerine daha duyarlı olduğunu. yalıtmak ve cinsiyette hipokampal astrosit zenginleştirilmiş popülasyonları korumak için güvenilir yöntemlerin geliştirilmesi neonatal HI patolojik sonuçları cinsiyet farklılıklarının hücresel temelini anlamak için esastır. Bu çalışmada, reoksijenasyonun ardından in vitro iskemi, oksijen glukoz yoksunluk bir model maruz cinsiyete spesifik hipokampal astrosit kültürleri oluşturmak için bir yöntem tarif eder. Daha sonra reaktif astrogliasis immunostai ile incelendiGlial fibriller asidik protein (GFAP) ve S100B için Ning. Bu yöntem ayrıca, yenidoğan HI aşağıdaki erkek ve kadın hipokampal astrositler rolünü incelemek için yararlı bir araç sağlar.

Fizyolojik veya patofizyolojik koşullarda cinsiyetli astrosit fonksiyonlarının rolleri anlamak gayet in vitro koşullarda bu kültür hücreleri tarafından da elde edilmiştir. cinsiyetli Kültürleme gerçekleştirme önemli yönü önce kullanımına fare yavru seks belirlemektir. Biz genetik olarak PCR ile ve görsel değerlendirilmesi (Şekil 2) 16 ile fare seks belirlendi. PCR kullanılarak cinsiyet tayini metodolojisi McClive ve Sinclair gel...

Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Astrositler merkezi sinir sistemi (MSS) en önemli anahtar oyunculardan biri bulunmaktadır. Burada, sonra in vitro iskemi erkek ve kadın yeni doğan yavrular astrosit fonksiyonu altında yatan mekanizmaları araştırmak için cinsiyetli hipokampal astrosit kültürü protokolünün pratik bir yöntem bildiriliyor.

Fare Hipokampal Astrositler Seks Farkları sonra<em&gt; In-Vitro</em&gt; İskemi

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies ...

sex-differences-mouse-hippocampal-astrocytes-after-vitro

Research

JoVE Journal

Neuroscience

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

13.3K Görüntüleme.  University of Wisconsin.  Astrositler merkezi sinir sistemi (MSS) en önemli anahtar oyunculardan biri bulunmaktadır. Burada, sonra in vitro iskemi erkek ve kadın yeni doğan yavrular astrosit fonksiyonu altında yatan mekanizmaları araştırmak için cinsiyetli hipokampal astrosit kültürü protokolünün pratik bir yöntem bildiriliyor. 

Video: Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Fare Kortikal astrositlerde İzolasyon ve Kültür

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Nörobilim

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms responsible for those differences remain unclear. Primary disassociated embryonic neuronal culture provides a simplified experimental model with which to investigate the neuronal cell signaling involved in cell death as a result of ischemia or disease; however, most neuronal cultures used in research today are mixed sex. Researchers can and do test the effects of sex steroid treatment in mixed sex neuronal cultures in models of neuronal injury and disease, but accumulating evidence suggests that the female brain responds to androgens, estrogens, and progesterone differently than the male brain. Furthermore, neonate male and female rodents respond differently to ischemic injury, with males experiencing greater injury following cerebral ischemia than females. Thus, mixed sex neuronal cultures might obscure and confound the experimental results; important information might be missed. For this reason, the Herson Lab at the University of Colorado School of Medicine routinely prepares sex-stratified primary disassociated embryonic neuronal cultures from both hippocampus and cortex. Embryos are sexed before harvesting of brain tissue and male and female tissue are disassociated separately, plated separately, and maintained separately. Using this method, the Herson Lab has demonstrated a male-specific role for the ion channel TRPM2 in ischemic cell death. In this manuscript, we share and discuss our protocol for sexing embryonic mice and preparing sex-stratified hippocampal primary disassociated neuron cultures. This method can be adapted to prepare sex-stratified cortical cultures and the method for embryo sexing can be used in conjunction with other protocols for any study in which sex is thought to be an important determinant of outcome.

