Name: sex differences in mouse hippocampal astrocytes after in-vitro ischemia
Uploaded: 2016-10-25T12:30:00.000+00:00
Duration: 8 min 32 s
Description: Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Clinical and Translational Science Award program of NCATS UL1 TR0000427 and KL2 TR000428 (Cengiz P), UL1TR000427 to the UW ICTR from NIH/NCATS and funds from Waisman Center (Cengiz P), K08 NS088563-01A1 from NINDS (Cengiz P) and NIH P30 HD03352 (Waisman Center), NIH/NINDS 1K08NS078113 (Ferrazzano P). We would like to thank Albee Messing, PhD, for providing us the GFAP knockout mice.

HINWEIS: Diese Studie wurde in Übereinstimmung mit der Empfehlung des Leitfadens für die Pflege und Verwendung von Labortieren des National Institute of Health durchgeführt. Das Tier Protokoll wurde von der University of Wisconsin-Madison, Institutional Animal Care und Use Committee genehmigt. Primäre Astrocyte Kultur Protokoll , das hier vorgestellt wird , wird aus den von Zhang Y 19 et al Protokolle angenommen. Und Cengiz P 20 et al. Mit einigen Modifikationen. 1. Hippocampale Dissection und Astrocyte Kultur <ol><li> Bereiten Sie alle notwendigen Reagenzien und Materialien einschließlich chirurgische Scheren, glatt feinen Pinzette, flache Spitze Pinzette, Papiertücher, Abfallbeutel, 70% Ethanol und 2 Sezieren Gerichte (3,5 cm Durchmesser) auf Eis gefüllt mit 2 ml Hanks Balanced Salt Solution (HBSS) jeder . Stellen Sie sicher, dass die chirurgische Ausrüstung sind steril (Autoklav) vor dem Verfahren lassen und alle anderen Materialien (Astrocyte Plating Medium: DMEM + 5% Pferdeserum +1% Penicillin-Streptomycin, Pferdeserum, HBSS, 0,25% Trypsin, Glasplättchen, Petrischalen, 15/50 ml - Röhrchen, T25 Flaschen, etc.) als vorge steril. </li><li> Mit scharfen sterilen Schere [1 (1)] vorsichtig halten und den Kopf und den Hals der Maus pup mit 70% Ethanol besprühen und enthaupten. </li><li> Führen Sie einen Mittelschnitt von hinten nach vorn Schädel mit einer kleinen Schere entlang der Kopfhaut , das Gehirn zu entlarven [1 (2-3)]. </li><li> Schneiden Sie den Schädel vorsichtig vom Hals bis zur Nase mit einer kleinen Schere. Dann schneiden Sie Schädel anterior der Riechkolben und schlechter als das Cerebellum den Schädel von der Schädelbasis zu trennen. </li><li> Machen Sie einen kleinen Schnitt an der Basis des Schädels und entlang der Mittellinie geschnitten. Verwenden Sie sterile Flach Spitze Zange den Schädel abzulösen. Entfernen Sie den Hirnstamm mit Hilfe einer gebogenen Pinzette. Entfernen Sie Gehirn aus dem Schädel und legen Sie in die erste Sezieren Gericht [1 (4-9)] 21. </li><li> Unter Verwendung einer gebogenen Pinzette, drehen das Gehirn , so dass die ventrale Oberfläche des Gehirns nach oben und trennen sich dann die beiden Hemisphären mit einem scharfen sterilen chirurgischen Klinge [1 (10,11)] </li><li> Ziehen Sie die zerebralen Hemisphären und sorgfältig die prall Mittelhirns und Thalamus Gewebe mit einer sterilen flach gebogenen Pinzette entfernen Sie den Hippocampus zu offenbaren, eine kleine, Seepferdchen förmige Struktur im medialen Temporallappen [1 (12-14)]. </li><li> Entfernen Sie sowohl die Hippokampus - Lappen [1 (15,16)] und sorgfältig die Meningen von den Lappen sezieren , indem sie mit den feinen Pinzette ziehen. Dieser Schritt vermeidet eine Verunreinigung der endgültigen Astrozyten Kultur von meningealen Zellen und Fibroblasten. </li><li> Übertragen Sie die vorbereiteten Hippokampus - Lappen in die zweite Schale mit HBSS gefüllt und schicken Sie es auf Eis [1 (17,18)]. Pool sowohl Hippocampus-Lappen aus einer einzigen Maus (P0 - P2) zur Herstellung von hippoCampal Astrozytenkulturen. Dies gibt die Astrozyten richtige Dichte. Mince Hippokampus-Lappen einen scharfen sterilen chirurgischen Klinge (ca. 4 mal). </li><li> Absaugen HBSS aus Schale mit einer sterilen Spitze an einer 1-ml-Pipette und 3 ml 0,25% Trypsin, mischen, Transfer in ein 15 ml sterilen konischen Röhrchen und inkubieren das Gewebe bei 37 ° C für 20 min unter leichtem Schütteln. </li><li> Zentrifugenröhrchen bei 300 g für 5 