Bu çalışma Meksika Bilim ve Teknoloji Konseyi (Conacyt, 207268 ve 233395 Michael Schnoor kadar) hibe tarafından desteklenmiştir. KFCO yüksek lisans derecesi elde etmek için bir Conacyt stipend (396260) bir alıcı.

Tüm hayvan deneyleri Cinvestav Kurumsal Hayvan Bakım ve Kullanım Kurulu tarafından onaylanmıştır. 1. DSS İçme Suyu Hazırlanması ve Kolit indüksiyonu <ol><li> otoklavlanmış içme suyu içinde% 3.5 a / h dekstran sülfat sodyum (DSS) çözeltisi hazırlayın. DSS kolayca çözünür ve nihai çözelti filtre etmek için gerekli değildir. Not: DSS tedavisi 7 gün ciddi kolit oluştu. Hafif kolit uyarılması için, 3 - Tedavi 4 gün tavsiye edilir. Sürece DSS içme suyu berrak kalır gibi, suyu değiştirmek için gerekli değildir. o bulanık dönerse Ancak, değiştirilmesi gerekir. </li><li> erkek farelerde bazal ağırlığı kaydedin. 12 hafta yaş ve 21 aralığında - - 25 gr vücut ağırlığı onlar 8 olduğundan emin olun. NOT: Uygun DSS konsantrasyonu her laboratuvarda optimize edilmelidir. Sonuçlar büyük ölçüde konut koşullarına bağlı olarak değişebilir. 2,5 ila Konsantrasyonları -% 5 genellikle güçlü c uyardığı bildirilmektedirC57BL / 6J WT farelerinde 10 olitis. sonuçları da DSS farklı kaynaklardan değişebilir gibi farklı şirketler ve farklı sürü DSS, test edilmelidir. </li><li> Su ad libitum sağlamak ve gerekirse taze% 3.5 DSS su ile değiştirin. </li></ol> Sonda ile beslenme takviyeleri 2. Uygulama <ol><li> uygun bir çözücü içinde, istenen besin takviyeleri bir &quot;boşluğundan dışarı çekilebilir&quot; çözelti hazırlayın. Bu çalışma için, 200 mg / kg L-arginin, 83 mg / kg vitamin C, 46 mg / kg E vitamini, 77 mg / kg, eikosapentaenoik asit (EPA), ve 115 mg / kg dokosaheksaenoik asit ihtiva eden bir karışım (DHA kullanılan a), 1: su ve aspur yağı 1 çözeltisi. </li><li> Bir sonda iğnesine bağlanır 1 ml şırınga doldurun besin takviyesi karışımı ile (15 g 50 mm x). iğne dışında herhangi bir bileşiği kaldırmak için ve uygun doz uygulanmasını sağlamak için gavaj iğnesi dışında silin. </li><li> kuyruk tabanı ile tutarak fare kısıtlamaktadırBir yandan diğer elinizle baş ve işaret parmağı ile boyun arkasındaki bir cilt kat kavrayarak. üçüncü parmak ve boyun tutan aynı elin başparmak tabanı arasındaki kuyruk yerleştirin. </li><li> dik bir pozisyonda fare korurken, hayvanın ağzının sol tarafında içine iğne takın ve dikkatlice yemek borusu bulmak için ağız çatı izleyin. Hiçbir direnç ise, mide doğru iğne ilerlemek. NOT: Hayvan geçmeden önce düzgün nefes emin olun. </li><li> Yavaş karışımı yönetmek yavaş yavaş şırınga çekerek tüp kaldırmak ve fareyi bırakın. kolit deney sırasında sonda ile günde bir kez beslenme takviyeleri uygulanır. </li></ol> Hastalık Aktivite İndeksi 3. Belirlenmesi NOT: hastalık aktivite indeksi ob olan kilo kaybı, perianal kanama ve dışkı kıvamı için puanları kombinasyonuGünlük 13 tained. <ol><li> günlük vücut ağırlığı ölçün ve kilo kaybı yüzdesine göre 0 ile 4 arasında bir puan atamak (0: 0%, 1: 1 -% 5, 2: 5 - 10%, 3: 10 -% 20, ve 4:&gt; 20 %). Not: Vücut ağırlığı kaybı DSS-kolit ve gerçek ağırlık öncesi taban ağırlığı arasındaki yüzde farkı hesaplayarak belirlenir. </li><li> Perianal kanama seviyesini belirlemek için, taze dışkı örneği toplamak ve bir guaiac dışkıda gizli kan testi kiti bir slayt üzerinde ince yayma uygulamak için sağlanan aplikatör kullanın. Her bir örnek için yeni bir uygulama aleti kullanmak. <ol><li> önündeki kapağını kapatın ve slayt arkasındaki penceresini açın. Örnek yerde arkasına geliştirici çözüm iki damla uygulayın. </li><li> 30 saniye sonra sonuç okuyun. Mavi rengin herhangi iz gizli kan için olumludur. Pozitif guaiac dışkıda gizli kan testi (sinyal gücü bağlı olarak), ve 3 - 4: - 2.5 hiçbiri, 0.5: 0 ila 4 (0 puan atama gross kanama). NOT: Dışkıda kan görülüyorsa, guaiac dışkıda gizli kan testi yapılması gerekir, ve 3 bir puan, 3.5 veya 4 görünür kan miktarına bağlı olarak atanır değildir. </li></ol></li><li> taze dışkı örneği gözlemleyerek dışkı kıvamını belirleyin. (Ishal 0: Normal / katı, 0.5 -: - 2,5 4 hamurumsu dışkı, ve 3) 4 0 puan atayın. </li></ol> Evans Blue Tahlili tarafından In Vivo Bağırsak epitel geçirgenliği Belirlenmesi 4. <ol><li> tuzlu su çözeltisi (% 0.9 NaCl) içinde seyreltilmiş bir ketamin karışımı (vücut ağırlığı 100 mg / kg) ve ksilazin (13 mg / kg vücut ağırlığı) ile karın içinden enjekte edilerek hayvanların anestezisi ve tutam izleyerek anestezi derinliğinin değerlendirmek geri çekilme refleksi. </li><li> Bir yatar pozisyonda anestezi hayvanların koyun ve bağırsakları ortaya çıkarmak için bir laparotomi gerçekleştirin. </li><li> Çekum bulun ve kolon a proksimal bölümünde küçük bir kesi yapmakscendens (çekum ideal olarak, hemen bitişik). </li><li> Bir besleme iğne (G22) takın ve ortak bir ipek iplik kullanarak bir ligature ile sabitleyin. Dikkatle tüp aracılığıyla bol PBS gömme kolon tüm dışkı dışarı durulayın. o anüs ulaşana kadar kolon içine Evans mavisi çözeltisi (w% 1.5 / PBS v) aşılamak. </li><li> 15 dakika boyunca, Evans mavisini inkübe edin. Perianal yıkama netleşene kadar bol PBS ile tüp temizlenerek boya yıkayın. </li><li> servikal dislokasyon ile hayvan Euthanize. </li><li> kolon tüketim ve bol PBS ile tekrar yıkayın. Kolon mukus yapışmasını bir boya ortadan kaldırmak için PBS içinde 6 mM N -acetylcysteine 1 mL bir kez yıkayın. </li><li> Uzunlamasına kolon kesin ve PBS ve 6 mM N -acetylcysteine 1 mL kez daha durulayın. </li><li> ağırlık ve uzunluk kaydedin. Yumuşak agitatio oda sıcaklığında gece boyunca, N, 2 mL N-dimetilformamid kolon yerleştirmek, Evans mavisi boya elde etmek içinn. 610 nm&#39;de spektrofotometrik boya konsantrasyonu ölçün. </li></ol> 5. Doku Toplama <ol><li> tuzlu su çözeltisi (% 0.9 NaCl) içinde seyreltilmiş bir ketamin karışımı (vücut ağırlığı 100 mg / kg) ve ksilazin (13 mg / kg vücut ağırlığı) ile karın içinden enjekte edilerek hayvanların anestezisi ve tutam izleyerek anestezi derinliğinin değerlendirmek geri çekilme refleksi. </li><li> servikal dislokasyon ile hayvan Euthanize. </li><li> Bir yatar pozisyonda hayvanları yerleştirin ve karın boşluğuna maruz laparotomi gerçekleştirin. </li><li> makas kullanarak, tüm kolon incelemek ve uzunluğunu kaydedin. </li><li> dışkı çıkarmak için soğutulmuş PBS Colon dikkatle birkaç kez yıkayın. Doku ağırlığı kaydedin ve adımları 5.6 de tarif edildiği gibi, aşağıdaki deneyler için hazırlamak - 5.8. </li><li> RNA izolasyonu ve miyeloperoksidaz (MPO) deneyleri için (100 mg, genellikle yeterlidir), bir tüp içine yerleştirin ve SNA bir uygun boyutlu bir doku örneği kesilmişsıvı azot içinde p-dondurmak. ileride kullanmak için -80 ° C &#39;de dokuları saklayın. </li><li> immünofloresan boyama ve oksidatif stres belirlenmesi (aşağıya bakınız), bir küçük kolon örneği kesmek (0,5-1 cm) ve optimal kesme ısısı (OCT) bileşiği ile dolu küçük alüminyum kaplar içinde daldırılması. kuru buz üzerinde bardak yerleştirin ve onları kabarcık oluşumunu önlemek için, yavaş yavaş donmasına izin. Dondurulmuş doku örnekleri ileride kullanılmak üzere -80 ° C&#39;de muhafaza edilebilir. </li><li> İsviçre 14 rulo için uzunlamasına kolon açın ve dikkatlice forseps kullanarak dışkı çıkarmak. mukoza ince uçlu forseps veya ince, yuvarlak tahta sopa kullanarak, içe dönük ile, o kadar yuvarlayın. Dikkatle gömme kaset içine yerleştirin ve adım 6.1 ile devam edin. NOT: DSS kolonda hasar neden olur. Ancak, hasar dağılımı genellikle distal kolon ve rektumda görülen en zararla, distal kolon proksimal değişir. Böylece, uzak col ya histoloji analiz tavsiyeya da bütün kalın bağırsağın İsviçre rolleri. </li></ol> Hematoksilen-eozin boyanması ile Colon Histoloji 6. Analizi <ol><li> Doku hazırlanması <ol><li> histolojik analiz için, uygun bir sabitleme elde etmek için, oda sıcaklığında (RT) 48 saat boyunca% 10 formaldehid 5 mL İsviçre rulo ya da kontrol belirli kolon bölgeleri küçük doku parçaları ve tedavi edilen fareler, ya daldırın. NOT: Aksi belirtilmedikçe aşama 6&#39;da ilave bütün adımları, oda sıcaklığında gerçekleştirilmektedir. </li><li> 18 saat musluk suyu ile yıkayın. </li><li> 1 saat boyunca 1 saat, 1 saat için% 96 ve mutlak etanol,% 70 etanol, 15 mL ile kurutmak. Bir sonraki konsantrasyona geçmeden önce taze alkol ile her adımı yineleyin. </li><li> mutlak etanol, 7.5 mL ve 1 saat boyunca mutlak ksilen 7.5 mL karışımında dehidratasyon devam edin. 1 saat boyunca saf ksilen 15 mL numune geçirmeden önce bir kez tekrarlayın. Taze ksilen kez bu adımı yineleyin. </li></ol&gt; </li><li> Parafin Colon Doku Örnekleri gömülmesi <ol><li> 17 saat sıvı parafin, 50 mL numune bırakın. ama bir kez sadece 3 saat için bu adımı yineleyin. </li><li> sıvı parafin 810 ml: küp numuneleri (22 x 22 x 22 mm plastik, kare kalıp, boyut) daldırın. </li><li> Kolon doku örnekleri parafin oda sıcaklığında 24 saat boyunca katılaşmaya izin verin. </li></ol></li><li> Bir Mikrotom kullanarak Doku Çapraz bölümleri kesme <ol><li> 5 um&#39;lik bir kalınlıkta, üreticinin talimatlarına