Primary disassociated embryonic hippocampal neuronal cultures are useful for investigating the signaling mechanisms involved in neuron death. Sexing the embryos before the isolation and dissociation of the hippocampus allows the preparation of separate male and female cultures, which enables the researcher to identify and investigate sex-specific cell signaling.

İskemik Hücre Ölümü Pathways Eğitim için seks Katmanlı Nöronal Kültürleri

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms ...

Assessment of Dendritic Arborization in the Dentate Gyrus of the Hippocampal Region in Mice

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity and extent of dendritic arborization correlates well with the synaptic plasticity in these cells. A reliable method for assessment of dendritic arborization is needed to characterize the deleterious effects of neurological disorders on these structures and to determine the effects of therapeutic interventions. However, quantification of these structures has proven to be a formidable task given their complex and dynamic nature. Fortunately, sophisticated imaging techniques can be paired with conventional staining methods to assess the state of dendritic arborization, providing a more reliable and expeditious means of assessment. Below is an example of how these imaging techniques were paired with staining methods to characterize the dendritic arborization in wild type mice. These complementary imaging methods can be used to qualitatively and quantitatively assess dendritic arborization that span a rather wide area within the hippocampal region.

We describe two methods for visualization and quantification of dendritic arborization in the hippocampus of mouse models: real-time and extended depth of field imaging. While the former method allows sophisticated topographical tracing and quantification of the extent of branching, the latter allows speedy visualization of the dendritic tree.

Farelerde Hipokampal Bölgesi Dentate Gyrus dendritik arborization Değerlendirilmesi

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity ...

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of oxygen and glucose, which causes energy failure and neuronal death. After an ischemic stroke insult, astrocytes become reactive and proliferate around the injury site as it develops. Under this scenario, it is difficult to study the specific contribution of astrocytes to the brain region exposed to ischemia. Therefore, this article introduces a methodology to study primary astrocyte reactivity and proliferation under an in vitro model of an ischemia-like environment, called oxygen glucose deprivation (OGD). Astrocytes were isolated from 1-4 day-old neonatal rats and the number of non-specific astrocytic cells was assessed using astrocyte selective marker Glial Fibrillary Acidic Protein (GFAP) and nuclear staining. The period in which astrocytes are subjected to the OGD condition can be customized, as well as the percentage of oxygen they are exposed to. This flexibility allows scientists to characterize the duration of the ischemic-like condition in different groups of cells in vitro. This article discusses the timeframes of OGD that induce astrocyte reactivity, hypertrophic morphology, and proliferation as measured by immunofluorescence using Proliferating Cell Nuclear Antigen (PCNA). Besides proliferation, astrocytes undergo energy and oxidative stress, and respond to OGD by releasing soluble factors into the cell medium. This medium can be collected and used to analyze the effects of molecules released by astrocytes in primary neuronal cultures without cell-to-cell interaction. In summary, this primary cell culture model can be efficiently used to understand the role of isolated astrocytes upon injury.

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex event in which the specific contribution of astrocytes to the affected brain region exposed to oxygen glucose deprivation (OGD) is difficult to study. This article introduces a methodology to obtain isolated astrocytes and study their reactivity and proliferation under OGD conditions.

Astrocyte reaktivite ve nükleer silahların yayılmasına karşı Vitro iskemik benzeri koşullar altında izleme

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of ...

Neurobehavioral Assessments in a Mouse Model of Neonatal Hypoxic-ischemic Brain Injury