min. Absaugen Überstand unter Verwendung sorgfältig mit einer sterilen Glaspipette mit einer Vakuumleitung angebracht. In 10 ml Astrozyten Plattierungsmedium und verreiben (20 - 30 mal) mit einem feuerpolierte Glaspipette, bis die Gewebestücke homogenisieren. </li><li> Zentrifugenröhrchen bei 300 g für 5 min. Überstand entfernen und mit 2 ml frischem vorgewärmtem Astrozyten Plattenmedien. Passieren Zellen durch ein 70 &amp; mgr; m-Mesh-Filter (Zellsieb) in ein neues 50 ml konischen Röhrchen. </li><li> Platte gesamte Zellsuspension auf Poly-D-Lysine / Laminin beschichtet sterile T25 Kulturflasche mit 3 mlAstrozyten Plattierung Medien, brüten dann der Kolben bei 37 ° C in einem 5% CO 2 Inkubator. </li><li> Absaugen gesamte Medien bei Tages- i n-vitro (DIV) 1, DIV 3 und DIV 7 und ersetzen mit 2 ml frischem Astrozyten Plattierung Medien. Beachten Sie die Progression und astrozytären Zusammenfluß unter dem Lichtmikroskop jedes Mal, während die Astrozyten Plattierung Medien zu ersetzen. HINWEIS: Bei DIV 1 alle lebensfähigen Astrozyten an der Oberfläche der Kulturflasche angebracht und die toten oder sterbenden Zellen, Nervenzellen enthalten, werden in der überstehenden Flüssigkeit schwimmt. Bei DIV 3 beginnen die anhaftenden Zellen zu teilen astrozytären Zellschicht zu bilden. In Abwesenheit der unterstützenden Bedingungen ist Kultur fast frei von jeder neuronalen Wachstums. Bei DIV 7 ist Astrozyten-Schicht etwa 80-90% konfluent und einige Mikroglia sowie Oligodendrozyten-Vorläuferzellen vorhanden sind auf der Oberseite der Schicht astrozytären. </li><li> Saugen Sie das Plattenmedium aus dem Kolben, fügen Sie 2 ml frischem vorgewärmtem Astrozyten Plattierungsmedium gründlich einnd wieder entfernen bei DIV 11, wenn Astrozyten sind konfluent und bereit für die Kultivierung sub. </li><li> In 2 ml 0,25% Trypsin, sanft den Kolben einige Male drehen und absaugen Trypsin eine sterile Glaspipette verwenden. </li><li> In 2 ml 0,25% Trypsin und ließ den Kolben 4 in der Gewebekultur Haube sitzen - 5 min bei RT. </li><li> Entfernen Sie die Trypsin und halten den Kolben bei 37 ° C in einem 5% CO 2 Inkubator für 10 min. In 5 ml vorgewärmtes Astrozyten Plattierungsmedium und entfernen Sie die astrozytären Schicht, indem der Kolben gegen die Handfläche klopfen (3 bis 4 mal) durch leichtes Verreiben gefolgt vollständige Ablösung zu erreichen und die Astrozyten in einem 15 ml konischen Röhrchen sammeln. </li><li> Zentrifugenröhrchen bei 300 g für 5 min den Überstand aspirieren, und fügen Sie 1 ml frisches Astrozyten Plattierungsmedium. </li><li> Fügen Sie 10 ul der Zellsuspension auf eine Zählkammer und zählen Sie die Zellen in der großen zentralen gerasterten Bereich (1 mm 2) unter Verwendung eines invertierten Phasenkontrastmikroskop (10X - Objektiv). Multiply von 10 4 , die Anzahl der Zellen pro ml zu bestimmen. Ein T25 - Kolben nachgeben ~ 1 x 10 6 insgesamt dissoziierten Zellen. Seed ~ 1 x 10 5 Zellen in 2 ml astrocyte Plattierungsmedium auf einem 12 mm Durchmesser Poly-D-Lysine vorbeschichteten Deckglas in die Vertiefung einer 24-Well - Kulturschale. </li><li> In einer 5% CO 2 Inkubator bei 37 ° C inkubieren. Führen Sie OGD / Reox bei DIV 12 bis 14 (Abschnitt 2). </li><li> Behandeln Sie die Astrozytenkulturen bei DIV 3 mit 5 mM L-Leucin-Methylester (LME) Hydrochlorid bis DIV 11, wenn Hippokampus-Kulturen frei von Mikroglia erwünscht sind. Nach LME Inkubation Fachkulturen zu Schütteln (300 Umdrehungen pro Minute für 1 h) verunreinigen Mikroglia zu entfernen. HINWEIS: LME ist ein microglial zytotoxischen Mittel , das in großem Umfang als ein Verfahren verwendet wurde Mikroglia 22 zu beseitigen proliferierenden. </li></ol> 2. OGD / Reox Behandlung <ol><li> Absaugen Medien von Deck enthält adhärenten Astrozyten Kultur (DIV 12 bis 14) und spülen Sie 3-maldurch die 24-Well - Kulturschale das Deckglas ein paar Mal mit 1 ml isotonischer OGD - Lösung (pH 7,4) , die (in mM) hält sanft rotierenden: 0 Glukose, 21 NaHCO 3, 120 NaCl, 5,36 KCl, 0,33 Na 2 HPO 4, 0,44 KH 2 PO 4, 1,27 CaCl 2 und 0,81 MgSO 4. </li><li> In 0,2 ml OGD