Clinical and Translational Science Award program of NCATS UL1 TR0000427 and KL2 TR000428 (Cengiz P), UL1TR000427 to the UW ICTR from NIH/NCATS and funds from Waisman Center (Cengiz P), K08 NS088563-01A1 from NINDS (Cengiz P) and NIH P30 HD03352 (Waisman Center), NIH/NINDS 1K08NS078113 (Ferrazzano P). We would like to thank Albee Messing, PhD, for providing us the GFAP knockout mice.

HINWEIS: Diese Studie wurde in Übereinstimmung mit der Empfehlung des Leitfadens für die Pflege und Verwendung von Labortieren des National Institute of Health durchgeführt. Das Tier Protokoll wurde von der University of Wisconsin-Madison, Institutional Animal Care und Use Committee genehmigt. Primäre Astrocyte Kultur Protokoll , das hier vorgestellt wird , wird aus den von Zhang Y 19 et al Protokolle angenommen. Und Cengiz P 20 et al. Mit einigen Modifikationen. 1. Hippocampale Dissection und Astrocyte Kultur <ol><li> Bereiten Sie alle notwendigen Reagenzien und Materialien einschließlich chirurgische Scheren, glatt feinen Pinzette, flache Spitze Pinzette, Papiertücher, Abfallbeutel, 70% Ethanol und 2 Sezieren Gerichte (3,5 cm Durchmesser) auf Eis gefüllt mit 2 ml Hanks Balanced Salt Solution (HBSS) jeder . Stellen Sie sicher, dass die chirurgische Ausrüstung sind steril (Autoklav) vor dem Verfahren lassen und alle anderen Materialien (Astrocyte Plating Medium: DMEM + 5% Pferdeserum +1% Penicillin-Streptomycin, Pferdeserum, HBSS, 0,25% Trypsin, Glasplättchen, Petrischalen, 15/50 ml - Röhrchen, T25 Flaschen, etc.) als vorge steril. </li><li> Mit scharfen sterilen Schere [1 (1)] vorsichtig halten und den Kopf und den Hals der Maus pup mit 70% Ethanol besprühen und enthaupten. </li><li> Führen Sie einen Mittelschnitt von hinten nach vorn Schädel mit einer kleinen Schere entlang der Kopfhaut , das Gehirn zu entlarven [1 (2-3)]. </li><li> Schneiden Sie den Schädel vorsichtig vom Hals bis zur Nase mit einer kleinen Schere. Dann schneiden Sie Schädel anterior der Riechkolben und schlechter als das Cerebellum den Schädel von der Schädelbasis zu trennen. </li><li> Machen Sie einen kleinen Schnitt an der Basis des Schädels und entlang der Mittellinie geschnitten. Verwenden Sie sterile Flach Spitze Zange den Schädel abzulösen. Entfernen Sie den Hirnstamm mit Hilfe einer gebogenen Pinzette. Entfernen Sie Gehirn aus dem Schädel und legen Sie in die erste Sezieren Gericht [1 (4-9)] 21. </li><li> Unter Verwendung einer gebogenen Pinzette, drehen das Gehirn , so dass die ventrale Oberfläche des Gehirns nach oben und trennen sich dann die beiden Hemisphären mit einem scharfen sterilen chirurgischen Klinge [1 (10,11)] </li><li> Ziehen Sie die zerebralen Hemisphären und sorgfältig die prall Mittelhirns und Thalamus Gewebe mit einer sterilen flach gebogenen Pinzette entfernen Sie den Hippocampus zu offenbaren, eine kleine, Seepferdchen förmige Struktur im medialen Temporallappen [1 (12-14)]. </li><li> Entfernen Sie sowohl die Hippokampus - Lappen [1 (15,16)] und sorgfältig die Meningen von den Lappen sezieren , indem sie mit den feinen Pinzette ziehen. Dieser Schritt vermeidet eine Verunreinigung der endgültigen Astrozyten Kultur von meningealen Zellen und Fibroblasten. </li><li> Übertragen Sie die vorbereiteten Hippokampus - Lappen in die zweite Schale mit HBSS gefüllt und schicken Sie es auf Eis [1 (17,18)]. Pool sowohl Hippocampus-Lappen aus einer einzigen Maus (P0 - P2) zur Herstellung von hippoCampal Astrozytenkulturen. Dies gibt die Astrozyten richtige Dichte. Mince Hippokampus-Lappen einen scharfen sterilen chirurgischen Klinge (ca. 4 mal). </li><li> Absaugen HBSS aus Schale mit einer sterilen Spitze an einer 1-ml-Pipette und 3 ml 0,25% Trypsin, mischen, Transfer in ein 15 ml sterilen konischen Röhrchen und inkubieren das Gewebe bei 37 ° C für 20 min unter leichtem Schütteln. </li><li> Zentrifugenröhrchen bei 300 g für 5 min. Absaugen Überstand unter Verwendung sorgfältig mit einer sterilen Glaspipette mit einer Vakuumleitung angebracht. In 10 ml Astrozyten Plattierungsmedium und verreiben (20 - 30 mal) mit einem feuerpolierte Glaspipette, bis die Gewebestücke homogenisieren. </li><li> Zentrifugenröhrchen bei 300 g für 5 min. Überstand entfernen und mit 2 ml frischem vorgewärmtem Astrozyten Plattenmedien. Passieren Zellen durch ein 70 &amp; mgr; m-Mesh-Filter (Zellsieb) in ein neues 50 ml konischen Röhrchen. </li><li> Platte gesamte Zellsuspension auf Poly-D-Lysine / Laminin beschichtet sterile T25 Kulturflasche mit 3 mlAstrozyten Plattierung Medien, brüten dann der Kolben bei 37 ° C in einem 5% CO 2 Inkubator. </li><li> Absaugen gesamte Medien bei Tages- i n-vitro (DIV) 1, DIV 3 und DIV 7 und ersetzen mit 2 ml frischem Astrozyten Plattierung Medien. Beachten Sie die Progression und astrozytären Zusammenfluß unter dem Lichtmikroskop jedes Mal, während die Astrozyten Plattierung Medien zu ersetzen. HINWEIS: Bei DIV 1 alle lebensfähigen Astrozyten an der Oberfläche der Kulturflasche angebracht und die toten oder sterbenden Zellen, Nervenzellen enthalten, werden in der überstehenden Flüssigkeit schwimmt. Bei DIV 3 beginnen die anhaftenden Zellen zu teilen astrozytären Zellschicht zu bilden. In Abwesenheit der unterstützenden Bedingungen ist Kultur fast frei von jeder neuronalen Wachstums. Bei DIV 7 ist Astrozyten-Schicht etwa 80-90% konfluent und einige Mikroglia sowie Oligodendrozyten-Vorläuferzellen vorhanden sind auf der Oberseite der Schicht astrozytären. </li><li> Saugen Sie das Plattenmedium aus dem Kolben, fügen Sie 2 ml frischem vorgewärmtem Astrozyten Plattierungsmedium gründlich einnd wieder entfernen bei DIV 11, wenn Astrozyten sind konfluent und bereit für die Kultivierung sub. </li><li> In 2 ml 0,25% Trypsin, sanft den Kolben einige Male drehen und absaugen Trypsin eine sterile Glaspipette verwenden. </li><li> In 2 ml 0,25% Trypsin und ließ den Kolben 4 in der Gewebekultur Haube sitzen - 5 min bei RT. </li><li> Entfernen Sie die Trypsin und halten den Kolben bei 37 ° C in einem 5% CO 2 Inkubator für 10 min. In 