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI brain injury by studying neurobehavioral functions in these mice compared to non-operated (i.e., normal) mice. During the study, Rice-Vannucci&#39;s method was used to induce neonatal HI brain damage in postnatal day 7-10 (P7-10) mice. The HI operation was performed on the pups by unilateral carotid artery ligation and exposure to hypoxia (8% O2 and 92% N2 for 90 min). One week after the operation, the damaged brains were evaluated with the naked eye through the semi-transparent skull and were categorized into subgroups based on the absence (&#34;no cortical injury&#34; group) or presence (&#34;cortical injury&#34; group) of cortical injury, such as a lesion in the right hemisphere. On week 6, the following neurobehavioral tests were performed to evaluate the cognitive and motor functions: passive avoidance task (PAT), ladder walking test, and grip strength test. These behavioral tests are helpful in determining the effects of neonatal HI brain injury and are used in other mouse models of neurodegenerative diseases. In this study, neonatal HI brain injury mice showed motor deficits that corresponded to right hemisphere damage. The behavioral test results are relevant to the deficits observed in human neonatal HI patients, such as cerebral palsy or neonatal stroke patients. In this study, a mouse model of neonatal HI brain injury was established and showed different degrees of motor deficits and cognitive impairment compared to non-operated mice. This work provides basic information on the HI mouse model. MRI images demonstrate the different phenotypes, separated according to the severity of brain damage by motor and cognitive tests.

We performed unilateral carotid artery occlusion on postnatal day 7-10 CD-1 mouse pups to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of HI brain injury. We studied neurobehavioral functions in these mice compared to non-operated normal mice.

Yenidoğan hipoksik-iskemik beyin hasarı, fare modeli neurobehavioral değerlendirmesi

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI ...

Ex Vivo Pressurized Hippocampal Capillary-Parenchymal Arteriole Preparation for Functional Study

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and cardiac arrest are remarkably sexually dimorphic diseases, and both induce cerebral ischemia. However, progress in understanding the vascular cognitive impairment, and then developing sex-specific treatments, has been partly limited by challenges in investigating the brain microcirculation from mouse models in functional studies. Here, we present an approach to examine the capillary-to-arteriole signaling in an ex vivo hippocampal capillary-parenchymal arteriole (HiCaPA) preparation from mouse brain. We describe how to isolate, cannulate, and pressurize the microcirculation to measure arteriolar diameter in response to capillary stimulation. We show which appropriate functional controls can be used to validate the HiCaPA preparation integrity and display typical results, including testing potassium as a neurovascular coupling agent and the effect of the recently characterized inhibitor of the Kir2 inward rectifying potassium channel family, ML133. Further, we compare the responses in preparations obtained from male and female mice. While these data reflect functional investigations, our approach can also be used in molecular biology, immunochemistry, and electrophysiology studies.

The present manuscript details how to isolate hippocampal arterioles and capillaries from the mouse brain and how to pressurize them for pressure myography, immunofluorescence, biochemistry, and molecular studies.

Fonksiyonel Çalışma için Ex Vivo Basınçlı Hipokampal Kapiller-Parenkimal Arteriyol Hazırlığı

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and ...

A Cell Culture Model for Studying the Role of Neuron-Glia Interactions in Ischemia

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent neuronal loss. Numerous evidence suggests that the interaction between glial and neuronal cells exert beneficial effects after an ischemic event. Therefore, to explore potential protective mechanisms, it is important to develop models that allow studying neuron-glia interactions in an ischemic environment. Herein we present a simple approach to isolate astrocytes and neurons from the rat embryonic cortex, and that by using specific culture media, allows the establishment of neuron- or astrocyte-enriched cultures or neuron-glia cultures with high yield and reproducibility.
To study the crosstalk between astrocytes and neurons, we propose an approach based on a co-culture system in which neurons cultured in coverslips are maintained in contact with a monolayer of astrocytes plated in multiwell plates. The two cultures are maintained apart by small paraffin spheres. This approach allows the independent manipulation and the application of specific treatments to each cell type, which represents an advantage in many studies.
To simulate what occurs during an ischemic stroke, the cultures are subjected to an oxygen and glucose deprivation protocol. This protocol represents a useful tool to study the role of neuron-glia interactions in ischemic stroke.

Here, we present a simple approach using specific culture media that allows the establishment of neuron- and astrocyte-enriched cultures, or neuron-glia cultures from the embryonic cortex, with high yield and reproducibility.

İskemide Nöron-Glia Etkileşimlerinin Rolünü Nörade İncelemek İçin Hücre Kültürü Modeli

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent ...