Lösung auch das Deckglas zu bedecken und 2 h in einem hypoxischen Inkubator inkubieren enthält 94% N 2, 1% O 2 und 5% CO 2. Vorsichtig mit einem Orbitalschüttler (50 rpm) für die ersten 30 min der Hypoxie mischen Gasaustausch zu erleichtern. </li><li> Inkubieren normoxischen Kontrollzellen für 2 h in 5% CO 2 und atmosphärische Luft in einem Puffer identisch mit der OGD - Lösung mit Ausnahme der Zugabe von 5,5 mM Glucose. </li><li> Für Reox absaugen OGD-Lösung und 2 mL Astrozyten Plating Medium. Inkubiere in 5% CO 2 und atmosphärischer Luft bei 37 ° C für 5 h. </li></ol> 3. immunzytochemische Färbung &lt;/ P&gt; <ol><li> Absaugen Kulturmedien eine sterile Glaspipette mit einer Vakuumleitung angebracht verwenden und schnell Deck spülen einmal durch Zugabe von 1 ml 0,1 M Tris-gepufferter Salzlösung (TBS) (154 mM NaCl, 16 mM Trizma-Base, 84 mM Tris-HCl, pH 7,4) zum Brunnen. Absaugen und mit 2 ml 4% Paraformaldehyd (PFA) in 1x Phosphat-gepufferte Saline (PBS). Inkubieren für 15 min bei RT. </li><li> Absaugen und fügen Sie 1 ml 0,1 M TBS, legen Sie dann auf einem Schüttler für 2 min. 3-mal wiederholen. In 1 ml Blockierungslösung (10% Ziegenserum, 10 mg / ml BSA, 0,025% Triton X-100 in 0,1 M TBS) und Inkubation für 30 min bei 37 ° C auf einem Schüttler. </li><li> Aspirat Blockierungslösung und primären anti-GFAP monoklonalen Maus-Antikörper hinzuzufügen (0,2 ml einer 1: 500-Verdünnung in Blockierlösung) und Kaninchen-polyklonalen Anti-S100B (1: 500) oder polyklonalem Kaninchen-anti-HIF1α (1: 200) für 60 min bei 37 ° C auf einem Schüttler. </li><li> und Maus mon: Alternativ werden einige Astrozyten mit polyklonalen Kaninchen-anti-Iba1 (200 1) inkubiertoclonal anti-MAP2 Reinheit der Kultur zuzugreifen. </li><li> Absaugen primären Antikörper und spülen Deckglas durch Zugabe von 1 ml 0,1 M TBS und Unterbringung an einem Schüttler für 2 Minuten und dann gründlich absaugen. Zweimal wiederholen. </li><li> Hinzufügen 0,2 ml einer 1: 200-Verdünnung des sekundären Ziegen-Anti-Kaninchen-488-konjugiertem und anti-Maus-568-konjugierten Antikörper in Blocking-Lösung für 60 min bei 37 ° C auf einem Schüttler. </li><li> Absaugen sekundären Antikörper und spülen Deckglas durch Zugabe von 1 ml 0,1 M TBS und auf einem Schüttler für 2 Minuten und dann gründlich absaugen. Zweimal wiederholen. </li><li> Entfernen Sie Deck von gut und trocken, indem man auf eine Folie auf einem Schlitten Trockner positioniert. Berg Deckglas auf einer neuen Folie, indem Sie auf einen einzigen Tropfen des Vectashield Umkehren hardset Eindeckmedium mit DAPI (1,5 ng / ul). </li><li> Bild Deckgläser auf einem konfokalen Mikroskop entweder 20X trocken oder 60X Öl-Objektiv. Erwerben Sie Bilder (512 x 512) für DAPI (405 nm ex / 450 nm em) und Fluorochrom 488 markiert GFAP Antikörper (488 nm ex / 515 nmem). Halten Sie Erfassungsparameter konstant innerhalb der 20X und 60X-Gruppen. </li></ol> 4. Geschlechtsbestimmung mittels PCR <ol><li> Wärme Pup Zeh oder Finger Schnittgut bei 95 ° C für 45 min in 50 mM NaOH und Neutralisieren mit einem gleichen Volumen von 1 M Tris, pH 6,8. </li><li> 1 &amp; mgr; l der extrahierten DNA-Lösung zu 19 &amp; mgr; l des folgenden Gemisches: 5 pmol Primer für die MYOG und Sry Gene, 1x Reaktionspuffer, 0,2 mM von jedem Desoxynukleotid und 8 U Taq-Polymerase. </li><li> Verwenden Sie Primer-Sequenzen; Sry 5&#39;TCATGAGACTGCCAACCACAG3 &#39;, 5&#39;CATGACCACCACCACCACCAA3&#39; und MYOG 5&#39;TTACGTCCATCGTGGACAGC3 &#39;, 5&#39;TGGGCTGGGTGTTAGTCTTA3&#39; 23. </li><li> Führen Sie die folgende PCR-Protokoll: 95 ° C für 3 min, dann 30 Zyklen Denaturierung bei 95 ° C für 15 s, Annealing bei 58 ° C für 15 s und Verlängerung bei 72 ° C für 1 min. Nach dieser 30 Zyklen schließt die Reaktion mit einem letzten 72 ° C Elongation für 1 min. </li><li> Separate PCR Produkte elektrophoretisch auf einem mit Ethidiumbromid, das 2% Agarose-Gel und unter UV-Beleuchtung sichtbar. (2A.) ACHTUNG! Ethidiumbromid ist ein potenzielles Karzinogen und muss sorgfältig und fachgerecht gemäß Institution Vorschriften entsorgt behandelt werden. </li></ol>