5 ml vorgewärmtes Astrozyten Plattierungsmedium und entfernen Sie die astrozytären Schicht, indem der Kolben gegen die Handfläche klopfen (3 bis 4 mal) durch leichtes Verreiben gefolgt vollständige Ablösung zu erreichen und die Astrozyten in einem 15 ml konischen Röhrchen sammeln. </li><li> Zentrifugenröhrchen bei 300 g für 5 min den Überstand aspirieren, und fügen Sie 1 ml frisches Astrozyten Plattierungsmedium. </li><li> Fügen Sie 10 ul der Zellsuspension auf eine Zählkammer und zählen Sie die Zellen in der großen zentralen gerasterten Bereich (1 mm 2) unter Verwendung eines invertierten Phasenkontrastmikroskop (10X - Objektiv). Multiply von 10 4 , die Anzahl der Zellen pro ml zu bestimmen. Ein T25 - Kolben nachgeben ~ 1 x 10 6 insgesamt dissoziierten Zellen. Seed ~ 1 x 10 5 Zellen in 2 ml astrocyte Plattierungsmedium auf einem 12 mm Durchmesser Poly-D-Lysine vorbeschichteten Deckglas in die Vertiefung einer 24-Well - Kulturschale. </li><li> In einer 5% CO 2 Inkubator bei 37 ° C inkubieren. Führen Sie OGD / Reox bei DIV 12 bis 14 (Abschnitt 2). </li><li> Behandeln Sie die Astrozytenkulturen bei DIV 3 mit 5 mM L-Leucin-Methylester (LME) Hydrochlorid bis DIV 11, wenn Hippokampus-Kulturen frei von Mikroglia erwünscht sind. Nach LME Inkubation Fachkulturen zu Schütteln (300 Umdrehungen pro Minute für 1 h) verunreinigen Mikroglia zu entfernen. HINWEIS: LME ist ein microglial zytotoxischen Mittel , das in großem Umfang als ein Verfahren verwendet wurde Mikroglia 22 zu beseitigen proliferierenden. </li></ol> 2. OGD / Reox Behandlung <ol><li> Absaugen Medien von Deck enthält adhärenten Astrozyten Kultur (DIV 12 bis 14) und spülen Sie 3-maldurch die 24-Well - Kulturschale das Deckglas ein paar Mal mit 1 ml isotonischer OGD - Lösung (pH 7,4) , die (in mM) hält sanft rotierenden: 0 Glukose, 21 NaHCO 3, 120 NaCl, 5,36 KCl, 0,33 Na 2 HPO 4, 0,44 KH 2 PO 4, 1,27 CaCl 2 und 0,81 MgSO 4. </li><li> In 0,2 ml OGD Lösung auch das Deckglas zu bedecken und 2 h in einem hypoxischen Inkubator inkubieren enthält 94% N 2, 1% O 2 und 5% CO 2. Vorsichtig mit einem Orbitalschüttler (50 rpm) für die ersten 30 min der Hypoxie mischen Gasaustausch zu erleichtern. </li><li> Inkubieren normoxischen Kontrollzellen für 2 h in 5% CO 2 und atmosphärische Luft in einem Puffer identisch mit der OGD - Lösung mit Ausnahme der Zugabe von 5,5 mM Glucose. </li><li> Für Reox absaugen OGD-Lösung und 2 mL Astrozyten Plating Medium. Inkubiere in 5% CO 2 und atmosphärischer Luft bei 37 ° C für 5 h. </li></ol> 3. immunzytochemische Färbung &lt;/ P&gt; <ol><li> Absaugen Kulturmedien eine sterile Glaspipette mit einer Vakuumleitung angebracht verwenden und schnell Deck spülen einmal durch Zugabe von 1 ml 0,1 M Tris-gepufferter Salzlösung (TBS) (154 mM NaCl, 16 mM Trizma-Base, 84 mM Tris-HCl, pH 7,4) zum Brunnen. Absaugen und mit 2 ml 4% Paraformaldehyd (PFA) in 1x Phosphat-gepufferte Saline (PBS). Inkubieren für 15 min bei RT. </li><li> Absaugen und fügen Sie 1 ml 0,1 M TBS, legen Sie dann auf einem Schüttler für 2 min. 3-mal wiederholen. In 1 ml Blockierungslösung (10% Ziegenserum, 10 mg / ml BSA, 0,025% Triton X-100 in 0,1 M TBS) und Inkubation für 30 min bei 37 ° C auf einem Schüttler. </li><li> Aspirat Blockierungslösung und primären anti-GFAP monoklonalen Maus-Antikörper hinzuzufügen (0,2 ml einer 1: 500-Verdünnung in Blockierlösung) und Kaninchen-polyklonalen Anti-S100B (1: 500) oder polyklonalem Kaninchen-anti-HIF1α (1: 200) für 60 min bei 37 ° C auf einem Schüttler. </li><li> und Maus mon: Alternativ werden einige Astrozyten mit polyklonalen Kaninchen-anti-Iba1 (200 1) inkubiertoclonal anti-MAP2 Reinheit der Kultur zuzugreifen. </li><li> Absaugen primären Antikörper und spülen Deckglas durch Zugabe von 1 ml 0,1 M TBS und Unterbringung an einem Schüttler für 2 Minuten und dann gründlich absaugen. Zweimal wiederholen. </li><li> Hinzufügen 0,2 ml einer 1: 200-Verdünnung des sekundären Ziegen-Anti-Kaninchen-488-konjugiertem und anti-Maus-568-konjugierten Antikörper in Blocking-Lösung für 60 min bei 37 ° C auf einem Schüttler. </li><li> Absaugen sekundären Antikörper und spülen Deckglas durch Zugabe von 1 ml 0,1 M TBS und auf einem Schüttler für 2 Minuten und dann gründlich absaugen. Zweimal wiederholen. </li><li> Entfernen Sie Deck von gut und trocken, indem man auf eine Folie auf einem Schlitten Trockner positioniert. Berg Deckglas auf einer neuen Folie, indem Sie auf einen einzigen Tropfen des Vectashield Umkehren hardset Eindeckmedium mit DAPI (1,5 ng / ul). </li><li> Bild Deckgläser auf einem konfokalen Mikroskop entweder 20X trocken oder 60X Öl-Objektiv. Erwerben Sie Bilder (512 x 512) für DAPI (405 nm ex / 450 nm em) und Fluorochrom 488 markiert GFAP Antikörper (488 nm ex / 515 nmem). Halten Sie Erfassungsparameter konstant innerhalb der 20X und 60X-Gruppen. </li></ol> 4. Geschlechtsbestimmung mittels PCR <ol><li> Wärme Pup Zeh oder Finger Schnittgut bei 95 ° C für 45 min in 50 mM NaOH und Neutralisieren mit einem gleichen Volumen von 1 M Tris, pH 6,8. </li><li> 1 &amp; mgr; l der extrahierten DNA-Lösung zu 19 &amp; mgr; l des folgenden Gemisches: 5 pmol Primer für die MYOG und Sry Gene, 1x Reaktionspuffer, 0,2 mM von jedem Desoxynukleotid und 8 U Taq-Polymerase. </li><li> Verwenden Sie Primer-Sequenzen; Sry 5&#39;TCATGAGACTGCCAACCACAG3 &#39;, 5&#39;CATGACCACCACCACCACCAA3&#39; und MYOG 5&#39;TTACGTCCATCGTGGACAGC3 &#39;, 5&#39;TGGGCTGGGTGTTAGTCTTA3&#39; 23. </li><li> Führen Sie die folgende PCR-Protokoll: 95 ° C für 3 min, dann 30 Zyklen Denaturierung bei 95 ° C für 15 s, Annealing bei 58 ° C für 15 s und Verlängerung bei 72 ° C für 1 min. Nach dieser 30 Zyklen schließt die Reaktion mit einem letzten 72 ° C Elongation für 1 min. </li><li> Separate PCR Produkte elektrophoretisch auf einem mit Ethidiumbromid, das 2% Agarose-Gel und unter UV-Beleuchtung sichtbar. (2A.) ACHTUNG! Ethidiumbromid ist ein potenzielles Karzinogen und muss sorgfältig und fachgerecht gemäß Institution Vorschriften entsorgt behandelt werden. </li></ol>