uygun olarak, bir mikrotom kullanılarak kolon örnekleri kesin. </li><li> % 0.3 jelatin içeren bir su banyosu (1 L) &#39;de kesik toplayın. Bu doku kesitlerinin katlanmasını önler. Doku bölümleri kurtarmak ve cam slaytlar takar. </li></ol></li><li> Doku Çapraz bölümlerin Hematoksilen ve Eosin Boyama <ol><li> Bir inkübatör içerisinde 60 ° C&#39;de 18 saat boyunca örnekleri Deparaffinize. Bu amaç için, cam s kullanımılide kulplu raf. </li><li> Parafinden arındırmadan sonra, 5 dakika süre ile çok saf ksilen 70 mL slaytlar bırakın. Taze ksilen kez bu adımı yineleyin. </li><li> 1 dakika boyunca mutlak alkol 70 ml örnekleri aktarın. Taze alkol ile bir kez bu adımı yineleyin. </li><li> 1 dakika için etanol,% 96 70 mL kolon doku numuneleri inkübe edin. Taze alkol ile bir kez bu adımı yineleyin. </li><li> 2 saniye süreyle iki kez musluk suyu örnekleri yıkayın. </li><li> 7 dakika Harris hematoksilen dokuları kuluçkaya yatmaktadır. </li><li> 2 saniye süreyle iki kez musluk suyu örnekleri yıkayın. </li><li> Asidik alkol örnekleri (etanol% 70, 70 mL, 1 M hidroklorik asit, 700 uL) 7 saniye boyunca inkübe edin. </li><li> 2 saniye süreyle iki kez musluk suyu örnekleri yıkayın. </li><li> lityum karbonat 7 sn için (distile su ve 100 mL lityum karbonat 1 g) 70 mL doku örnekleri inkübe edin. </li><li> 2 saniye süreyle iki kez musluk suyu örnekleri yıkayın. </li><li> etanol 80 70 mL örnekleri inkübe1 dakika için%. </li><li> 15 saniye için 70 mL Eozin-Y içine örnekleri aktarın. </li><li> 1 dakika boyunca% 96 etanol içinde 70 mL inkübe. Taze alkol ile bir kez bu adımı yineleyin. </li><li> 1 dakika boyunca mutlak etanol (etil alkol, mutlak susuz) 70 mL doku örnekleri inkübe edin. Taze alkol ile bir kez bu adımı yineleyin. </li><li> Bir mutlak alkol, 35 ml karışımı ve 1 dakika boyunca mutlak ksilen 35 mL 70 mL numune inkübe edin. </li><li> 1 dakika boyunca mutlak ksilen 70 mL numuneleri aktarın. Taze çok saf ksilen 70 mL, 5 dakika için bu adımı tekrarlanır. </li><li> , Kolon doku örnekleri sentetik reçine 80 uL ekleyin lamelleri ile onları karşılamak ve oda sıcaklığında 24 saat süreyle kurumaya bırakın. Son olarak, parlak alan mikroskobu 8 kullanarak örnekleri analiz. </li></ol></li></ol> İmmünofloresan tarafından 7. incelendiğinde Kavşağı Kompozisyon <ol><li> Adım 5.7 açıklandığı gibi doku hazırlayın ve 8 mikron kalınlığında kesitler kesmekBir kriyostat kullanarak. </li><li> Saptamak ve 20 dakika boyunca -20 ° C&#39;de% 96 etanol ile kolon kesitler geçirgenliği. NOT: Aksi belirtilmedikçe Bundan sonraki bütün inkübasyonlar kurutma ve florokrom solmasının engellenmesi için nemli bir karanlık kutu içinde, oda sıcaklığında gerçekleştirilmelidir. </li><li> Hava kuru numuneler ve sonra 1x PBS ile onlara 5 dakika boyunca 3 kez her durulama </li><li> 2 saat boyunca (PBS,% 0.01 Tween ile yıkandı ve% 2 BSA içeren) bloke etme çözeltisi ile inkübe edin. </li><li> engelleme çözeltisi çıkarın ve 10 dakika süre ile PBS,% 0.01 Tween ile durulayın. </li><li> Bu süre boyunca, PBS-% 0.01 Tween içerisinde arzu edilen konsantrasyonlarda birincil antikor seyreltin. </li><li> Yıkama suyu çıkarmak önceki adımda elde edilen antikor solüsyonu uygulanır ve nemlendirilmiş kutu içinde, 4 ° C&#39;de bir gece boyunca inkübe edilir. </li><li> Antikor çözeltisi çıkarın ve çok yumuşak çalkalama ile 10 dakika boyunca iyonu giderilmiş su ile bir kez her biri 5 dakika için PBS-% 0.01 Tween ile 3 kez yıkayın. </li><li> yıkama, santrifüj flor ikenochromeconjugated, türe özel, 4 ° C&#39;de 20 dakika 14,000 xg&#39;de ikincil antikorlar. </li><li> PBS-% 0.01 Tween sağlayıcı tarafından gösterildiği gibi, çökeltiler olmayan ikincil antikorlar seyreltilir uygulamak ve oda sıcaklığında 1 saat inkübe edilir. </li><li> Adımı yineleyin 7.8 ve mümkün olduğunca tamamen yıkama çözüm kaldırmak. </li><li> Pipet 4 mcL slayt her numune üzerinde ajan, anti-solma. </li><li> bir lamel ile örnekleri örtün. </li><li> 1 saat boyunca hava kuru. </li><li> oje ile mühür slayt. Slaytlar, ileride analize kadar -20 ° C&#39;de muhafaza edilebilir. </li><li> Bir konfokal lazer mikroskobu 8 analiz edin. </li></ol> Etidiyum oksidasyonu ile Oksidatif Stresin 8. Belirlenmesi <ol><li> 5 um kalınlığında bir kriyostat kolon bölümleri aşama 5.7&#39;de tarif edilen ve kesme şekilde DSS kolit 7 gün sonra, doku hazırlanması. Cam slaytlar üzerine monte kesitleri poli-L-lizin çözeltisi ile muamele edilmiş ve numuneler wit inkübeH 5 karanlıkta 30 dakika için 37 ° C sıcaklıkta su içinde dihydroethidium (DHE) uM. </li><li> PBS (pH 7.6), oda sıcaklığında yumuşak çalkalama ile 15 dakika her biri için üç kez numune yıkanır. Hava örnekleri, kuru ve floresan korumak için montaj orta bir damla ekleyin. okside bir lazer tarama konfokal mikroskop etidyum (40X büyütme, 568 nm dalga boyu) floresan gözlemleyin. </li></ol> MPO Testi ile Lökosit istihdamı 9. Analizi <ol><li> DSS kolit 7 gün sonra, kolon dokusu toplamak ve örnekleri homojenize - buz üzerinde bir homojenleştirici kullanılarak heksadesiltrimetilamonyum 1 mL (YSEK) tampon (50 mM% 0.5 YSEK fosfat tamponu, pH 6.0) ile (200, 400 mg) eklenmiştir. </li><li> 10 sn her% 40 genlik beş kez lizat tüm doku dahil ve ses dalgalarına maruz için 1 ml YSEK tampon ile iki kez homojenleştirici ucu durulayın. sıvı azot üç kez donma-çözülme. </li><li> 15 dakika için 14,000 x g&#39;de santrifüjleyin ve supernatant toplanır.sodyum sitrat (su içinde 1 M), hidrojen peroksit 0.1 mL ABTS, 5 mL karıştırılarak 2,2&#39;-azino-bis (3-etilbenzotiazolin-6-sülfonik asit) (ABTS) çözeltisi hazırlayın ve bi 45 mi -arıtılmış su. </li><li> 96-gözlü düz dipli levhanın içinde 0.1 ml ABTS çözeltisi ile her bir süpernatanın 0.1 mL karıştırın. 10 dakika sonra, bir spektrofotometre kullanılarak 460 nm&#39;de absorbans ölçümü. </li></ol> 10. PCR ile Pro-inflamatuar Sitokinlerin Anlatım değerlendirilmesi <ol><li> doku Homojenizasyon <ol><li> Bir güç homojenleştirici kullanılarak bir asit guanidinyum tiyosiyanat-fenol-kloroform karışımı 1 mL kolon doku örnekleri 50 ila 100 mg homojenize edilir. </li><li> 15 dakika oda sıcaklığında inkübe edin. </li></ol></li><li> Faz Ayırma <ol><li> kloroform 0.2 ml ekleyin ve 30 saniye kuvvetlice çalkalanır. </li><li> 30 dakika boyunca 4 ° C&#39;de inkübe edin. </li><li> 4 ° C&#39;de 60 dakika boyunca 12,000 x g&#39;de santrifüjleyin. </li><li> u aktaryeni bir tüpe (~ 500 uL) içinde pper sulu faz. </li></ol></li><li> RNA Yağış ve Tekrar Süspansiyonu <ol><li> izopropil alkol, 0.5 ml ilave edilir ve 60 dakika boyunca 4 ° C&#39;de inkübe örnekleri. </li><li> 4 ° C&#39;de 30 dakika için 12,000 x g&#39;de santrifüjleyin. </li><li> tamamen süpernatantı. </li><li> Etanol% 75 ve vorteks 1 ml ekleyin. </li><li> 4 ° C&#39;de 30 dakika için 12,000 x g&#39;de santrifüjleyin. </li><li> süpernatantı. </li><li> 3-5 dakika süreyle kurumaya kalan etanol izin verin. NOT: büyük ölçüde çözünürlüğünü azalacak gibi RNA pelet tamamen kurumasına izin vermeyin önemlidir. </li><li> dietilpirokarbonat 0.3 mL (DEPC) ile tedavi edilen suyun pelet yeniden çözülür. Hemen -80 ° C&#39;de veya mağaza (adım 10.5 Daha fazla kararlı) cDNA içine RNA örnekleri yazıya. </li></ol></li><li> RNA ölçümü <ol><li> DEPC arıtılmış su 99 ul RNA 1 mcL seyreltin. </li><li> inci oku260 nm ve örnek konsantrasyonu ve saflığı belirlemek için, bir UV / VIS spektrofotometre kullanılarak 280 nm&#39;de e OD. </li></ol></li><li> cDNA sentezi <ol><li> RNaz içermeyen steril tüplerde 1 Oligo uL (dT) 12-18 (0.5 mg / ml) ve DEPC ile muamele edilmiş su (12 uL toplam hacim) RNA numuneleri (1-5 ug) karıştırın. </li><li> 10 dakika boyunca 70 ° C&#39;de inkübe edin. </li><li> 10X PCR tampon maddesinin 2 uL, MgCI2, 50 mM 1 uL, 10 mM dNTP karışımı 1 ul ve 0.1 M ditiyotreitol ve 2 ul (DTT) ekleyin. </li><li> 5 dakika boyunca 4 ° C&#39;de inkübe edin. </li><li> ters transkriptazın 1 uL ilave edilir ve 5 dakika boyunca 42 ° C&#39;de inkübe edin. </li><li> 15 dakika boyunca 70 ° C&#39;de inkübe edin. </li><li> 15 dakika boyunca 4 ° C&#39;de inkübe edin. cDNA, bir sonraki kullanıma kadar -20 ° C&#39;de muhafaza edilebilir. </li></ol></li><li> PCR <ol><li> 10x PCR Tamponu 2.5 uL, 25 mM, 1.5 uL MgCl2 karıştırın, 10 mM dNTP 0.5 ul, mix 0.25 μ25 uL&#39;lik bir toplam hacme Taq DNA polimeraz, 0.25 her bir primer uL (10 uM) ve cDNA (100 ng) ve steril su L. </li><li> 96 oyuklu bir termal döngü örnekleri çalıştırın. ileri, genomik DNA amplifikasyon önlemek ve primerler farklı ekzon bulunmalıdır ters çevirmek için: IL1β-FW: GCAACTGTTCCTGAACTCAACT ve IL1β-RE: TCTTTTGGGGTCCGTCAACT; IL-6-FW: CCTTCCTACCCCAATTTCCAA ve IL 6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT ve KC-RE: CCTGAGGGCAACACCTTCA; ve Aktin-FW: TATCCACCTTCCAGCAGATGT ve Aktin-RE: AGCTCAGTAACAGTCCGCCTA. 15 s, 30 s için 58 ° C ve 30 sn için 72 ° C, artı 72 ° C&#39;de 10 dakika boyunca son bir uzatma, 95 ° C &#39;de 95 ° C, 5 dakika için 30 döngü izledi: Aşağıdaki PCR koşulları kullanarak . </li></ol></li></ol>