<ol>
	<li>Powell, E. M., Geller, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+astrocyte-mediated+cues+in+neuronal+guidance+and+process+extension.">Dissection of astrocyte-mediated cues in neuronal guidance and process extension.</a> Glia. 26, 73-83 (1999).</li><li>Koehler, R. C., Roman, R. J., Harder, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytes+and+the+regulation+of+cerebral+blood+flow.">Astrocytes and the regulation of cerebral blood flow.</a> Trends in neurosciences. 32, 160-169 (2009).</li><li>Seifert, G., Schilling, K., Steinhauser, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocyte+dysfunction+in+neurological+disorders:+a+molecular+perspective.">Astrocyte dysfunction in neurological disorders: a molecular perspective.</a> Nature reviews. Neuroscience. 7, 194-206 (2006).</li><li>Ballabh, P., Braun, A., Nedergaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+blood-brain+barrier:+an+overview:+structure,+regulation,+and+clinical+implications.">The blood-brain barrier: an overview: structure, regulation, and clinical implications.</a> Neurobiology of disease. 16, 1-13 (2004).</li><li>Araque, A., Parpura, V., Sanzgiri, R. P., Haydon, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tripartite+synapses:+glia,+the+unacknowledged+partner.">Tripartite synapses: glia, the unacknowledged partner.</a> Trends in neurosciences. 22, 208-215 (1999).</li><li>Anderson, M. A., Ao, Y., Sofroniew, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+reactive+astrocytes.">Heterogeneity of reactive astrocytes.</a> Neuroscience letters. 565, 23-29 (2014).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Na+/H++exchanger+isoform+1+is+neuroprotective+in+neonatal+hypoxic+ischemic+brain+injury.">Inhibition of Na+/H+ exchanger isoform 1 is neuroprotective in neonatal hypoxic ischemic brain injury.</a> Antioxidants &amp; redox signaling. 14, 1803-1813 (2011).</li><li>Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+brain+injury.">Neonatal brain injury.</a> The New England journal of medicine. 351, 1985-1995 (2004).</li><li>Hill, C. A., Fitch, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+differences+in+mechanisms+and+outcome+of+neonatal+hypoxia-ischemia+in+rodent+models:+implications+for+sex-specific+neuroprotection+in+clinical+neonatal+practice.">Sex differences in mechanisms and outcome of neonatal hypoxia-ischemia in rodent models: implications for sex-specific neuroprotection in clinical neonatal practice.</a> Neurol Res Int. , 1-9 (2012).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERalpha+Signaling+Is+Required+for+TrkB-Mediated+Hippocampal+Neuroprotection+in+Female+Neonatal+Mice+after+Hypoxic+Ischemic+Encephalopathy(1,2,3).">ERalpha Signaling Is Required for TrkB-Mediated Hippocampal Neuroprotection in Female Neonatal Mice after Hypoxic Ischemic Encephalopathy(1,2,3).</a> eNeuro. 3, (2016).</li><li>Uluc, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TrkB+receptor+agonist+7,+8+dihydroxyflavone+triggers+profound+gender-+dependent+neuroprotection+in+mice+after+perinatal+hypoxia+and+ischemia.">TrkB receptor agonist 7, 8 dihydroxyflavone triggers profound gender- dependent neuroprotection in mice after perinatal hypoxia and ischemia.</a> CNS Neurol Disord Drug Targets. 12, 360-370 (2013).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+microglia+activation+after+hypoxia-ischemia+results+in+age-dependent+improvements+in+neurologic+injury.">Suppression of microglia activation after hypoxia-ischemia results in age-dependent improvements in neurologic injury.</a> J Neuroimmunol. 291, 18-27 (2016).</li><li>McQuillen, P. S., Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+vulnerability+in+the+developing+central+nervous+system.">Selective vulnerability in the developing central nervous system.</a> Pediatr Neurol. 30, 227-235 (2004).</li><li>Morken, T. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+astrocyte-neuronal+interactions+after+hypoxia-ischemia+in+the+neonatal+brain+in+female+and+male+rats.">Altered astrocyte-neuronal interactions after hypoxia-ischemia in the neonatal brain in female and male rats.</a> Stroke; a journal of cerebral circulation. 45, 2777-2785 (2014).</li><li>Chisholm, N. C., Sohrabji, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytic+response+to+cerebral+ischemia+is+influenced+by+sex+differences+and+impaired+by+aging.">Astrocytic response to cerebral ischemia is influenced by sex differences and impaired by aging.</a> Neurobiology of disease. 85, 245-253 (2016).</li><li>Liu, M., Oyarzabal, E. A., Yang, R., Murphy, S. J., Hurn, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+assessing+sex-specific+and+genotype-specific+response+to+injury+in+astrocyte+culture.">A novel method for assessing sex-specific and genotype-specific response to injury in astrocyte culture.</a> Journal of neuroscience methods. 171, 214-217 (2008).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+biological+contributions+to+human+health:+does+sex+matter?.">Exploring the biological contributions to human health: does sex matter?.</a> Journal of women's health &amp; gender-based. 10, 433-439 (2001).</li><li>Collins, F. S., Tabak, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Policy:+NIH+plans+to+enhance+reproducibility.">Policy: NIH plans to enhance reproducibility.</a> Nature. 505, 612-613 (2014).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78, 785-798 (2013).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+Na+/H++exchanger+activation+promotes+gliotransmitter+release+from+reactive+hippocampal+astrocytes+following+oxygen-glucose+deprivation.">Sustained Na+/H+ exchanger activation promotes gliotransmitter release from reactive hippocampal astrocytes following oxygen-glucose deprivation.</a> PloS one. 9, e84294 (2014).</li><li>Landis, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+call+for+transparent+reporting+to+optimize+the+predictive+value+of+preclinical+research.">A call for transparent reporting to optimize the predictive value of preclinical research.</a> Nature. 490, 187-191 (2012).</li><li>Hamby, M. E., Uliasz, T. F., Hewett, S. J., Hewett, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+an+improved+procedure+for+the+removal+of+microglia+from+confluent+monolayers+of+primary+astrocytes.">Characterization of an improved procedure for the removal of microglia from confluent monolayers of primary astrocytes.</a> J Neurosci Methods. 150, 128-137 (2006).</li><li>McClive, P. J., Sinclair, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+DNA+extraction+and+PCR-sexing+of+mouse+embryos.">Rapid DNA extraction and PCR-sexing of mouse embryos.</a> Molecular reproduction and development. 60, 225-226 (2001).</li><li>Wolterink-Donselaar, I. G., Meerding, J. M., Fernandes, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gender+determination+in+newborn+dark+pigmented+mice.">A method for gender determination in newborn dark pigmented mice.</a> Lab Anim (NY). 38, 35-38 (2009).</li><li>Uliasz, T. F., Hamby, M. E., Jackman, N. A., Hewett, J. A., Hewett, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+primary+astrocyte+cultures+devoid+of+contaminating+microglia.">Generation of primary astrocyte cultures devoid of contaminating microglia.</a> Methods Mol Biol. 814, 61-79 (2012).</li><li>Raponi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=S100B+expression+defines+a+state+in+which+GFAP-expressing+cells+lose+their+neural+stem+cell+potential+and+acquire+a+more+mature+developmental+stage.">S100B expression defines a state in which GFAP-expressing cells lose their neural stem cell potential and acquire a more mature developmental stage.</a> Glia. 55, 165-177 (2007).</li><li>Souza, D. G., Bellaver, B., Souza, D. O., Quincozes-Santos, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+adult+rat+astrocyte+cultures.">Characterization of adult rat astrocyte cultures.</a> PloS one. 8, e60282 (2013).</li><li>Puschmann, T. B., Dixon, K. J., Turnley, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+differences+in+reactivity+of+mouse+and+rat+astrocytes+in+vitro.">Species differences in reactivity of mouse and rat astrocytes in vitro.</a> Neuro-Signals. 18, 152-163 (2010).</li><li>Schildge, S., Bohrer, C., Beck, K., Schachtrup, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+mouse+cortical+astrocytes.">Isolation and culture of mouse cortical astrocytes.</a> Journal of visualized experiments : JoVE. , (2013).</li><li>Saura, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglial+cells+in+astroglial+cultures:+a+cautionary+note.">Microglial cells in astroglial cultures: a cautionary note.</a> J Neuroinflammation. 4 (26), (2007).</li></ol>