<ol>
	<li>Powell, E. M., Geller, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+astrocyte-mediated+cues+in+neuronal+guidance+and+process+extension.">Dissection of astrocyte-mediated cues in neuronal guidance and process extension.</a> Glia. 26, 73-83 (1999).</li><li>Koehler, R. C., Roman, R. J., Harder, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytes+and+the+regulation+of+cerebral+blood+flow.">Astrocytes and the regulation of cerebral blood flow.</a> Trends in neurosciences. 32, 160-169 (2009).</li><li>Seifert, G., Schilling, K., Steinhauser, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocyte+dysfunction+in+neurological+disorders:+a+molecular+perspective.">Astrocyte dysfunction in neurological disorders: a molecular perspective.</a> Nature reviews. Neuroscience. 7, 194-206 (2006).</li><li>Ballabh, P., Braun, A., Nedergaard, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+blood-brain+barrier:+an+overview:+structure,+regulation,+and+clinical+implications.">The blood-brain barrier: an overview: structure, regulation, and clinical implications.</a> Neurobiology of disease. 16, 1-13 (2004).</li><li>Araque, A., Parpura, V., Sanzgiri, R. P., Haydon, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tripartite+synapses:+glia,+the+unacknowledged+partner.">Tripartite synapses: glia, the unacknowledged partner.</a> Trends in neurosciences. 22, 208-215 (1999).</li><li>Anderson, M. A., Ao, Y., Sofroniew, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Heterogeneity+of+reactive+astrocytes.">Heterogeneity of reactive astrocytes.</a> Neuroscience letters. 565, 23-29 (2014).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+Na+/H++exchanger+isoform+1+is+neuroprotective+in+neonatal+hypoxic+ischemic+brain+injury.">Inhibition of Na+/H+ exchanger isoform 1 is neuroprotective in neonatal hypoxic ischemic brain injury.</a> Antioxidants &amp; redox signaling. 14, 1803-1813 (2011).</li><li>Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+brain+injury.">Neonatal brain injury.</a> The New England journal of medicine. 351, 1985-1995 (2004).</li><li>Hill, C. A., Fitch, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sex+differences+in+mechanisms+and+outcome+of+neonatal+hypoxia-ischemia+in+rodent+models:+implications+for+sex-specific+neuroprotection+in+clinical+neonatal+practice.">Sex differences in mechanisms and outcome of neonatal hypoxia-ischemia in rodent models: implications for sex-specific neuroprotection in clinical neonatal practice.</a> Neurol Res Int. , 1-9 (2012).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ERalpha+Signaling+Is+Required+for+TrkB-Mediated+Hippocampal+Neuroprotection+in+Female+Neonatal+Mice+after+Hypoxic+Ischemic+Encephalopathy(1,2,3).">ERalpha Signaling Is Required for TrkB-Mediated Hippocampal Neuroprotection in Female Neonatal Mice after Hypoxic Ischemic Encephalopathy(1,2,3).</a> eNeuro. 3, (2016).</li><li>Uluc, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TrkB+receptor+agonist+7,+8+dihydroxyflavone+triggers+profound+gender-+dependent+neuroprotection+in+mice+after+perinatal+hypoxia+and+ischemia.">TrkB receptor agonist 7, 8 dihydroxyflavone triggers profound gender- dependent neuroprotection in mice after perinatal hypoxia and ischemia.</a> CNS Neurol Disord Drug Targets. 12, 360-370 (2013).</li><li>Cikla, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Suppression+of+microglia+activation+after+hypoxia-ischemia+results+in+age-dependent+improvements+in+neurologic+injury.">Suppression of microglia activation after hypoxia-ischemia results in age-dependent improvements in neurologic injury.</a> J Neuroimmunol. 291, 18-27 (2016).</li><li>McQuillen, P. S., Ferriero, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+vulnerability+in+the+developing+central+nervous+system.">Selective vulnerability in the developing central nervous system.</a> Pediatr Neurol. 30, 227-235 (2004).</li><li>Morken, T. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Altered+astrocyte-neuronal+interactions+after+hypoxia-ischemia+in+the+neonatal+brain+in+female+and+male+rats.">Altered astrocyte-neuronal interactions after hypoxia-ischemia in the neonatal brain in female and male rats.</a> Stroke; a journal of cerebral circulation. 45, 2777-2785 (2014).</li><li>Chisholm, N. C., Sohrabji, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Astrocytic+response+to+cerebral+ischemia+is+influenced+by+sex+differences+and+impaired+by+aging.">Astrocytic response to cerebral ischemia is influenced by sex differences and impaired by aging.</a> Neurobiology of disease. 85, 245-253 (2016).</li><li>Liu, M., Oyarzabal, E. A., Yang, R., Murphy, S. J., Hurn, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+assessing+sex-specific+and+genotype-specific+response+to+injury+in+astrocyte+culture.">A novel method for assessing sex-specific and genotype-specific response to injury in astrocyte culture.</a> Journal of neuroscience methods. 171, 214-217 (2008).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+biological+contributions+to+human+health:+does+sex+matter?.">Exploring the biological contributions to human health: does sex matter?.</a> Journal of women's health &amp; gender-based. 10, 433-439 (2001).</li><li>Collins, F. S., Tabak, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Policy:+NIH+plans+to+enhance+reproducibility.">Policy: NIH plans to enhance reproducibility.</a> Nature. 505, 612-613 (2014).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78, 785-798 (2013).</li><li>Cengiz, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+Na+/H++exchanger+activation+promotes+gliotransmitter+release+from+reactive+hippocampal+astrocytes+following+oxygen-glucose+deprivation.">Sustained Na+/H+ exchanger activation promotes gliotransmitter release from reactive hippocampal astrocytes following oxygen-glucose deprivation.</a> PloS one. 9, e84294 (2014).</li><li>Landis, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+call+for+transparent+reporting+to+optimize+the+predictive+value+of+preclinical+research.">A call for transparent reporting to optimize the predictive value of preclinical research.</a> Nature. 490, 187-191 (2012).</li><li>Hamby, M. E., Uliasz, T. F., Hewett, S. J., Hewett, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+an+improved+procedure+for+the+removal+of+microglia+from+confluent+monolayers+of+primary+astrocytes.">Characterization of an improved procedure for the removal of microglia from confluent monolayers of primary astrocytes.</a> J Neurosci Methods. 150, 128-137 (2006).</li><li>McClive, P. J., Sinclair, A. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+DNA+extraction+and+PCR-sexing+of+mouse+embryos.">Rapid DNA extraction and PCR-sexing of mouse embryos.</a> Molecular reproduction and development. 60, 225-226 (2001).</li><li>Wolterink-Donselaar, I. G., Meerding, J. M., Fernandes, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+gender+determination+in+newborn+dark+pigmented+mice.">A method for gender determination in newborn dark pigmented mice.</a> Lab Anim (NY). 38, 35-38 (2009).</li><li>Uliasz, T. F., Hamby, M. E., Jackman, N. A., Hewett, J. A., Hewett, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+primary+astrocyte+cultures+devoid+of+contaminating+microglia.">Generation of primary astrocyte cultures devoid of contaminating microglia.</a> Methods Mol Biol. 814, 61-79 (2012).</li><li>Raponi, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=S100B+expression+defines+a+state+in+which+GFAP-expressing+cells+lose+their+neural+stem+cell+potential+and+acquire+a+more+mature+developmental+stage.">S100B expression defines a state in which GFAP-expressing cells lose their neural stem cell potential and acquire a more mature developmental stage.</a> Glia. 55, 165-177 (2007).</li><li>Souza, D. G., Bellaver, B., Souza, D. O., Quincozes-Santos, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+adult+rat+astrocyte+cultures.">Characterization of adult rat astrocyte cultures.</a> PloS one. 8, e60282 (2013).</li><li>Puschmann, T. B., Dixon, K. J., Turnley, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Species+differences+in+reactivity+of+mouse+and+rat+astrocytes+in+vitro.">Species differences in reactivity of mouse and rat astrocytes in vitro.</a> Neuro-Signals. 18, 152-163 (2010).</li><li>Schildge, S., Bohrer, C., Beck, K., Schachtrup, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+culture+of+mouse+cortical+astrocytes.">Isolation and culture of mouse cortical astrocytes.</a> Journal of visualized experiments : JoVE. , (2013).</li><li>Saura, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microglial+cells+in+astroglial+cultures:+a+cautionary+note.">Microglial cells in astroglial cultures: a cautionary note.</a> J Neuroinflammation. 4 (26), (2007).</li></ol>