<ol>
	<li>Souza, H. S., Fiocchi, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunopathogenesis+of+IBD:+current+state+of+the+art.">Immunopathogenesis of IBD: current state of the art.</a> Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).</li><li>Xavier, R. J., Podolsky, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unravelling+the+pathogenesis+of+inflammatory+bowel+disease.">Unravelling the pathogenesis of inflammatory bowel disease.</a> Nature. 448, 427-434 (2007).</li><li>Neuman, M. G., Nanau, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+role+of+diet,+microbiota,+life+style.">Inflammatory bowel disease: role of diet, microbiota, life style.</a> Transl Res. 160, 29-44 (2011).</li><li>Lowenberg, M., D'Haens, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-Generation+Therapeutics+for+IBD.">Next-Generation Therapeutics for IBD.</a> Current Gastroenterol Rep. 17, 21 (2015).</li><li>Bernstein, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Does+everyone+with+inflammatory+bowel+disease+need+to+be+treated+with+combination+therapy.">Does everyone with inflammatory bowel disease need to be treated with combination therapy.</a> Curr Opin Gastroenterol. , (2016).</li><li>Nanau, R. M., Neuman, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutritional+and+probiotic+supplementation+in+colitis+models.">Nutritional and probiotic supplementation in colitis models.</a> Dig Dis Sci. 57, 2786-2810 (2012).</li><li>Yamamoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutrition+and+diet+in+inflammatory+bowel+disease.">Nutrition and diet in inflammatory bowel disease.</a> Curr Opin Gastroenterol. 29, 216-221 (2013).</li><li>Vargas Robles, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+Colitis+Is+Attenuated+by+Cardioprotective+Diet+Supplementation+That+Reduces+Oxidative+Stress,+Inflammation,+and+Mucosal+Damage.">Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage.</a> Ox Med Cell Longev. , 8473242 (2016).</li><li>Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antioxidative+diet+supplementation+reverses+high-fat+diet-induced+increases+of+cardiovascular+risk+factors+in+mice.">Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice.</a> Ox Med Cell Longev. 2015, 467471 (2015).</li><li>Perse, M., Cerar, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dextran+sodium+sulphate+colitis+mouse+model:+traps+and+tricks.">Dextran sodium sulphate colitis mouse model: traps and tricks.</a> J Biomed Biotechnol. 2012, 718617 (2012).</li><li>Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dextran+sulfate+sodium+(DSS)-induced+colitis+in+mice.">Dextran sulfate sodium (DSS)-induced colitis in mice.</a> Curr. Protoc. Immunol. 104, 25 (2014).</li><li>Laroui, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dextran+sodium+sulfate+(DSS)+induces+colitis+in+mice+by+forming+nano-lipocomplexes+with+medium-chain-length+fatty+acids+in+the+colon.">Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon.</a> PLoS One. 7, 32084 (2009).</li><li>Mennigen, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probiotic+mixture+VSL#3+protects+the+epithelial+barrier+by+maintaining+tight+junction+protein+expression+and+preventing+apoptosis+in+a+murine+model+of+colitis.">Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis.</a> Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).</li><li>Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple,+practical+'swiss+roll'+method+of+preparing+tissues+for+paraffin+or+methacrylate+embedding.">A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding.</a> J Microsc. 145, 115-120 (1987).</li><li>Shen, W., Gaskins, H. R., McIntosh, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+dietary+fat+on+intestinal+microbes,+inflammation,+barrier+function+and+metabolic+outcomes.">Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes.</a> J Nutr Biochem. , (2013).</li><li>Bruewer, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interferon-gamma+induces+internalization+of+epithelial+tight+junction+proteins+via+a+macropinocytosis-like+process.">Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process.</a> FASEB J. 19, 923-933 (2005).</li><li>Fournier, B. M., Parkos, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+neutrophils+during+intestinal+inflammation.">The role of neutrophils during intestinal inflammation.</a> Muc Immunol. 5, 354-366 (2012).</li><li>Yan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+and+spatial+analysis+of+clinical+and+molecular+parameters+in+dextran+sodium+sulfate+induced+colitis.">Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis.</a> PLoS One. 4, 6073 (2009).</li><li>Maxwell, J. R., Viney, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overview+of+mouse+models+of+inflammatory+bowel+disease+and+their+use+in+drug+discovery.">Overview of mouse models of inflammatory bowel disease and their use in drug discovery.</a> Curr Prot Pharmacol, S.J. Enna. , (2009).</li><li>Ostanin, D. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+transfer+model+of+chronic+colitis:+concepts,+considerations,+and+tricks+of+the+trade.">T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade.</a> Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).</li><li>Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+on+chemical-induced+inflammatory+bowel+disease+models+in+rodents.">A review on chemical-induced inflammatory bowel disease models in rodents.</a> Kor J Physiol Pharmacol. 18, 279-288 (2014).</li><li>Whittem, C. G., Williams, A. D., Williams, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+Colitis+modeling+using+Dextran+Sulfate+Sodium+(DSS).">Murine Colitis modeling using Dextran Sulfate Sodium (DSS).</a> JoVE. , (2010).</li><li>Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+induced+mouse+models+of+intestinal+inflammation.">Chemically induced mouse models of intestinal inflammation.</a> Nat Prot. 2, 541-546 (2007).</li><li>Naydenov, N. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonmuscle+Myosin+IIA+Regulates+Intestinal+Epithelial+Barrier+in+vivo+and+Plays+a+Protective+Role+During+Experimental+Colitis.">Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis.</a> Sci Rep. 6, 24161 (2016).</li><li>Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmigrated+neutrophils+in+the+intestinal+lumen+engage+ICAM-1+to+regulate+the+epithelial+barrier+and+neutrophil+recruitment.">Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment.</a> Muc Immunol. 7, 905-915 (2014).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dextran+sodium+sulfate+inhibits+the+activities+of+both+polymerase+and+reverse+transcriptase:+lithium+chloride+purification,+a+rapid+and+efficient+technique+to+purify+RNA.">Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA.</a> BMC Res Notes. 6, 360 (2013).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Klinik çalışmalarda besin takviyeleri kullanmak için, yararları ve bu tür ek güvenlik dikkatle hayvan çalışmalarında, in vivo olarak değerlendirilmelidir. kolit durumunda, IBD klinik belirtilerini benzeyen bazı uygun hayvan modelleri DSS, TNBS ya da asetik asit kullanılarak kimyasal modelleri dahil olmak üzere, oluşturulmuştur; knock-out gibi IL10-KO olarak (KO) modelleri; ve evlat edinen T hücre transferi 19-21 kullanılarak kolit immün hücre aracılı. Kolit DSS modeli, insan IB...