Keiner der Autoren haben im Wettbewerb oder widerstreitenden Interessen.

Um die geschlechtsspezifische Unterschiede in den Eigenschaften und Funktion der Astrozyten unter physiologischen und pathologischen Bedingungen zu untersuchen, die Vorbereitung von sexed primären Astrozyten in der Zellkultur ist ein wichtiges Instrument zu nutzen. In der vorliegenden Studie berichten wir über eine hocheffiziente und ein reproduzierbares Verfahren zur Kultur ein hochangereichertes homogene Population von sexed Hippokampus - Astrozyten von Neugeborenen (P0-P2) C57Bl / 6 (Wildtyp) oder K19F (GFAP null) ...

Astrozyten sind eine der wichtigsten Schlüsselspieler im zentralen Nervensystem (ZNS). Immer deutlicher abzeichnet, zeigt an, dass die Rollen von Astrozyten sind mehr als neuronale Unterstützung. In der Tat können die Rollen der Astrocyten unter physiologischen Bedingungen sehr komplex, wie die Wanderung der Entwicklungs Axone 1 Führung Regulieren CNS Blutfluß 2, um den pH - Homöostase des synaptischen Interstitialflüssigkeit 3 und in der Blut - Hirn - Schranke beteiligt 4 und 5 der synaptischen Übertragung. Unter pathologischen Bedingungen reagieren Astrozyten zu Verletzungen im Zusammenhang mit einem Prozess reaktiven Astrogliose genannt , in dem die Morphologie, Anzahl, Lage, Topographie (in Bezug auf Abstand von Insult) und Funktion der Astrozyten in einer heterogenen Weise 6,7 geändert. Astrogliose folgende neonatalen hypoxischen ischämischen Enzephalopathie gesehen vielleicht auf die Morbidität und Mortalität von Neugeborenen beitragen <sbis&gt; 8. Neuere klinische und experimentelle Studien zeigen, dass die Schwere der Hirnverletzung wird geschlechtsabhängig zu sein und dass die männlichen Neugeborenen anfälliger für die Wirkungen von Hypoxie / Ischämie (HALLO) -bezogene Hirnverletzung, was zu schweren neurologischen Ergebnisse im Vergleich zu Frauen mit vergleichbaren Hirnverletzungen 11.09. Obwohl die Lokalisation der Verletzung auf dem Schwangerschaftsalter und der Dauer und der Schwere der Insult abhängt, ist hippocampus eine der am häufigsten durchgeführt Regionen im ZNS nach der Begriff neonatal HALLO und erhöhte hippocampal Astrogliose durch Hochregulierung von bestätigt die sauren Gliafaserproteins (GFAP) 3 d nach der Neugeborenen HALLO 7,10,12,13. Geschlechtsunterschiede in Astrozytenfunktion wurden in beiden Neugeborenen und erwachsenen Nagetieren nach zerebraler Ischämie 14,15 gezeigt. Zusätzlich wurde männlichen astrozytären Anfälligkeit für in-vitro Ischämie durch erhöhte cel gezeigtenl Tod im Vergleich zu weiblichen kortikalen Astrozyten in Kultur 16. Geschlechtsunterschiede beginnen in-utero und weiter bis zum Tod 17. Im Laufe der letzten zehn Jahre von der Bedeutung , die Geschlechter in der experimentellen Bedingungen in Zellkultur mit und in-vivo - Studien haben die Schwerpunkte des Instituts für Medizin und NIH gewesen grundlegende Kenntnisse in den geschlechtsspezifische Unterschiede in der physiologischen und pathologischen Zuständen gesehen zu suchen 17,18 . Entwicklung zuverlässiger Methoden Populationen von sexed Hippokampus-Astrozyten zu isolieren und zu pflegen ist wichtig, die zellulären Grundlagen der Geschlechtsunterschiede in den pathologischen Folgen der Neugeborenen-HALLO zu verstehen. Die vorliegende Studie wurde entworfen, um die Techniken zu bieten angereichertem geschlechtsspezifische hippokampale Astrozytenkulturen von neugeborenen Mäusen vorzubereiten, um die Rollen von GFAP-immunoreaktive Astrozyten zu bewerten folgenden Sauerstoff / Glukose-Deprivation (OGD) und Reoxygenierung (Reox), induzierenHALLO in Zellkulturumgebung. Diese Technik kann verwendet werden, um eine Hypothese zu testen, in Bezug auf Hippokampus-Astrocyten in neonatal Männchen und Weibchen unter normoxischen und ischämischen Zuständen.

<table><tbody><tr><td>&lt;strong&gt;&lt;em&gt;Astrocyte culture media&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DMEM, high glucose</td><td>cellgro</td><td>10-013-CV</td><td></td></tr><tr><td>Horse Serum</td><td>Gibco</td><td>26050-070</td><td>Final Concentration: 10%</td></tr><tr><td>Penicillin-Streptomycin</td><td>Cellgro&amp;nbsp;</td><td>30-002-CI</td><td>Final Concentration: 1%</td></tr><tr><td>L-Leucine methyl ester hydrochloride</td><td>Aldrich</td><td>L1002-25G</td><td>Final Concentration: 5 mM</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Solution for brain tissue digestion&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HBSS</td><td>Life Technologies</td><td>14170-088</td><td></td></tr><tr><td>Trypsin</td><td>cellgro</td><td>25-050-CI</td><td>Final Concentration: 0.25%</td></tr><tr><td>&lt;strong&gt;&lt;em&gt;Other&lt;/em&gt;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>70% (vol/vol) ethanol</td><td>Roth</td><td>9065.2</td><td></td></tr><tr><td>Poly-D-Lysine (PDL) 12 mm round coverslips&amp;nbsp;</td><td>Corning</td><td>354087</td><td></td></tr><tr><td>Water</td><td>Sigma</td><td>W3500</td><td>Cell-culture grade</td></tr><tr><td>PBS</td><td>cellgro</td><td>21-040-CV</td><td>Cell-culture grade</td></tr><tr><td>0.05% Trypsin-EDTA&amp;nbsp;</td><td>Life Technologies</td><td>25300-062</td><td></td></tr><tr><td>70 &amp;mu;m Sterile cell strainer&amp;nbsp;</td><td>Fisher scientific</td><td>22363548</td><td></td></tr><tr><td>3.5 cm Petri dish</td><td>BD Falcon</td><td>353001</td><td></td></tr><tr><td>15 mL Falcon tube</td><td>BD Falcon</td><td>352096</td><td></td></tr><tr><td>50 mL Falcon tube</td><td>BD Falcon</td><td>352070</td><td></td></tr><tr><td>Forceps, fine&amp;nbsp;</td><td>Dumont</td><td>2-1032; 2-1033</td><td># 3c; # 5</td></tr><tr><td>Forceps, flat tip</td><td>KLS Martin</td><td>12-120-11</td><td></td></tr><tr><td>13 cm surgical scissors</td><td>Aesculap</td><td>BC-140-R</td><td></td></tr><tr><td>Confocal Microscope</td><td>Nikon</td><td>A1RSi&amp;nbsp;</td><td></td></tr><tr><td>Centrifuge</td><td>Eppendorf</td><td>5805000.017</td><td>5804R</td></tr><tr><td>Orbital Shaker</td><td>Thermo Scientific</td><td>SHKE 4450-1CE</td><td>MaxQ 4450&amp;nbsp;</td></tr><tr><td>Anti-IBA1</td><td>Wako</td><td>019-19741</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-MAP2</td><td>Sigma</td><td>M2320</td><td>Mouse monoclonal</td></tr><tr><td>Anti-HIF1alpha</td><td>abcam</td><td>ab179483</td><td>Rabbit monoclonal</td></tr><tr><td>Anti-S100B</td><td>Sigma</td><td>HPA015768</td><td>Rabbit polyclonal</td></tr><tr><td>Anti-GFAP (cocktail)</td><td>Biolegend</td><td>837602</td><td></td></tr><tr><td>VECTASTAIN Elite ABC Kit (Rabbit IgG)</td><td>Vector Labs</td><td>PK-6101</td><td>Contains 4 Reagents&amp;nbsp;</td></tr><tr><td>Goat Anti Rabbit Alexa-Fluor 488</td><td>Invitrogen</td><td>A11070</td><td></td></tr><tr><td>Goat Anti Mouse Alexa-Fluor 568</td><td>Invitrogen</td><td>A11004</td><td></td></tr></tbody></table>