Keiner der Autoren haben im Wettbewerb oder widerstreitenden Interessen.

Um die geschlechtsspezifische Unterschiede in den Eigenschaften und Funktion der Astrozyten unter physiologischen und pathologischen Bedingungen zu untersuchen, die Vorbereitung von sexed primären Astrozyten in der Zellkultur ist ein wichtiges Instrument zu nutzen. In der vorliegenden Studie berichten wir über eine hocheffiziente und ein reproduzierbares Verfahren zur Kultur ein hochangereichertes homogene Population von sexed Hippokampus - Astrozyten von Neugeborenen (P0-P2) C57Bl / 6 (Wildtyp) oder K19F (GFAP null) ...

Astrozyten sind eine der wichtigsten Schlüsselspieler im zentralen Nervensystem (ZNS). Immer deutlicher abzeichnet, zeigt an, dass die Rollen von Astrozyten sind mehr als neuronale Unterstützung. In der Tat können die Rollen der Astrocyten unter physiologischen Bedingungen sehr komplex, wie die Wanderung der Entwicklungs Axone 1 Führung Regulieren CNS Blutfluß 2, um den pH - Homöostase des synaptischen Interstitialflüssigkeit 3 und in der Blut - Hirn - Schranke beteiligt 4 und 5 der synaptischen Übertragung. Unter pathologischen Bedingungen reagieren Astrozyten zu Verletzungen im Zusammenhang mit einem Prozess reaktiven Astrogliose genannt , in dem die Morphologie, Anzahl, Lage, Topographie (in Bezug auf Abstand von Insult) und Funktion der Astrozyten in einer heterogenen Weise 6,7 geändert. Astrogliose folgende neonatalen hypoxischen ischämischen Enzephalopathie gesehen vielleicht auf die Morbidität und Mortalität von Neugeborenen beitragen <sbis&gt; 8. Neuere klinische und experimentelle Studien zeigen, dass die Schwere der Hirnverletzung wird geschlechtsabhängig zu sein und dass die männlichen Neugeborenen anfälliger für die Wirkungen von Hypoxie / Ischämie (HALLO) -bezogene Hirnverletzung, was zu schweren neurologischen Ergebnisse im Vergleich zu Frauen mit vergleichbaren Hirnverletzungen 11.09. Obwohl die Lokalisation der Verletzung auf dem Schwangerschaftsalter und der Dauer und der Schwere der Insult abhängt, ist hippocampus eine der am häufigsten durchgeführt Regionen im ZNS nach der Begriff neonatal HALLO und erhöhte hippocampal Astrogliose durch Hochregulierung von bestätigt die sauren Gliafaserproteins (GFAP) 3 d nach der Neugeborenen HALLO 7,10,12,13. Geschlechtsunterschiede in Astrozytenfunktion wurden in beiden Neugeborenen und erwachsenen Nagetieren nach zerebraler Ischämie 14,15 gezeigt. Zusätzlich wurde männlichen astrozytären Anfälligkeit für in-vitro Ischämie durch erhöhte cel gezeigtenl Tod im Vergleich zu weiblichen kortikalen Astrozyten in Kultur 16. Geschlechtsunterschiede beginnen in-utero und weiter bis zum Tod 17. Im Laufe der letzten zehn Jahre von der Bedeutung , die Geschlechter in der experimentellen Bedingungen in Zellkultur mit und in-vivo - Studien haben die Schwerpunkte des Instituts für Medizin und NIH gewesen grundlegende Kenntnisse in den geschlechtsspezifische Unterschiede in der physiologischen und pathologischen Zuständen gesehen zu suchen 17,18 . Entwicklung zuverlässiger Methoden Populationen von sexed Hippokampus-Astrozyten zu isolieren und zu pflegen ist wichtig, die zellulären Grundlagen der Geschlechtsunterschiede in den pathologischen Folgen der Neugeborenen-HALLO zu verstehen. Die vorliegende Studie wurde entworfen, um die Techniken zu bieten angereichertem geschlechtsspezifische hippokampale Astrozytenkulturen von neugeborenen Mäusen vorzubereiten, um die Rollen von GFAP-immunoreaktive Astrozyten zu bewerten folgenden Sauerstoff / Glukose-Deprivation (OGD) und Reoxygenierung (Reox), induzierenHALLO in Zellkulturumgebung. Diese Technik kann verwendet werden, um eine Hypothese zu testen, in Bezug auf Hippokampus-Astrocyten in neonatal Männchen und Weibchen unter normoxischen und ischämischen Zuständen.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Astrocyte culture media</td>
		</tr>
		<tr>
			<td>DMEM, high glucose</td>
			<td>cellgro</td>
			<td>10-013-CV</td>
			<td></td>
		</tr>
		<tr>
			<td>Horse serum</td>
			<td>Gibco</td>
			<td>26050-070</td>
			<td>Final Concentration: 10%</td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin</td>
			<td>Cellgro&#160;</td>
			<td>30-002-CI</td>
			<td>Final Concentration: 1%</td>
		</tr>
		<tr>
			<td rowspan="2">L-Leucine methyl ester hydrochloride</td>