Kolit ishal ve karın ağrısına neden olabilir kolonun inflamatuar bir durumdur. Kolit enfeksiyon ya da strese yanıt olarak, akut olabilir, ya da enflamatuvar bağırsak hastalığı (IBD) grubuna ait ülseratif kolit (ÜK) &#39;deki gibi, kronik bir hastalık olarak ortaya çıkabilir. UC klinik bulguları iyi tanımlanmış olmasına karşın, patogenezi hala tam olarak 1 anlaşılmaktadır. UC önemli bir rol oynayan 2 genetik mutasyonlar ve anormal bağışıklık tepkilerinin ile, multifaktöriyel bir hastalık olduğunu uzmanlar arasında kabul edilmektedir. Ancak, bu tür yaşam ve beslenme tarzı gibi çevresel faktörler, aynı zamanda hastalık gelişimi ve ilerlemesi 3 katkıda bulunur. Ne yazık ki, İBH tedavi edilebilir değildir, ancak klinik semptomları hafifletmek amacı birçok tedavi seçeneği vardır. Güncel tedaviler gibi sulfasalazin ve kortikosteroidler gibi anti-inflamatuar ilaçlar, arasında; Bu azathio gibi imünosupresanlar,Prine; İntegrinler gibi tümör nekroz faktörü-a (TNF-α) ya da blok adezyon molekülleri gibi yakalama pro-enflamatuar sitokinler, aşırı lökosit azaltmak için tek klonlu antikorları; ve Janus kinaz (JAK) 4 gibi pro-enflamatuar yolları, tetik kinazları hedef inhibitörleridir. Tüm hastalar tüm tedavilere yanıt, bu nedenle tedavi stratejileri 5 kişiye göre ayarlanmalıdır. Ayrıca, bu tedavi edici ilaçlar çoğu zaman ciddi yan etkilere yol, metabolizma ve bağışıklık tepkilerinin engeller. Bu nedenle, alternatif tedavi incelenmiştir. Alternatif tedaviler probiyotikler ve başarı 6,7 çeşitli düzeylerde ile hayvan modellerinde ve klinik çalışmalarda uygulanmış olan besin takviyeleri içerir. Son zamanlarda bulunan bu tür anti-oksidatif vitamin ya da ω3-poli-doymamış yağ asitleri gibi farklı tek besin takviyeleri, uygulama (pUFAS), kolit ve kardiyovasküler hastalık semptomlarını 8,9 hafifletilmesi gibi ek bir kombinasyonunun uygulanması altındadır. Bu çalışmalar, farelerde gerçekleştirilmiştir, bu yüzden, klinik çalışmalar, bu bulgular, insanlar için geçerli olup olmadığını belirlemek için insanlarda gerçekleştirilmelidir. klinik çalışmalar başlatılmış önce, yeni tedavi etkinliği ve güvenliği hayvan modellerinde değerlendirilmelidir. İBH için dekstran sülfat sodyum (DSS) modeli yaygın hastalık gelişimi mekanizmaları ve uyuşturucu ve besin takviyeleri 6,10 yararlı etkilerini incelemek için kullanılır olmuştur. Birçok çalışmada, indüklenen yedi günlük bir süre boyunca, sadece akut hastalığı; Bununla birlikte, bu hayvanlarda gözlenen klinik belirtiler yakın İBH hastalarda gözlenen benzeyen (örneğin, kanlı ishal, kilo kaybı, epitelyal disfonksiyon ve bağışık hücre içi filtratı) 10. DSS, mukozada erozyonlar neden olurbariyer disfonksiyonu ve artmış intestinal epitel geçirgenliği 11 ile sonuçlanır. tam mekanizması bilinmemektedir. Bununla birlikte, bir çalışma DSS epitelyal hücrelere girmek için ve enflamatuar sinyal 12 geçiş yolu uyarabildiği nano lipocomplexes oluşturmak üzere, orta zincir uzunluğunda yağ asitlerinin etkileşim göstermektedir. Bu yazıda kaynaklı ve her hayvanın bir sabit doz sağlamak için sonda ile nasıl uygulandığını besin takviyeleri farelerde, analiz edilir kolit nasıl ayrıntılı olarak tarif ve çeşitli kolit belirtileri üzerine bu tür takviyeleri etkileri nasıl incelenmiştir.