sex differences in mouse hippocampal astrocytes after in-vitro ischemia

Astrogliose nach Hypoxie / Ischämie (HALLO) -related Hirnverletzung spielt eine Rolle bei einer erhöhten Morbidität und Mortalität bei Neugeborenen. Neuere klinische Studien zeigen , dass die Schwere der Hirnverletzung erscheinen Geschlecht abhängig zu sein, und dass die männlichen Neugeborenen sind anfälliger für die Auswirkungen von HALLO bezogenen Hirnverletzung, was zu mehr schweren neurologischen Ergebnisse als zu Frauen mit vergleichbaren Hirnverletzungen verglichen. Die Entwicklung zuverlässiger Methoden zur Isolierung und hochangereichertes Populationen von sexed Hippokampus-Astrozyten halten ist wichtig, die zellulären Grundlagen der Geschlechtsunterschiede in den pathologischen Folgen der Neugeborenen-HALLO zu verstehen. In dieser Studie beschreiben wir ein Verfahren zur geschlechtsspezifischen hippocampal Astrozytenkulturen schaffen , die in vitro zu einem Modell der Ischämie unterzogen werden, Sauerstoff-glucose deprivation, gefolgt von Reoxygenierung. Nachfolgende reaktive Astrogliose wurde von immunostai geprüftning für den sauren Gliafaserproteins (GFAP) und S100B. Dieses Verfahren stellt ein nützliches Werkzeug, um die Rolle der männlichen und weiblichen hippocampalen Astrozyten folgenden neonatal HALLO, separat zu untersuchen.

Verständnis haben die Rollen von sexed Astrozyten Funktionen unter physiologischen oder pathophysiologischen Bedingungen wurden durch die Kultivierung dieser Zellen unter in vitro Bedingungen immens aufgeklärt. Der wichtige Aspekt gesextem Züchten der Durchführung ist das Geschlecht der Maus Welpen vor seiner Verwendung zu bestimmen. Wir stellten fest , das Geschlecht der Maus genetisch durch PCR und durch visuelle Beurteilung (Abbildung 2) 16. Di...

Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Astrozyten sind eine der wichtigsten Schlüsselspieler im zentralen Nervensystem (ZNS). Hier berichten wir eine praktische Methode der sexed Hippokampus - Astrozyten Kulturprotokoll , um die zugrunde liegenden Mechanismen der Astrozytenfunktion bei männlichen und weiblichen Neugeborenen Welpen nach In-vitro - Ischämie zu untersuchen.

Geschlechtsunterschiede in Mäuse Hippocampus Astrozyten nach<em&gt; In-Vitro</em&gt; Ischemia

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies ...

sex-differences-mouse-hippocampal-astrocytes-after-vitro

Research

JoVE Journal

Neuroscience

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

13.3K Aufrufe.  University of Wisconsin.  Astrozyten sind eine der wichtigsten Schlüsselspieler im zentralen Nervensystem (ZNS). Hier berichten wir eine praktische Methode der sexed Hippokampus - Astrozyten Kulturprotokoll , um die zugrunde liegenden Mechanismen der Astrozytenfunktion bei männlichen und weiblichen Neugeborenen Welpen nach In-vitro - Ischämie zu untersuchen. 

Serie: Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Isolation und Kultur von Maus Kortikale Astrozyten

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Forschung

Neurowissenschaften

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms responsible for those differences remain unclear. Primary disassociated embryonic neuronal culture provides a simplified experimental model with which to investigate the neuronal cell signaling involved in cell death as a result of ischemia or disease; however, most neuronal cultures used in research today are mixed sex. Researchers can and do test the effects of sex steroid treatment in mixed sex neuronal cultures in models of neuronal injury and disease, but accumulating evidence suggests that the female brain responds to androgens, estrogens, and progesterone differently than the male brain. Furthermore, neonate male and female rodents respond differently to ischemic injury, with males experiencing greater injury following cerebral ischemia than females. Thus, mixed sex neuronal cultures might obscure and confound the experimental results; important information might be missed. For this reason, the Herson Lab at the University of Colorado School of Medicine routinely prepares sex-stratified primary disassociated embryonic neuronal cultures from both hippocampus and cortex. Embryos are sexed before harvesting of brain tissue and male and female tissue are disassociated separately, plated separately, and maintained separately. Using this method, the Herson Lab has demonstrated a male-specific role for the ion channel TRPM2 in ischemic cell death. In this manuscript, we share and discuss our protocol for sexing embryonic mice and preparing sex-stratified hippocampal primary disassociated neuron cultures. This method can be adapted to prepare sex-stratified cortical cultures and the method for embryo sexing can be used in conjunction with other protocols for any study in which sex is thought to be an important determinant of outcome.

Primary disassociated embryonic hippocampal neuronal cultures are useful for investigating the signaling mechanisms involved in neuron death. Sexing the embryos before the isolation and dissociation of the hippocampus allows the preparation of separate male and female cultures, which enables the researcher to identify and investigate sex-specific cell signaling.