			<td rowspan="2">Aldrich</td>
			<td rowspan="2">L1002-25G</td>
			<td rowspan="2">Final Concentration: 5 mM</td>
		</tr>
		<tr>
		</tr>
		<tr>
			<td colspan="4">Solution for brain tissue digestion</td>
		</tr>
		<tr>
			<td>HBSS</td>
			<td>Life Technologies</td>
			<td>14170-088</td>
			<td></td>
		</tr>
		<tr>
			<td>0.25% Trypsin</td>
			<td>cellgro</td>
			<td>25-050-CI</td>
			<td>Final Concentration: 0.25%</td>
		</tr>
		<tr>
			<td colspan="4">Other</td>
		</tr>
		<tr>
			<td>70% (vol/vol) ethanol</td>
			<td>Roth</td>
			<td>9065.2</td>
			<td></td>
		</tr>
		<tr>
			<td>Poly-D-Lysine 12mm round coverslips&#160;</td>
			<td>Corning</td>
			<td>354087</td>
			<td></td>
		</tr>
		<tr>
			<td>Water</td>
			<td>Sigma</td>
			<td>W3500</td>
			<td>cell culture grade</td>
		</tr>
		<tr>
			<td>PBS</td>
			<td>cellgro</td>
			<td>21-040-CV</td>
			<td>cell culture grade</td>
		</tr>
		<tr>
			<td>0.05% Trypsin-EDTA&#160;</td>
			<td>Life Technologies</td>
			<td>25300-062</td>
			<td></td>
		</tr>
		<tr>
			<td>70 &#956;m Sterile cell strainer&#160;</td>
			<td>Fisher scientific</td>
			<td>22363548</td>
			<td></td>
		</tr>
		<tr>
			<td>3.5 cm petri dish</td>
			<td>BD Falcon</td>
			<td>353001</td>
			<td></td>
		</tr>
		<tr>
			<td>15 ml Falcon tube</td>
			<td>BD Falcon</td>
			<td>352096</td>
			<td></td>
		</tr>
		<tr>
			<td>50 ml Falcon tube</td>
			<td>BD Falcon</td>
			<td>352070</td>
			<td></td>
		</tr>
		<tr>
			<td>Forceps, fine&#160;</td>
			<td>Dumont</td>
			<td>2-1032; 2-1033</td>
			<td># 3c; # 5</td>
		</tr>
		<tr>
			<td>Forceps, flat tip</td>
			<td>KLS Martin</td>
			<td>12-120-11</td>
			<td></td>
		</tr>
		<tr>
			<td>13 cm surgical scissors</td>
			<td>Aesculap</td>
			<td>BC-140-R</td>
			<td></td>
		</tr>
		<tr>
			<td>Confocal Microscope</td>
			<td>Nikon</td>
			<td>A1RSi&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td>5805000.017</td>
			<td>Centrifuge5804R</td>
		</tr>
		<tr>
			<td>Orbital Shaker</td>
			<td>Thermo Scientific</td>
			<td>SHKE 4450-1CE</td>
			<td>MaxQ 4450&#160;</td>
		</tr>
		<tr>
			<td>Anti-IBA1</td>
			<td>Wako</td>
			<td>019-19741</td>
			<td>Rabbit monoclonal</td>
		</tr>
		<tr>
			<td>Anti-MAP2</td>
			<td>Sigma</td>
			<td>M2320</td>
			<td>Mouse monoclonal</td>
		</tr>
		<tr>
			<td>Anti-HIF1alpha</td>
			<td>abcam</td>
			<td>ab179483</td>
			<td>rabbit monoclonal</td>
		</tr>
		<tr>
			<td>Anti-S100B</td>
			<td>Sigma</td>
			<td>HPA015768</td>
			<td>Rabbit polyclonal</td>
		</tr>
		<tr>
			<td>Anti-GFAP (cocktail)</td>
			<td>Biolegend</td>
			<td>837602</td>
			<td></td>
		</tr>
		<tr>
			<td>VECTASTAIN Elite ABC Kit (Rabbit IgG)</td>
			<td>Vector Labs</td>
			<td>PK-6101</td>
			<td>Contains 4 Reagents&#160;</td>
		</tr>
		<tr>
			<td>Goat Anti Rabbit Alexa-Fluor 488</td>
			<td>Invitrogen</td>
			<td>A11070</td>
			<td></td>
		</tr>
		<tr>
			<td>Goat Anti Mouse Alexa-Fluor 568</td>
			<td>Invitrogen</td>
			<td>A11004</td>
			<td></td>
		</tr>
	</tbody>
</table>

sex differences in mouse hippocampal astrocytes after in-vitro ischemia

Astrogliose nach Hypoxie / Ischämie (HALLO) -related Hirnverletzung spielt eine Rolle bei einer erhöhten Morbidität und Mortalität bei Neugeborenen. Neuere klinische Studien zeigen , dass die Schwere der Hirnverletzung erscheinen Geschlecht abhängig zu sein, und dass die männlichen Neugeborenen sind anfälliger für die Auswirkungen von HALLO bezogenen Hirnverletzung, was zu mehr schweren neurologischen Ergebnisse als zu Frauen mit vergleichbaren Hirnverletzungen verglichen. Die Entwicklung zuverlässiger Methoden zur Isolierung und hochangereichertes Populationen von sexed Hippokampus-Astrozyten halten ist wichtig, die zellulären Grundlagen der Geschlechtsunterschiede in den pathologischen Folgen der Neugeborenen-HALLO zu verstehen. In dieser Studie beschreiben wir ein Verfahren zur geschlechtsspezifischen hippocampal Astrozytenkulturen schaffen , die in vitro zu einem Modell der Ischämie unterzogen werden, Sauerstoff-glucose deprivation, gefolgt von Reoxygenierung. Nachfolgende reaktive Astrogliose wurde von immunostai geprüftning für den sauren Gliafaserproteins (GFAP) und S100B. Dieses Verfahren stellt ein nützliches Werkzeug, um die Rolle der männlichen und weiblichen hippocampalen Astrozyten folgenden neonatal HALLO, separat zu untersuchen.