<table border="0" cellpadding="0" cellspacing="0" width="953">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">0.3% of gelatin&#160;</td>
			<td style="width:184px;">Bioxon</td>
			<td style="width:139px;">158</td>
			<td style="width:191px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">10% formaldehyde</td>
			<td style="width:184px;">J.T. Baker</td>
			<td style="width:139px;">2106-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">96-well plate with flat bottom</td>
			<td style="width:184px;">Corning</td>
			<td style="width:139px;">3368</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Absolute ethanol&#160;</td>
			<td style="width:184px;">J.T. Baker</td>
			<td style="width:139px;">9000-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Absolute xylene</td>
			<td style="width:184px;">J.T. Baker</td>
			<td style="width:139px;">9490-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">ABTS</td>
			<td style="width:184px;">Sigma Aldrich</td>
			<td style="width:139px;">H5882</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Bovine Serum Albumin</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">9048-46-8</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">ColoScreen</td>
			<td style="width:184px;">Helena Laboratories</td>
			<td style="width:139px;">5072</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Corabion (Kindly provided by Merck, Naucalpan, Mexico)</td>
			<td style="width:184px;">Merck</td>
			<td style="width:139px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Dextran Sulfate Sodium Salt</td>
			<td style="width:184px;">Affymetrix</td>
			<td style="width:139px;">9011-18-1</td>
			<td style="width:191px;">(M.W. 40,000-50,000)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Dihydroethidium</td>
			<td style="width:184px;">Life Technology</td>
			<td style="width:139px;">D11347</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Eosin-Y&#160;</td>
			<td style="width:184px;">J.T. Baker</td>
			<td style="width:139px;">L087-03</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Evans blue</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">314-13-6</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Feeding&#160; needle</td>
			<td style="width:184px;">Cadence Science Inc.</td>
			<td style="width:139px;">9921</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Glass slide rack with handle</td>
			<td style="width:184px;">Electron Microscopy</td>
			<td style="width:139px;">70312-16</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Glass Slides</td>
			<td style="width:184px;">Corning</td>
			<td style="width:139px;">2947</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Harris hematoxylin&#160;</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">H3136</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Hexadecyltrimethyammonium (HTAB)</td>
			<td style="width:184px;">Sigma Aldrich</td>
			<td style="width:139px;">H6269</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Histosette (Embedding cassette)</td>
			<td style="width:184px;">Simport</td>
			<td style="width:139px;">M498.2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Hydrochloric acid 1 M</td>
			<td style="width:184px;">J.T. Baker</td>
			<td style="width:139px;">9535-62</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Hydrogen peroxide</td>
			<td style="width:184px;">Sigma Aldrich</td>
			<td style="width:139px;">H3410</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Ketamine</td>
			<td style="width:184px;">PiSA Agropecuaria</td>
			<td style="width:139px;">Q-7833-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Liquid paraffin&#160;</td>
			<td style="width:184px;">Paraplast</td>
			<td style="width:139px;">39501-006</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Lithium carbonate&#160;</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">2362</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">N,N-dimethylformamide</td>
			<td style="width:184px;">J.T. Baker</td>
			<td style="width:139px;">68-12-2</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">N-acetylcysteine</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">A9165</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Plastic cubes</td>
			<td style="width:184px;">Electron Microscopy</td>
			<td style="width:139px;">70181</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Poly-L-Lysine Solution</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">25988-63-0</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Prism 5 statistical software</td>
			<td style="width:184px;">GraphPad Software</td>
			<td style="width:139px;">Prism 5</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Saline Solution 0.9% NaCl</td>
			<td style="width:184px;">CS PiSA</td>
			<td style="width:139px;">Q-7833-009</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Sodium citrate</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">W302600</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Synthetic resin&#160;</td>
			<td style="width:184px;">Poly Mont</td>
			<td style="width:139px;">7987</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Taq DNA polymerase</td>
			<td style="width:184px;">Invitrogen</td>
			<td style="width:139px;">11615-010</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Tissue-tek. O.C.T Compound</td>
			<td style="width:184px;">Sakura Finetek</td>
			<td style="width:139px;">4583</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Tuberculine Syringe</td>
			<td style="width:184px;">BD Plastipak</td>
			<td style="width:139px;">305945</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Tween 20</td>
			<td style="width:184px;">Sigma-Aldrich</td>
			<td style="width:139px;">9005-64-5</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">VECTASHIELD Antifade Mounting Medium with DAPI</td>
			<td style="width:184px;">Vector Laboratories</td>
			<td style="width:139px;">H-1200</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:439px;">Xylazine</td>
			<td style="width:184px;">PiSA Agropecuaria</td>
			<td style="width:139px;">Q-7833-099</td>
			<td></td>
		</tr>
	</tbody>
</table>

analyzing beneficial effects of nutritional supplements on intestinal epithelial barrier functions during experimental colitis