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms ...

Assessment of Dendritic Arborization in the Dentate Gyrus of the Hippocampal Region in Mice

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity and extent of dendritic arborization correlates well with the synaptic plasticity in these cells. A reliable method for assessment of dendritic arborization is needed to characterize the deleterious effects of neurological disorders on these structures and to determine the effects of therapeutic interventions. However, quantification of these structures has proven to be a formidable task given their complex and dynamic nature. Fortunately, sophisticated imaging techniques can be paired with conventional staining methods to assess the state of dendritic arborization, providing a more reliable and expeditious means of assessment. Below is an example of how these imaging techniques were paired with staining methods to characterize the dendritic arborization in wild type mice. These complementary imaging methods can be used to qualitatively and quantitatively assess dendritic arborization that span a rather wide area within the hippocampal region.

We describe two methods for visualization and quantification of dendritic arborization in the hippocampus of mouse models: real-time and extended depth of field imaging. While the former method allows sophisticated topographical tracing and quantification of the extent of branching, the latter allows speedy visualization of the dendritic tree.

Bewertung der dendritischen Verzweigung im Gyrus dentatus des Hippocampus-Region an der Maus

Dendritic arborization has been shown to be a reliable marker for examination of structural and functional integrity of neurons. Indeed, the complexity ...

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of oxygen and glucose, which causes energy failure and neuronal death. After an ischemic stroke insult, astrocytes become reactive and proliferate around the injury site as it develops. Under this scenario, it is difficult to study the specific contribution of astrocytes to the brain region exposed to ischemia. Therefore, this article introduces a methodology to study primary astrocyte reactivity and proliferation under an in vitro model of an ischemia-like environment, called oxygen glucose deprivation (OGD). Astrocytes were isolated from 1-4 day-old neonatal rats and the number of non-specific astrocytic cells was assessed using astrocyte selective marker Glial Fibrillary Acidic Protein (GFAP) and nuclear staining. The period in which astrocytes are subjected to the OGD condition can be customized, as well as the percentage of oxygen they are exposed to. This flexibility allows scientists to characterize the duration of the ischemic-like condition in different groups of cells in vitro. This article discusses the timeframes of OGD that induce astrocyte reactivity, hypertrophic morphology, and proliferation as measured by immunofluorescence using Proliferating Cell Nuclear Antigen (PCNA). Besides proliferation, astrocytes undergo energy and oxidative stress, and respond to OGD by releasing soluble factors into the cell medium. This medium can be collected and used to analyze the effects of molecules released by astrocytes in primary neuronal cultures without cell-to-cell interaction. In summary, this primary cell culture model can be efficiently used to understand the role of isolated astrocytes upon injury.

Monitoring Astrocyte Reactivity and Proliferation in Vitro Under Ischemic-Like Conditions

Ischemic stroke is a complex event in which the specific contribution of astrocytes to the affected brain region exposed to oxygen glucose deprivation (OGD) is difficult to study. This article introduces a methodology to obtain isolated astrocytes and study their reactivity and proliferation under OGD conditions.

Überwachung der Astrozyten Reaktivität und Proliferation in Vitro unter ischämischen-ähnlichen Bedingungen

Ischemic stroke is a complex brain injury caused by a thrombus or embolus obstructing blood flow to parts of the brain. This leads to deprivation of ...

Neurobehavioral Assessments in a Mouse Model of Neonatal Hypoxic-ischemic Brain Injury

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI brain injury by studying neurobehavioral functions in these mice compared to non-operated (i.e., normal) mice. During the study, Rice-Vannucci&#39;s method was used to induce neonatal HI brain damage in postnatal day 7-10 (P7-10) mice. The HI operation was performed on the pups by unilateral carotid artery ligation and exposure to hypoxia (8% O2 and 92% N2 for 90 min). One week after the operation, the damaged brains were evaluated with the naked eye through the semi-transparent skull and were categorized into subgroups based on the absence (&#34;no cortical injury&#34; group) or presence (&#34;cortical injury&#34; group) of cortical injury, such as a lesion in the right hemisphere. On week 6, the following neurobehavioral tests were performed to evaluate the cognitive and motor functions: passive avoidance task (PAT), ladder walking test, and grip strength test. These behavioral tests are helpful in determining the effects of neonatal HI brain injury and are used in other mouse models of neurodegenerative diseases. In this study, neonatal HI brain injury mice showed motor deficits that corresponded to right hemisphere damage. The behavioral test results are relevant to the deficits observed in human neonatal HI patients, such as cerebral palsy or neonatal stroke patients. In this study, a mouse model of neonatal HI brain injury was established and showed different degrees of motor deficits and cognitive impairment compared to non-operated mice. This work provides basic information on the HI mouse model. MRI images demonstrate the different phenotypes, separated according to the severity of brain damage by motor and cognitive tests.

We performed unilateral carotid artery occlusion on postnatal day 7-10 CD-1 mouse pups to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of HI brain injury. We studied neurobehavioral functions in these mice compared to non-operated normal mice.

Neurobehavioral Bewertungen in einem Mausmodell der Neugeborenen hypoxisch-ischämische Hirnschädigung

We performed unilateral carotid artery occlusion on CD-1 mice to create a neonatal hypoxic-ischemic (HI) model and investigated the effects of neonatal HI ...

Ex Vivo Pressurized Hippocampal Capillary-Parenchymal Arteriole Preparation for Functional Study

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and cardiac arrest are remarkably sexually dimorphic diseases, and both induce cerebral ischemia. However, progress in understanding the vascular cognitive impairment, and then developing sex-specific treatments, has been partly limited by challenges in investigating the brain microcirculation from mouse models in functional studies. Here, we present an approach to examine the capillary-to-arteriole signaling in an ex vivo hippocampal capillary-parenchymal arteriole (HiCaPA) preparation from mouse brain. We describe how to isolate, cannulate, and pressurize the microcirculation to measure arteriolar diameter in response to capillary stimulation. We show which appropriate functional controls can be used to validate the HiCaPA preparation integrity and display typical results, including testing potassium as a neurovascular coupling agent and the effect of the recently characterized inhibitor of the Kir2 inward rectifying potassium channel family, ML133. Further, we compare the responses in preparations obtained from male and female mice. While these data reflect functional investigations, our approach can also be used in molecular biology, immunochemistry, and electrophysiology studies.