Verständnis haben die Rollen von sexed Astrozyten Funktionen unter physiologischen oder pathophysiologischen Bedingungen wurden durch die Kultivierung dieser Zellen unter in vitro Bedingungen immens aufgeklärt. Der wichtige Aspekt gesextem Züchten der Durchführung ist das Geschlecht der Maus Welpen vor seiner Verwendung zu bestimmen. Wir stellten fest , das Geschlecht der Maus genetisch durch PCR und durch visuelle Beurteilung (Abbildung 2) 16. Di...

Watch this Scientific Journal Video about Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia at JoVE.com

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Astrozyten sind eine der wichtigsten Schlüsselspieler im zentralen Nervensystem (ZNS). Hier berichten wir eine praktische Methode der sexed Hippokampus - Astrozyten Kulturprotokoll , um die zugrunde liegenden Mechanismen der Astrozytenfunktion bei männlichen und weiblichen Neugeborenen Welpen nach In-vitro - Ischämie zu untersuchen.

Geschlechtsunterschiede in Mäuse Hippocampus Astrozyten nach<em&gt; In-Vitro</em&gt; Ischemia

Astrogliosis following hypoxia/ischemia (HI)-related brain injury plays a role in increased morbidity and mortality in neonates. Recent clinical studies ...

sex-differences-mouse-hippocampal-astrocytes-after-vitro

Research

JoVE Journal

Neuroscience

Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

13.3K Aufrufe.  University of Wisconsin.  Astrozyten sind eine der wichtigsten Schlüsselspieler im zentralen Nervensystem (ZNS). Hier berichten wir eine praktische Methode der sexed Hippokampus - Astrozyten Kulturprotokoll , um die zugrunde liegenden Mechanismen der Astrozytenfunktion bei männlichen und weiblichen Neugeborenen Welpen nach In-vitro - Ischämie zu untersuchen. 

Serie: Sex Differences in Mouse Hippocampal Astrocytes after In-Vitro Ischemia

Fluorescence Recovery After Photobleaching (FRAP) of Fluorescence Tagged Proteins in Dendritic Spines of Cultured Hippocampal Neurons

FRAP has been used to quantify the mobility of GFP-tagged proteins. Using a strong excitation laser, the fluorescence of a GFP-tagged protein is bleached in the region of interest. The fluorescence of the region recovers when the unbleached GFP-tagged protein from outside of the region diffuses into the region of interest. The mobility of the protein is then analyzed by measuring the fluorescence recovery rate. This technique could be used to characterize protein mobility and turnover rate.
In this study, we express the (enhanced green fluorescent protein) EGFP vector in cultured hippocampal neurons. Using the Zeiss 710 confocal microscope, we photobleach the fluorescence signal of the GFP protein in a single spine, and then take time lapse images to record the fluorescence recovery after photobleaching. Finally, we estimate the percentage of mobile and immobile fractions of the GFP in spines, by analyzing the imaging data using ImageJ and Graphpad softwares.
This FRAP protocol shows how to perform a basic FRAP experiment as well as how to analyze the data.

Fluorescence Recovery After Photobleaching FRAP of Fluorescence Tagged Proteins in Dendritic Spines of Cultured Hippocampal Neurons

FRAP has been used to quantify the mobility of Green Fluorescence Protein (GFP)-tagged proteins in cultured cells. We examined the mobile/immobile fractions of the GFP by analyzing the fluorescence recovery percentage after photobleaching. In this study, FRAP was performed at spines of hippocampal neurons.

Fluorescence Recovery After Photobleaching (FRAP) der Fluoreszenz-markierten Proteine ​​in dendritischen Dornen von hippokampalen Neuronen

FRAP has been used to quantify the mobility of GFP-tagged proteins. Using a strong excitation laser, the fluorescence of a GFP-tagged protein is bleached ...

Forschung

Neurowissenschaften

Dual Electrophysiological Recordings of Synaptically-evoked Astroglial and Neuronal Responses in Acute Hippocampal Slices

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs through activation of their ion channels and neurotransmitter receptors, and process information in part through activity-dependent release of gliotransmitters. Furthermore, astrocytes constitute the main uptake system for glutamate, contribute to potassium spatial buffering, as well as to GABA clearance. These cells therefore constantly monitor synaptic activity, and are thereby sensitive indicators for alterations in synaptically-released glutamate, GABA and extracellular potassium levels. Additionally, alterations in astroglial uptake activity or buffering capacity can have severe effects on neuronal functions, and might be overlooked when characterizing physiopathological situations or knockout mice. Dual recording of neuronal and astroglial activities is therefore an important method to study alterations in synaptic strength associated to concomitant changes in astroglial uptake and buffering capacities. Here we describe how to prepare hippocampal slices, how to identify stratum radiatum astrocytes, and how to record simultaneously neuronal and astroglial electrophysiological responses. Furthermore, we describe how to isolate pharmacologically the synaptically-evoked astroglial currents.

The preparation of acute brain slices from isolated hippocampi, as well as the simultaneous electrophysiological recordings of astrocytes and neurons in stratum radiatum during stimulation of schaffer collaterals is described. The pharmacological isolation of astroglial potassium and glutamate transporter currents is demonstrated.

Dual-Elektrophysiologische Recordings synaptisch-evozierte astrogliale und neuronale Antworten in Acute Hippocampusschnitte

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs ...

Isolation and Culture of Mouse Cortical Astrocytes

Astrocytes are an abundant cell type in the mammalian brain, yet much remains to be learned about their molecular and functional characteristics. In vitro astrocyte cell culture systems can be used to study the biological functions of these glial cells in detail. This video protocol shows how to obtain pure astrocytes by isolation and culture of mixed cortical cells of mouse pups. The method is based on the absence of viable neurons and the separation of astrocytes, oligodendrocytes and microglia, the three main glial cell populations of the central nervous system, in culture. Representative images during the first days of culture demonstrate the presence of a mixed cell population and indicate the timepoint, when astrocytes become confluent and should be separated from microglia and oligodendrocytes. Moreover, we demonstrate purity and astrocytic morphology of cultured astrocytes using immunocytochemical stainings for well established and newly described astrocyte markers. This culture system can be easily used to obtain pure mouse astrocytes and astrocyte-conditioned medium for studying various aspects of astrocyte biology.