Crohn hastalığı ve ülseratif kolit de dahil olmak üzere inflamatuvar bağırsak hastalığı (İBH), bağırsak, kronik olarak tekrarlayan bozukluklarıdır. Onlar etkilenen bireylerde bu tür karın krampları, kanlı ishal ve kilo kaybı gibi ciddi sorunlara, neden olur. Ne yazık ki, hiçbir tedavi henüz yoktur ve tedaviler sadece semptomları hafifletmek için hedefliyoruz. Mevcut tedaviler, ciddi yan etkilere neden olabilir, anti-enflamatuar ve bağışıklık bastırıcı ilaçlardır. Bu yan etkilere neden yok böyle besin takviyeleri gibi alternatif tedavi seçenekleri, aramaya garanti eder. Klinik çalışmalarda da Kullanımdan önce, bu tip bileşikler titizlikle hayvan modellerinde etkinlik ve güvenlik açısından test edilmelidir. Güvenilir bir deneysel model insanlarda ülseratif kolit klinik belirtileri birçok üretir farelerde dekstran sülfat sodyum (DSS) kolit modelidir. Son zamanlarda ihtiva eden bir besin takviyesi yararlı etkilerini test etmek için, bu model tatbikC ve E vitaminleri, L-arginin ve ω3-çoklu doymamış yağ asitleri (PUFA). Biz çeşitli hastalık parametrelerini analiz ve bu ek hastalık aktivite indeksi genel bir iyileşme lider, ödem oluşumu, doku hasarı, lökosit infiltrasyonu, oksidatif stres ve pro-inflamatuar sitokinlerin üretimini iyileştirmek mümkün olduğunu gördük. Bu yazıda, detaylı, doğru C57BL / 6 farelerde DSS kolit modelini kullanarak besin takviyeleri uygulama, hem de nasıl gibi histoloji, oksidatif stres ve inflamasyon gibi hastalık parametreleri değerlendirilir açıklar. Farklı diyet takviyeleri yararlı etkileri analiz ardından sonunda İBH belirtileri hafifletmek ve / veya ciddi yan etkilere neden olmadan remisyon aşamalarını uzatmak alternatif tedavi stratejilerinin geliştirilmesi için yeni yollar açabilir.

Diyet Takviyeler DSS Kolit koruyunuz Can vitamin C, vitamin E, nitrik oksit (NO) -Source L-arginin ve ω3-doymamış yağ asitleri (ω3-PUFA&#39;lar) gibi anti-enflamatuar ve anti-oksidatif beslenme takviyeleri, hayvanda değişen başarı ile kullanılmıştır modeller enflamatuar hastalıklar 3,6,15 belirtileri hafifletmek için. Yetersiz beslenme, oksidatif stres ve pro-inflamatuar sitokinlerin üretimi hem akut he...

Watch this Scientific Journal Video about Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis at JoVE.com

Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis

enflamatuvar bağırsak hastalığı (IBD) Mevcut tedaviler, hastalığın semptomlarını hafifletmek amaçlamaktadır, ancak ciddi yan etkilere neden olabilir. Böylece, alternatif stratejiler hayvan kolit modellerinde araştırılmaktadır. Burada, klinik IBD işaretleri diyet takviyeleri yararlı etkileri böyle bir kolit modelinde analiz edilmektedir açıklar.

Deneysel Kolit sırasında Bağırsak epitel Bariyer Fonksiyonları Üzerine Ek Beslenme Faydalı Etkileri Analizi

Inflammatory bowel diseases (IBD), including Crohn&#39;s disease and ulcerative colitis, are chronic relapsing disorders of the intestines. They cause ...

analyzing-beneficial-effects-nutritional-supplements-on-intestinal

Research

Education

JoVE Core

JoVE Journal

Pharmacology

Medicine

Unit 1

Drugs for Chronic Bowel Disorders

SCIENTISTS IN ACTION

12.1K Görüntüleme.  Center for Research and Advanced Studies of the National Polytechnic Institute.  enflamatuvar bağırsak hastalığı (IBD) Mevcut tedaviler, hastalığın semptomlarını hafifletmek amaçlamaktadır, ancak ciddi yan etkilere neden olabilir. Böylece, alternatif stratejiler hayvan kolit modellerinde araştırılmaktadır. Burada, klinik IBD işaretleri diyet takviyeleri yararlı etkileri böyle bir kolit modelinde analiz edilmektedir açıklar. 

Video: Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis

DNBS/TNBS Colitis Models: Providing Insights Into Inflammatory Bowel Disease and Effects of Dietary Fat

Inflammatory Bowel Diseases (IBD), including Crohn&#39;s Disease and Ulcerative Colitis, have long been associated with a genetic basis, and more recently host immune responses to microbial and environmental agents. Dinitrobenzene sulfonic acid (DNBS)-induced colitis allows one to study the pathogenesis of IBD associated environmental triggers such as stress and diet, the effects of potential therapies, and the mechanisms underlying intestinal inflammation and mucosal injury. In this paper, we investigated the effects of dietary n-3 and n-6 fatty acids on the colonic mucosal inflammatory response to DNBS-induced colitis in rats. All rats were fed identical diets with the exception of different types of fatty acids [safflower oil (SO), canola oil (CO), or fish oil (FO)] for three&#160;weeks prior to exposure to intrarectal DNBS. Control rats given intrarectal ethanol continued gaining weight over the 5 day study, whereas, DNBS-treated rats fed lipid diets all lost weight with FO and CO fed rats demonstrating significant weight loss by 48&#160;hr and rats fed SO by 72&#160;hr. Weight gain resumed after 72&#160;hr post DNBS, and by 5 days post DNBS, the FO group had a higher body weight than SO or CO groups. Colonic sections collected 5&#160;days post DNBS-treatment showed focal ulceration, crypt destruction, goblet cell depletion, and mucosal infiltration of both acute and chronic inflammatory cells that differed in severity among diet groups. The SO fed group showed the most severe damage followed by the CO, and FO fed groups that showed the mildest degree of tissue injury. Similarly, colonic myeloperoxidase (MPO) activity, a marker of neutrophil activity was significantly higher in SO followed by CO fed rats, with FO fed rats having significantly lower MPO activity. These results demonstrate the use of DNBS-induced colitis, as outlined in this protocol, to determine the impact of diet in the pathogenesis of IBD.

DNBS/TNBS induced colitis offers an alternative and inexpensive method to study the pathobiology of inflammatory bowel disease. The protocol discussed in this paper outlines the successful application of DNBS to induce colitis in mice and rats and allows one to thoroughly study host-mediated intestinal responses.

DNBS / TNBS kolit Modelleri: Koliti içine Trendleri ve Diyet Yağ Etkileri sağlanması

Inflammatory Bowel Diseases (IBD), including Crohn&#39;s Disease and Ulcerative Colitis, have long been associated with a genetic basis, and more recently ...