Analysis of Astrocyte Territory Volume and Tiling in Thick Free-Floating Tissue Sections

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the brain. Through these interactions, astrocytes actively regulate many critical brain functions, including synapse formation, neurotransmission, and ion homeostasis. In the rodent brain, astrocytes grow in size and complexity during the first three postnatal weeks and establish distinct, non-overlapping territories to tile the brain. This protocol provides an established method for analyzing astrocyte territory volume and astrocyte tiling using free-floating tissue sections from the mouse brain. First, this protocol describes the steps for tissue collection, cryosectioning, and immunostaining of free-floating tissue sections. Second, this protocol describes image acquisition and analysis of astrocyte territory volume and territory overlap volume, using commercially available image analysis software. Lastly, this manuscript discusses the advantages, important considerations, common pitfalls, and limitations of these methods. This protocol requires brain tissue with sparse or mosaic fluorescent labeling of astrocytes, and is designed to be used with common lab equipment, confocal microscopy, and commercially available image analysis software.

This protocol describes methods for sectioning, staining, and imaging free-floating tissue sections of the mouse brain, followed by a detailed description of the analysis of astrocyte territory volume and astrocyte territory overlap or tiling.

Astrosit Bölgesi Hacminin Analizi ve Kalın Serbest Yüzen Doku Kesitlerinde Döşeme

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the ...

İskemik İnme Fare Modeli Geliştirmek için Distal Orta Arter Oklüzyonu

Induction of Acute Ischemic Stroke in Mice Using the Distal Middle Artery Occlusion Technique

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic stroke patients are eligible to receive intravascular thrombolysis or mechanical thrombectomy therapy within the optimal time window. Among those stroke survivors, around two-thirds suffer neurological dysfunctions over an extended period. Establishing a stable and repeatable experimental ischemic stroke model is extremely significant for further investigating the pathophysiological mechanisms and developing effective therapeutic strategies for ischemic stroke. The middle cerebral artery (MCA) represents the predominant location of ischemic stroke in humans, with the MCA occlusion serving as the frequently employed model of focal cerebral ischemia. In this protocol, we describe the methodology of establishing the distal MCA occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6 mice. Since the occlusion site is located at the cortical branch of MCA, this model generates a moderate infarcted lesion restricted to the cortex. Neurological behavioral and histopathological characterization have demonstrated visible motor dysfunction, neuron degeneration, and pronounced activation of microglia and astrocytes in this model. Thus, this dMCAO mouse model provides a valuable tool for investigating the ischemiastroke and worth of popularization.

Yazar Spotlight: İnme Araştırmaları için Farelerde Güvenilir Bir Distal MCA Oklüzyon Modeli Oluşturma

Here, we present a protocol to establish a distal middle cerebral artery occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6J mice and evaluate the subsequent neurological behavior and histopathological features.

Distal Orta Arter Oklüzyonu Tekniği Kullanılarak Farelerde Akut İskemik İnme İndüksiyonu

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic ...

Fare Hipokampal Astrositler Seks Farkları sonra

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Fare Kortikal astrositlerde İzolasyon ve Kültür

İskemik Hücre Ölümü Pathways Eğitim için seks Katmanlı Nöronal Kültürleri

Farelerde Hipokampal Bölgesi Dentate Gyrus dendritik arborization Değerlendirilmesi

Astrocyte reaktivite ve nükleer silahların yayılmasına karşı Vitro iskemik benzeri koşullar altında izleme

Yenidoğan hipoksik-iskemik beyin hasarı, fare modeli neurobehavioral değerlendirmesi

Fonksiyonel Çalışma için Ex Vivo Basınçlı Hipokampal Kapiller-Parenkimal Arteriyol Hazırlığı

İskemide Nöron-Glia Etkileşimlerinin Rolünü Nörade İncelemek İçin Hücre Kültürü Modeli

Astrosit Bölgesi Hacminin Analizi ve Kalın Serbest Yüzen Doku Kesitlerinde Döşeme

Distal Orta Arter Oklüzyonu Tekniği Kullanılarak Farelerde Akut İskemik İnme İndüksiyonu

Distal Orta Arter Oklüzyonu Tekniği Kullanılarak Farelerde Akut İskemik İnme İndüksiyonu