Astrocytes have been recognized to be versatile cells participating in fundamental biological processes that are essential for normal brain development and function, and central nervous system repair. Here we present a rapid procedure to obtain pure mouse astrocyte cultures to study the biology of this major class of central nervous system cells.

Isolation und Kultur von Maus Kortikale Astrozyten

Astrocytes  are an abundant cell type in the mammalian brain, yet much remains to be  learned about their molecular and functional characteristics. In ...

Sex Stratified Neuronal Cultures to Study Ischemic Cell Death Pathways

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms responsible for those differences remain unclear. Primary disassociated embryonic neuronal culture provides a simplified experimental model with which to investigate the neuronal cell signaling involved in cell death as a result of ischemia or disease; however, most neuronal cultures used in research today are mixed sex. Researchers can and do test the effects of sex steroid treatment in mixed sex neuronal cultures in models of neuronal injury and disease, but accumulating evidence suggests that the female brain responds to androgens, estrogens, and progesterone differently than the male brain. Furthermore, neonate male and female rodents respond differently to ischemic injury, with males experiencing greater injury following cerebral ischemia than females. Thus, mixed sex neuronal cultures might obscure and confound the experimental results; important information might be missed. For this reason, the Herson Lab at the University of Colorado School of Medicine routinely prepares sex-stratified primary disassociated embryonic neuronal cultures from both hippocampus and cortex. Embryos are sexed before harvesting of brain tissue and male and female tissue are disassociated separately, plated separately, and maintained separately. Using this method, the Herson Lab has demonstrated a male-specific role for the ion channel TRPM2 in ischemic cell death. In this manuscript, we share and discuss our protocol for sexing embryonic mice and preparing sex-stratified hippocampal primary disassociated neuron cultures. This method can be adapted to prepare sex-stratified cortical cultures and the method for embryo sexing can be used in conjunction with other protocols for any study in which sex is thought to be an important determinant of outcome.

Primary disassociated embryonic hippocampal neuronal cultures are useful for investigating the signaling mechanisms involved in neuron death. Sexing the embryos before the isolation and dissociation of the hippocampus allows the preparation of separate male and female cultures, which enables the researcher to identify and investigate sex-specific cell signaling.

Sex differences in neuronal susceptibility to ischemic injury and neurodegenerative disease have long been observed, but the signaling mechanisms ...

Modeling Astrocytoma Pathogenesis In Vitro and In Vivo Using Cortical Astrocytes or Neural Stem Cells from Conditional, Genetically Engineered Mice

Current astrocytoma models are limited in their ability to define the roles of oncogenic mutations in specific brain cell types during disease pathogenesis and their utility for preclinical drug development. In order to design a better model system for these applications, phenotypically wild-type cortical astrocytes and neural stem cells (NSC) from conditional, genetically engineered mice (GEM) that harbor various combinations of floxed oncogenic alleles were harvested and grown in culture. Genetic recombination was induced in vitro using adenoviral Cre-mediated recombination, resulting in expression of mutated oncogenes and deletion of tumor suppressor genes. The phenotypic consequences of these mutations were defined by measuring proliferation, transformation, and drug response in vitro. Orthotopic allograft models, whereby transformed cells are stereotactically injected into the brains of immune-competent, syngeneic littermates, were developed to define the role of oncogenic mutations and cell type on tumorigenesis in vivo. Unlike most established human glioblastoma cell line xenografts, injection of transformed GEM-derived cortical astrocytes into the brains of immune-competent littermates produced astrocytomas, including the most aggressive subtype, glioblastoma, that recapitulated the histopathological hallmarks of human astrocytomas, including diffuse invasion of normal brain parenchyma. Bioluminescence imaging of orthotopic allografts from transformed astrocytes engineered to express luciferase was utilized to monitor in vivo tumor growth over time. Thus, astrocytoma models using astrocytes and NSC harvested from GEM with conditional oncogenic alleles provide an integrated system to study the genetics and cell biology of astrocytoma pathogenesis in vitro and in vivo and may be useful in preclinical drug development for these devastating diseases.

Modeling Astrocytoma Pathogenesis In Vitro and In Vivo Using Cortical Astrocytes or Neural Stem Cells from Conditional, Genetically Engineered Mice

Phenotypically wild-type astrocytes and neural stem cells harvested from mice engineered with floxed, conditional oncogenic alleles and transformed via viral Cre-mediated recombination can be used to model astrocytoma pathogenesis in vitro and in vivo by orthotopic injection of transformed cells into brains of syngeneic, immune-competent littermates.

Modellierung Astrozytom Pathogenese<em&gt; In-vitro-</em&gt; Und<em&gt; In Vivo</em&gt; Verwenden kortikale Astrozyten oder neuralen Stammzellen aus dem Bedingten, gentechnisch veränderte Mäuse

Current astrocytoma models are limited in their ability to define the roles of oncogenic mutations in specific brain cell types during disease ...

Immunohistochemical Visualization of Hippocampal Neuron Activity After Spatial Learning in a Mouse Model of Neurodevelopmental Disorders

Induction of phosphorylated extracellular-regulated kinase (pERK) is a reliable molecular readout of learning-dependent neuronal activation. Here, we describe a pERK immunohistochemistry protocol to study the profile of hippocampal neuron activation following exposure to a spatial learning task in a mouse model characterized by cognitive deficits of neurodevelopmental origin. Specifically, we used pERK immunostaining to study neuronal activation following Morris water maze (MWM, a classical hippocampal-dependent learning task) in Engrailed-2 knockout (En2-/-) mice, a model of autism spectrum disorders (ASD). As compared to wild-type (WT) controls, En2-/- mice showed significant spatial learning deficits in the MWM. After MWM, significant differences in the number of pERK-positive neurons were detected in specific hippocampal subfields of En2-/- mice, as compared to WT animals. Thus, our protocol can robustly detect differences in pERK-positive neurons associated to hippocampal-dependent learning impairment in a mouse model of ASD. More generally, our protocol can be applied to investigate the profile of hippocampal neuron activation in both genetic or pharmacological mouse models characterized by cognitive deficits.

We describe an immunohistochemistry protocol to study the profile of hippocampal neuron activation following exposure to a spatial learning task in a mouse model characterized by cognitive deficits of neurodevelopmental origin. This protocol can be applied to both genetic or pharmacological mouse models characterized by cognitive deficits.

Immunhistochemische Visualisierung von Hippocampus-Aktivität nach Spatial Learning in einem Mausmodell für neurologische Entwicklungsstörungen

Induction of phosphorylated extracellular-regulated kinase (pERK) is a reliable molecular readout of learning-dependent neuronal activation. Here, we ...