Tıp

Long-Term Catheterization of the Intestinal Lymph Trunk and Collection of Lymph in Neonatal Pigs

Catheterization of the intestinal lymph trunk in neonatal pigs is a technique allowing for the long-term collection of large quantities of intestinal (central) efferent lymph. Importantly, the collection of central lymph from the intestine enables researchers to study both the mechanisms and lipid constitutes associated with lipid metabolism, intestinal inflammation and cancer metastasis, as well as cells involved in immune function and immunosurveillance. A ventral mid-line surgical approach permits excellent surgical exposure to the cranial abdomen and relatively easy access to the intestinal lymph trunk vessel that lies near the pancreas and the right ventral segment of the portal vein underneath the visceral aspect of the right liver lobe. The vessel is meticulously dissected and released from the surrounding fascia and then dilated with sutures allowing for insertion and subsequent securing of the catheter into the vessel. The catheter is exteriorized and approximately 1 L/24 hr of lymph is collected over a 7 day period. While this technique enables the collection of large quantities of central lymph over an extended period of time, the success depends on careful surgical dissection, tissue handling and close attention to proper surgical technique. This is particularly important with surgeries in young animals as the lymph vessels can easily tear, potentially leading to surgical and experimental failure. The video demonstrates an excellent surgical technique for the collection of intestinal lymph.

We present a surgical procedure to catheterize the intestinal lymph trunk in neonatal pigs to collect large quantities of lipid metabolism components from efferent lymph.

Yenidoğan Domuzların Lenf Bağırsak Lenf Trunk ve Koleksiyonu Uzun Vadeli Kateterizasyon

Catheterization of the intestinal lymph trunk in neonatal pigs is a technique allowing for the long-term collection of large quantities of intestinal ...

A Step by Step Protocol for Subretinal Surgery in Rabbits

Age related macular degeneration (AMD), retinitis pigmentosa, and other RPE related diseases are the most common causes for irreversible loss of vision in adults in industrially developed countries. RPE transplantation appears to be a promising therapy, as it may replace dysfunctional RPE, restore its function, and thereby vision.
Here we describe a method for transplanting a cultured RPE monolayer on a scaffold into the subretinal space (SRS) of rabbits. After vitrectomy xenotransplants were delivered into the SRS using a custom made shooter consisting of a 20-gauge metallic nozzle with a polytetrafluoroethylene (PTFE) coated plunger. The current technique evolved in over 150 rabbit surgeries over 6 years. Post-operative follow-up can be obtained using non-invasive and repetitive in vivo imaging such as spectral domain optical coherence tomography (SD-OCT) followed by perfusion-fixed histology.
The method has well-defined steps for easy learning and high success rate. Rabbits are considered a large eye animal model useful in preclinical studies for clinical translation. In this context rabbits are a cost-efficient and perhaps convenient alternative to other large eye animal models.

Retinal pigment epithelium (RPE) replacement strategies and gene-based therapy are considered for several retinal degenerative conditions. For clinical translation, large eye animal models are required to study surgical techniques applicable in patients. Here we present a rabbit model for subretinal surgery geared towards RPE transplantation, which is versatile and cost-efficient.

Tavşanlarda Subretinal Cerrahi Adım Protokolle Bir Adım

Age related macular degeneration (AMD), retinitis pigmentosa, and other RPE related diseases are the most common causes for irreversible loss of vision in ...

Effects of Allogeneic Platelet-Rich Plasma (PRP) on the Healing Process of Sectioned Achilles Tendons of Rats: A Methodological Description

This article describes the experimental procedures used to observe if PRP can positively affect tendon healing. There are 4 main steps to follow: induce a lesion in the Achilles tendon; prepare PRP and inject it (or the saline solution); remove the tendon; and perform biomechanical, molecular, and histological evaluations. At each step, all the procedures and methods are described in detail, so they can be reproduced easily.
Achilles tendons have been surgically sectioned (removal of a 5-mm long section). Afterwards, PRP or saline solution was injected to study whether PRP has a positive effect on the healing of the tendon. Three groups of 40 animals (a total of 120 rats were used in this study) were subdivided into 2 subgroups: PRP injection group and a saline injection control group. Rats were sacrificed at increasing time points (Group A: 5 days; Group B: 15 days; Group C: 30 days) and tendons were removed. 90 tendons underwent biomechanical testing before performing transcriptomic analysis and the 30 remaining tendons were submitted to histological analysis.

Effects of Allogeneic Platelet-Rich Plasma PRP on the Healing Process of Sectioned Achilles Tendons of Rats: A Methodological Description

This protocol describes the evaluation process of healing tendons in rats that have been injected with allogeneic platelet rich plasma (PRP) or saline solution after removing part of the Achilles tendon. The progress of tendon healing is evaluated at several time points using different types of analyses.

Allojeneik trombosit açısından zengin plazma (PRP) kesitli Aşil tendon sıçan iyileşme süreci üzerine etkileri: metodolojik bir açıklama

This article describes the experimental procedures used to observe if PRP can positively affect tendon healing. There are 4 main steps to follow: induce a ...

Ultrasonography in Experimental Reproductive Investigations on Rats

With the development of assisted reproductive technology and the ethical limitations of research on humans, rat animal models have been widely used in reproductive medicine. In the past, the study of reproductive system development in rodents has been based on one-time histological examination of excised tissues. Recently, with the development of high-resolution transabdominal ultrasound, high-quality sonography can now be performed to evaluate the reproductive organs of rats, allowing a new method for studying the reproductive system. Images were obtained using a high-resolution ultrasonographic system. Gynecological ultrasonography was performed on 28 eight-week-old non-pregnant rats and 5 pregnant Sprague-Dawley rats. We describe how to recognize organs of the reproductive system and associated structures in typical views during different phases of the estrus cycle. Color flow Doppler was used to measure uterine artery blood flow and evaluate uterine blood flow pattern changes during different stages of pregnancy. We have demonstrated that ultrasound exploration is a useful method for evaluating changes in internal reproductive organs. Its use raises the possibility of conducting additional experiments, including medical or surgical procedures, and provides the ability to monitor sonographic changes to internal organs without sacrificing animals.

This manuscript describes the utility of ultrasound performed on female rats to design experimental models for reproductive and gynecological investigation. A step-by-step explanation of how to perform ultrasonographic evaluation is shown.

Fareler üzerinde deneysel üreme araştırmalarda Ultrasonografi

With the development of assisted reproductive technology and the ethical limitations of research on humans, rat animal models have been widely used in ...

Improved Method for the Establishment of an In Vitro Blood-Brain Barrier Model Based on Porcine Brain Endothelial Cells

The aim of this protocol presents an optimized procedure for the purification and cultivation of pBECs and to establish in vitro blood-brain barrier (BBB) models based on pBECs in mono-culture (MC), MC with astrocyte-conditioned medium (ACM), and non-contact co-culture (NCC) with astrocytes of porcine or rat origin. pBECs were isolated and cultured from fragments of capillaries from the brain cortices of domestic pigs 5-6 months old. These fragments were purified by careful removal of meninges, isolation and homogenization of grey matter, filtration, enzymatic digestion, and centrifugation. To further eliminate contaminating cells, the capillary fragments were cultured with puromycin-containing medium. When 60-95% confluent, pBECs growing from the capillary fragments were passaged to permeable membrane filter inserts and established in the models. To increase barrier tightness and BBB characteristic phenotype of pBECs, the cells were treated with the following differentiation factors: membrane permeant 8-CPT-cAMP (here abbreviated cAMP), hydrocortisone, and a phosphodiesterase inhibitor, RO-20-1724 (RO). The procedure was carried out over a period of 9-11 days, and when establishing the NCC model, the astrocytes were cultured 2-8 weeks in advance. Adherence to the described procedures in the protocol has allowed the establishment of endothelial layers with highly restricted paracellular permeability, with the NCC model showing an average transendothelial electrical resistance (TEER) of 1249 &#177; 80 &#937; cm2, and paracellular permeability (Papp) for Lucifer Yellow of 0.90 10-6 &#177; 0.13 10-6 cm sec-1 (mean &#177; SEM, n=55). Further evaluation of this pBEC phenotype showed good expression of the tight junctional proteins claudin 5, ZO-1, occludin and adherens junction protein p120 catenin. The model presented can be used for a range of studies of the BBB in health and disease and, with the highly restrictive paracellular permeability, this model is suitable for studies of transport and intracellular trafficking.