The present manuscript details how to isolate hippocampal arterioles and capillaries from the mouse brain and how to pressurize them for pressure myography, immunofluorescence, biochemistry, and molecular studies.

Ex Vivo Druck hippocampal Kapillare-Parenchymale Arteriole Vorbereitung für die funktionelle Studie

From subtle behavioral alterations to late-stage dementia, vascular cognitive impairment typically develops following cerebral ischemia. Stroke and ...

A Cell Culture Model for Studying the Role of Neuron-Glia Interactions in Ischemia

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent neuronal loss. Numerous evidence suggests that the interaction between glial and neuronal cells exert beneficial effects after an ischemic event. Therefore, to explore potential protective mechanisms, it is important to develop models that allow studying neuron-glia interactions in an ischemic environment. Herein we present a simple approach to isolate astrocytes and neurons from the rat embryonic cortex, and that by using specific culture media, allows the establishment of neuron- or astrocyte-enriched cultures or neuron-glia cultures with high yield and reproducibility.
To study the crosstalk between astrocytes and neurons, we propose an approach based on a co-culture system in which neurons cultured in coverslips are maintained in contact with a monolayer of astrocytes plated in multiwell plates. The two cultures are maintained apart by small paraffin spheres. This approach allows the independent manipulation and the application of specific treatments to each cell type, which represents an advantage in many studies.
To simulate what occurs during an ischemic stroke, the cultures are subjected to an oxygen and glucose deprivation protocol. This protocol represents a useful tool to study the role of neuron-glia interactions in ischemic stroke.

Here, we present a simple approach using specific culture media that allows the establishment of neuron- and astrocyte-enriched cultures, or neuron-glia cultures from the embryonic cortex, with high yield and reproducibility.

Ein Zellkulturmodell zum Studium der Rolle von Neuron-Glia-Interaktionen in Ischämie

Ischemic stroke is a clinical condition characterized by hypoperfusion of brain tissue, leading to oxygen and glucose deprivation, and the consequent ...

Analysis of Astrocyte Territory Volume and Tiling in Thick Free-Floating Tissue Sections

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the brain. Through these interactions, astrocytes actively regulate many critical brain functions, including synapse formation, neurotransmission, and ion homeostasis. In the rodent brain, astrocytes grow in size and complexity during the first three postnatal weeks and establish distinct, non-overlapping territories to tile the brain. This protocol provides an established method for analyzing astrocyte territory volume and astrocyte tiling using free-floating tissue sections from the mouse brain. First, this protocol describes the steps for tissue collection, cryosectioning, and immunostaining of free-floating tissue sections. Second, this protocol describes image acquisition and analysis of astrocyte territory volume and territory overlap volume, using commercially available image analysis software. Lastly, this manuscript discusses the advantages, important considerations, common pitfalls, and limitations of these methods. This protocol requires brain tissue with sparse or mosaic fluorescent labeling of astrocytes, and is designed to be used with common lab equipment, confocal microscopy, and commercially available image analysis software.

This protocol describes methods for sectioning, staining, and imaging free-floating tissue sections of the mouse brain, followed by a detailed description of the analysis of astrocyte territory volume and astrocyte territory overlap or tiling.

Analyse des Astrozytengebietsvolumens und der Kachelung in dicken frei schwebenden Gewebeabschnitten

Astrocytes possess an astounding degree of morphological complexity that enables them to interact with nearly every type of cell and structure within the ...

Verschluss der distalen Mittelarterie zur Entwicklung eines ischämischen Schlaganfall-Mausmodells

Induction of Acute Ischemic Stroke in Mice Using the Distal Middle Artery Occlusion Technique

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic stroke patients are eligible to receive intravascular thrombolysis or mechanical thrombectomy therapy within the optimal time window. Among those stroke survivors, around two-thirds suffer neurological dysfunctions over an extended period. Establishing a stable and repeatable experimental ischemic stroke model is extremely significant for further investigating the pathophysiological mechanisms and developing effective therapeutic strategies for ischemic stroke. The middle cerebral artery (MCA) represents the predominant location of ischemic stroke in humans, with the MCA occlusion serving as the frequently employed model of focal cerebral ischemia. In this protocol, we describe the methodology of establishing the distal MCA occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6 mice. Since the occlusion site is located at the cortical branch of MCA, this model generates a moderate infarcted lesion restricted to the cortex. Neurological behavioral and histopathological characterization have demonstrated visible motor dysfunction, neuron degeneration, and pronounced activation of microglia and astrocytes in this model. Thus, this dMCAO mouse model provides a valuable tool for investigating the ischemiastroke and worth of popularization.

Autor im Rampenlicht: Etablierung eines zuverlässigen distalen MCA-Okklusionsmodells bei Mäusen für die Schlaganfallforschung

Here, we present a protocol to establish a distal middle cerebral artery occlusion (dMCAO) model through transcranial electrocoagulation in C57BL/6J mice and evaluate the subsequent neurological behavior and histopathological features.

Induktion eines akuten ischämischen Schlaganfalls bei Mäusen mit der Technik des distalen Mittelarterienverschlusses

Ischemic stroke remains the predominant cause of mortality and functional impairment among the adult populations globally. Only a minority of ischemic ...

Geschlechtsunterschiede in Mäuse Hippocampus Astrozyten nach

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

Isolation und Kultur von Maus Kortikale Astrozyten

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Bewertung der dendritischen Verzweigung im Gyrus dentatus des Hippocampus-Region an der Maus

Überwachung der Astrozyten Reaktivität und Proliferation in Vitro unter ischämischen-ähnlichen Bedingungen

Neurobehavioral Bewertungen in einem Mausmodell der Neugeborenen hypoxisch-ischämische Hirnschädigung

Ex Vivo Druck hippocampal Kapillare-Parenchymale Arteriole Vorbereitung für die funktionelle Studie

Ein Zellkulturmodell zum Studium der Rolle von Neuron-Glia-Interaktionen in Ischämie

Analyse des Astrozytengebietsvolumens und der Kachelung in dicken frei schwebenden Gewebeabschnitten

Induktion eines akuten ischämischen Schlaganfalls bei Mäusen mit der Technik des distalen Mittelarterienverschlusses

Induktion eines akuten ischämischen Schlaganfalls bei Mäusen mit der Technik des distalen Mittelarterienverschlusses