Protocol for Three-dimensional Confocal Morphometric Analysis of Astrocytes

As glial cells in the brain, astrocytes have diverse functional roles in the central nervous system. In the presence of harmful stimuli, astrocytes modify their functional and structural properties, a condition called reactive astrogliosis. Here, a protocol for assessment of the morphological properties of astrocytes is presented. This protocol includes quantification of 12 different parameters i.e. the surface area and volume of the tissue covered by an astrocyte (astrocyte territory), the entire astrocyte including branches, cell body, and nucleus, as well as total length and number of branches, the intensity of fluorescence immunoreactivity of antibodies used for astrocyte detection, and astrocyte density (number/1,000 &#181;m2). For this purpose three-dimensional (3D) confocal microscopic images were created, and 3D image analysis software such as Volocity 6.3 was used for measurements. Rat brain tissue exposed to amyloid beta1-40 (A&#946;1-40) with or without a therapeutic&#160;intervention was used to present the method. This protocol can also be used for 3D morphometric analysis of other cells from either in vivo or in vitro conditions.

Astrocytes in the CNS change their functional and structural properties in response to harmful stimuli. This report presents a protocol for assessment of three-dimensional astrocyte morphology in diseased conditions or after therapeutic interventions.

Protokoll zur dreidimensionalen konfokalen morphometrische Analyse der Astrozyten

As glial cells in the brain, astrocytes have diverse functional roles in the central nervous system. In the presence of harmful stimuli, astrocytes modify ...

Tuning in the Hippocampal Theta Band In Vitro: Methodologies for Recording from the Isolated Rodent Septohippocampal Circuit

This protocol outlines the procedures for preparing and recording from the isolated whole hippocampus, of WT and transgenic mice, along with recent improvements in methodologies and applications for the study of theta oscillations. A simple characterization of the isolated hippocampal preparation is presented whereby the relationship between internal hippocampal theta oscillators is examined together with the activity of pyramidal cells, and GABAergic interneurons, of the cornu ammonis-1 (CA1) and subiculum (SUB) areas. Overall, we show that the isolated hippocampus is capable of generating intrinsic theta oscillations in vitro and that rhythmicity generated within the hippocampus can be precisely manipulated by optogenetic stimulation of parvalbumin-positive (PV) interneurons. The in vitro isolated hippocampal preparation offers a unique opportunity to use simultaneous field and intracellular patch-clamp recordings from visually-identified neurons to better understand the mechanisms underlying theta rhythm generation.

Tuning in the Hippocampal Theta Band In Vitro: Methodologies for Recording from the Isolated Rodent Septohippocampal Circuit

Here, we present a protocol for recording rhythmic neuronal network theta and gamma oscillations from an isolated whole hippocampal preparation. We describe the experimental steps from extraction of the hippocampus to details of field, unitary and whole-cell patch clamp recordings as well as optogenetic pacing of the theta rhythm.

Tuning in der Hippocampal Theta Band<em&gt; In vitro</em&gt;: Methoden für die Aufnahme aus dem isolierten Nagetier Septohippocampal Circuit

This protocol outlines the procedures for preparing and recording from the isolated whole hippocampus, of WT and transgenic mice, along with recent ...

In Utero Electroporation of Multiaddressable Genome-Integrating Color (MAGIC) Markers to Individualize Cortical Mouse Astrocytes

Protoplasmic astrocytes (PrA) located in the mouse cerebral cortex are tightly juxtaposed, forming an apparently continuous three-dimensional matrix at adult stages. Thus far, no immunostaining strategy can single them out and segment their morphology in mature animals and over the course of corticogenesis. Cortical PrA originate from progenitors located in the dorsal pallium and can easily be targeted using in utero electroporation of integrative vectors. A protocol is presented here to label these cells with the multiaddressable genome-integrating color (MAGIC) Markers strategy, which relies on piggyBac/Tol2 transposition and Cre/lox recombination to stochastically express distinct fluorescent proteins (blue, cyan, yellow, and red) addressed to specific subcellular compartments. This multicolor fate mapping strategy enables to mark in situ nearby cortical progenitors with combinations of color markers prior to the start of gliogenesis and to track their descendants, including astrocytes, from embryonic to adult stages at the individual cell level. Semi-sparse labeling achieved by adjusting the concentration of electroporated vectors and color contrasts provided by the Multiaddressable Genome-Integrating Color Markers (MAGIC Markers or MM) enable to individualize astrocytes and single out their territory and complex morphology despite their dense anatomical arrangement. Presented here is a comprehensive experimental workflow including the details of the electroporation procedure, multichannel image stacks acquisition by confocal microscopy, and computer-assisted three-dimensional segmentation that will enable the experimenter to assess individual PrA volume and morphology. In summary, electroporation of MAGIC Markers provides a convenient method to individually label numerous astrocytes and gain access to their anatomical features at different developmental stages. This technique will be useful to analyze cortical astrocyte morphological properties in various mouse models without resorting to complex crosses with transgenic reporter lines.

In Utero Electroporation of Multiaddressable Genome-Integrating Color MAGIC Markers to Individualize Cortical Mouse Astrocytes

Astrocytes tile the cerebral cortex uniformly, making the analysis of their complex morphology challenging at the cellular level. The protocol provided here uses multicolor labeling based on in utero electroporation to single out cortical astrocytes and analyze their volume and morphology with a user-friendly image analysis pipeline.

In Utero Elektroporation von Multiadressierbaren Genom-integrierenden Farbe (MAGIC) Marker zur Individualisierung kortikaler Maus-Astrozyten

Protoplasmic astrocytes (PrA) located in the mouse cerebral cortex are tightly juxtaposed, forming an apparently continuous three-dimensional matrix at ...

Neuronal Differentiation from Mouse Embryonic Stem Cells In vitro

The neural differentiation of mouse embryonic stem cells (mESCs) is a potential tool for elucidating the key mechanisms involved in neurogenesis and potentially aid in regenerative medicine. Here, we established an efficient and low cost method for neuronal differentiation from mESCs in vitro, using the strategy of combinatorial screening. Under the conditions defined here, the 2-day embryoid body formation + 6-day retinoic acid induction protocol permits fast and efficient differentiation from mESCs into neural precursor cells (NPCs), as seen by the formation of well-stacked and neurite-like A2lox and 129 derivatives that are Nestin positive. The healthy state of embryoid bodies and the timepoint at which retinoic acid (RA) is applied, as well as the RA concentrations, are critical in the process. In the subsequent differentiation from NPCs into neurons, N2B27 medium II (supplemented by Neurobasal medium) could better support the long term maintenance and maturation of neuronal cells. The presented method is highly efficiency, low cost and easy to operate, and can be a powerful tool for neurobiology and developmental biology research.

Here, we established a low cost and easy to operate method that directs fast and efficient differentiation from embryonic stem cells into neurons. This method is suitable for popularization among laboratories and can be a useful tool for neurological research.

Neuronale Differenzierung von Maus embryonalen Stammzellen In vitro

The neural differentiation of mouse embryonic stem cells (mESCs) is a potential tool for elucidating the key mechanisms involved in neurogenesis and ...