Improved Method for the Establishment of an In Vitro Blood-Brain Barrier Model Based on Porcine Brain Endothelial Cells

The aim of the protocol is to present an optimized procedure for the establishment of an in vitro blood-brain barrier (BBB) model based on primary porcine brain endothelial cells (pBECs). The model shows high reproducibility, high tightness, and is suitable for studies of transport and intracellular trafficking in drug discovery.

Yöntem bir Vitro kan - beyin bariyerini modeli domuz beyin endotel hücreleri temel alan kurulması için geliştirilmiş

The aim of this protocol presents an optimized procedure for the purification and cultivation of pBECs and to establish in vitro blood-brain barrier (BBB) ...

Microscopy Based Methods for the Assessment of Epithelial Cell Migration During In Vitro Wound Healing

Cell migration is a mandatory aspect for wound healing. Creating artificial wounds on research animal models often results in costly and complicated experimental procedures, while potentially lacking in precision. In vitro culture of epithelial cell lines provides a suitable platform for researching the cell migratory behavior in wound healing and the impact of treatments on these cells. The physiology of epithelial cells is often studied in non-confluent conditions; however, this approach may not resemble natural wound healing conditions. Disrupting the epithelium integrity by mechanical means generates a realistic model, but may impede the application of molecular techniques. Consequently, microscopy based techniques are optimal for studying epithelial cell migration in vitro. Here we detail two specific methods, the artificial wound scratch assay and the artificial migration front assay, that can obtain quantitative and qualitative data, respectively, on the migratory performance of epithelial cells.

Microscopy Based Methods for the Assessment of Epithelial Cell Migration During  In Vitro Wound Healing

This manuscript describes how incision-like lesions made on cultured epithelial cell monolayers conveniently model wound healing in vitro, allowing for imaging by confocal or laser scanning microscopy, and which can provide high-quality quantitative and qualitative data for studying both cell behavior and the mechanisms involved in migration.

Mikroskopi Vitro yara iyileşmesi sırasında epitel hücre göç değerlendirilmesi için yöntemleri temel

Cell migration is a mandatory aspect for wound healing. Creating artificial wounds on research animal models often results in costly and complicated ...

Measuring the Effects of Bacteria and Chemicals on the Intestinal Permeability of Caenorhabditis elegans

In living organisms, intestinal hyperpermeability is a serious symptom that leads to many inflammatory bowel diseases (IBDs). Caenorhabditis elegans is a nonmammalian animal model that is widely used as an assay system due to its short lifespan, transparency, cost-effectiveness, and lack of animal ethics issues. In this study, a method was developed to investigate the effects of different bacteria and 3,3'-diindolylmethane (DIM) on the intestinal permeability of C. elegans with a high-throughput image analysis system. The worms were infected with different gut bacteria or cotreated with DIM for 48 h and fed with fluorescein isothiocyanate (FITC)-dextran overnight. Then, the intestinal permeability was examined by comparing the fluorescence images and the fluorescence intensity inside the worm bodies. This method may also have the potential to identify probiotic and pathogenic intestinal bacteria that affect intestinal permeability in the animal model and is effective for examining the effects of harmful or health-promoting chemicals on intestinal permeability and intestinal health. However, this protocol also has some considerable limitations at the genetic level, especially for determining which genes are altered to control illness, because this method is mostly used for phenotypic determination. In addition, this method is limited to determining exactly which pathogenic substrates cause inflammation or increase the permeability of the worms' intestines during infection. Therefore, further in-depth studies, including investigation of the molecular genetic mechanism using mutant bacteria and nematodes as well as chemical component analysis of bacteria, are required to fully evaluate the function of bacteria and chemicals in determining intestinal permeability.

Measuring the Effects of Bacteria and Chemicals on the Intestinal Permeability of Caenorhabditis elegans

This protocol describes how to measure intestinal permeability of Caenorhabditis elegans. This method is helpful for basic biological research on intestinal health related to the interaction between intestinal bacteria and their host and for screening to identify probiotic and chemical agents to cure leaky gut syndrome and inflammatory bowel diseases.

Bakteri ve Kimyasalların Caenorhabditis elegans'ın Bağırsak Geçirgenliği Üzerine Etkilerinin Ölçülmesi

In living organisms, intestinal hyperpermeability is a serious symptom that leads to many inflammatory bowel diseases (IBDs). Caenorhabditis elegans is a ...

Investigating Intestinal Barrier Breakdown in Living Organoids

Organoids and three-dimensional (3D) cell cultures allow the investigation of complex biological mechanisms and regulations in vitro, which previously was not possible in classical cell culture monolayers. Moreover, monolayer cell cultures are good in vitro model systems but do not represent the complex cellular differentiation processes and functions that rely on 3D structure. This has so far only been possible in animal experiments, which are laborious, time consuming, and hard to assess by optical techniques. Here we describe an assay to quantitatively determine the barrier integrity over time in living small intestinal mouse organoids. To validate our model, we applied interferon gamma (IFN-&#947;) as a positive control for barrier destruction and organoids derived from IFN-&#947; receptor 2 knock out mice as a negative control. The assay allowed us to determine the impact of IFN-&#947; on the intestinal barrier integrity and the IFN-&#947; induced degradation of the tight junction proteins claudin-2, -7, and -15. This assay could also be used to investigate the impact of chemical compounds, proteins, toxins, bacteria, or patient-derived probes on the intestinal barrier integrity.

Here we describe a technique to quantify the barrier integrity of small intestinal organoids. The fact that the method is based on living organoids enables the sequential investigation of different barrier integrity modulating substances or combinations thereof in a time-resolved manner.

Yaşayan Organoidlerde Bağırsak Bariyerinin Bozulmasının Araştırılması

Organoids and three-dimensional (3D) cell cultures allow the investigation of complex biological mechanisms and regulations in vitro, which previously was ...

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing enterocolitis (NEC). However, a mechanistic link between these two conditions remains yet to be discovered. We have adopted a murine model of chorioamnionitis involving lipopolysaccharide (LPS)-induced fetal exposure to maternal inflammation (FEMI). This model of FEMI induces a sterile maternal, placental, and fetal inflammatory cascade, which is also present in many cases of clinical chorioamnionitis. Although models exist that utilize live bacteria and more accurately mimic the pathophysiology of an ascending infection resulting in chorioamnionitis, these methods may cause indirect effects on development of the immature intestinal tract and the associated developing microbiome. Using this protocol, we have demonstrated that LPS-induced FEMI results in a dose-dependent increase in pregnancy loss and preterm birth, as well as disruption of normal intestinal development in offspring. Further, we have demonstrated that FEMI significantly increases intestinal injury and serum cytokines in offspring, while simultaneously decreasing goblet and Paneth cells, both of which provide a first line of innate immunity against intestinal inflammation. Although a similar model of LPS-induced FEMI has been used to model the association between chorioamnionitis and subsequent abnormalities of the central nervous system, to our knowledge, this protocol is the first to attempt to elucidate a mechanistic link between chorioamnionitis and later perturbations in intestinal development as a potential link between chorioamnionitis and NEC.

We developed a model of chorioamnionitis to simulate fetal exposure to maternal inflammation (FEMI) without complications of live organisms to examine the effects of FEMI on development of the offspring&#8217;s intestinal tract. This allows for study of mechanistic causes for development of intestinal injury following chorioamnionitis.