Name: analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach
Uploaded: 2017-03-12T15:00:00.000+00:00
Duration: 12 min 12 s
Description: Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Research in Ansari lab was supported by the research grant (No. MCB 1020911) from National Science Foundation.

Not: Bu yöntem Medler, S ve Ansari, A. 2&#39;de bildirilen araştırma makalesinde kullanılmıştır. 1. Kültürleme ve Hasat Hücreler <ol><li> Yeni boyanmış bir Saccharomyces cerevisiae plakadan YPD ortamında (10 g / L maya ekstresi, 20 g / L pepton,% 2 dekstroz) hücre 5 ml&#39;lik bir kültürden başlatın. </li><li> 30 ° C ve 250 rpm&#39;de bir orbital çalkalayıcı içinde gece boyunca hücrelerin büyütün. </li><li> 250 mL&#39;lik bölmeli bir şişe içerisinde gece boyunca büyütülmüş kültürden YPD ortamı içinde 100 ml&#39;lik bir nihai hacme 100 kez seyreltilir. Not: kültür, 100 mL toplam TRO reaksiyon başına gerekli olan; Birden reaksiyonlar gerektiği takdirde, kültür daha büyük bir hacim kullanılmalıdır. </li><li> 0.8 bir optik yoğunluğa kadar hücreler büyümek - 1.0, 600 nm (600 ~ 0,8-1,0). </li><li> Bir steril 50 ml konik bir tüp içinde, 4 ° C&#39;de 5 dakika boyunca 820 x g&#39;de santrifüj ile hücreler hasat edilir. </li><li> buz TMN met 10 mL hücrelerin yeniden süspanseffer (10 mM Tris-HCI pH 7.5, 5 mM MgCl2, 100 mM NaCI) ve 5 dakika boyunca buz üzerinde inkübe edilir. </li><li> 4 ° C&#39;de 5 dakika boyunca 820 x g&#39;de santrifüj pelet hücreleri. Yavaşça aspirasyon ile süpernatantı kaldırmak. </li></ol> Deney çalışma üzerinde 2. permeabilizing ve hazırlanması Hücreler <ol><li> Yukarı ve aşağı pipetleme hafifçe kesilmiş bir P 1000 ucunu kullanarak% 0.6 sarkosil solüsyonu 1 ml hücrelerin tekrar. soğutulmuş bir 1.5 mL mikrosantrifüj tüpüne hücre süspansiyonu aktarın. </li><li> bir çalkalama platformunda 25 dakika boyunca 4 ° C &#39;de yavaşça hücreler çalkalayın. Not: mikrosantrifüj tüpleri bu aşamada promoteri meydana gelen yeni bir başlatma olaylarına olma olasılığı önlenmiş olur, soğuk sıcaklık korumak için buz ile 50 ml konik bir tüp içine paketlenmiş olmalıdır. </li><li> Bir masa soğutmalı santrifüj kullanılarak 4 ° C&#39;de 6 dakika boyunca 1200 x g&#39;de santrifüjleyin hücreleri. </li><li> Yavaşça per fazla suyu çıkarmak için süpernatant aspiremeabilized hücre topağı. </li></ol> 3. Transkripsiyon Run-on Tepki <ol><li> Transkripsiyon 150 mcL çalışma tampon çözelti (50 mM Tris-HCI pH 7.5, 100 mM KCI, 10 mM MgCl2, 2 mM DTT (ditiyotreitol), 0.75 mM ATP, CTP, GTP ve BrUTP, 200 U RNaz her permeabilize hücre pelletine inhibitörü). </li><li> Yukarı pipetleme ve kesik P 200 ucunu kullanarak aşağı yavaşça karıştırın. NOT: Birden fazla numune işleme, tüm numuneler hazır olana kadar buz üzerinde her şeyi tutmak ve sonra bir sonraki adıma geçin. </li><li> Bir su banyosu içinde 30 ° C&#39;de 5 dakika süreyle inkübe edilir. Not: olgunlaşmamış RNA&#39;ya BrUTP optimum dahil edilmesini sağlamak için 1 ila 5 dak arasında fırınlama süresi ayarlayın. </li><li> Soğuk hazır kullanım RNA izolasyon reaktif 500 uL ilave ederek reaksiyonu durdurun. Oda sıcaklığında 5 dakika süreyle inkübe edilir. </li></ol> 4. RNA Ekstraksiyon <ol><li> Hücre suspensi için asitle yıkanmış cam boncuklar 200 uL ekleyin(3.4 adım a) ve vorteks karıştırıcıda 4 ° C&#39;de 20 dakika boyunca kuvvetli bir şekilde çalkalanır ilgili. </li><li> Sıcak 22 G iğne kullanılarak mikrosantrifüj tüpü alt delme ve 15 ml steril konik tüp üzerine yerleştirin. </li><li> 4 ° C&#39;de 1 dakika boyunca 300 x g&#39;de santrifüjleyin hücre lizatı toplamak. 1.5 ml mikrosantrifüj tüpüne hücre lizat aktarın. </li><li> Soğuk RNA izolasyon reaktif 500 ul hücre lisatı kloroform 200 uL ekleyin. 4 ° C&#39;de 20 dakika boyunca 16.168 x g&#39;de vorteksli bir mikserde ve santrifüj içeriğini karıştırın. </li><li> Yeni bir mikrosantrifüj tüpü, üst sulu faz transfer. </li><li> pH 4-5 izoamil alkol / (: 24: 1 125), soğuk fenol / kloroform eşit hacim. 4 ° C&#39;de 15 dakika boyunca 16.168 x g&#39;de vorteksli bir mikserde ve santrifüj ile kuvvetli bir şekilde çalkalanır. </li><li> Yeni bir mikrosantrifüj tüpü, üst sulu faz ihtiva eden RNA aktarın. Adımı yineleyin 4.6 iki kez daha. </li><li> Nihai RNA içeren sulu faz için, 5 M NaCI stoc ekleme0.3 M bir son konsantrasyon RNA çökeltilmesi için 3 kez soğuk etanol hacim kazandırmak için k. <ol><li> 1 saat veya gece -20 ° C&#39;de inkübe edin. NOT: - anti-BrdU boncuklar (adım 5.3) engelleme inkübe edilirken 4.11 adımları 4.9 gerçekleştirin. </li></ol></li><li> 4 ° C&#39;de 20 dakika boyunca 16.168 x g&#39;de santrifüjleyin. Süpernatantı ve DEPC (diethylpyrocarbonate) su 100 ul RNA pelletini. </li><li> unincorporated BrUTP nükleotidlerden RNA ayırmak için bir RNA izolasyonu, mini kiti kullanın. RNaz içermeyen su, 100 uL ile kolondan RNA Zehir. </li><li> 5 dakika için 65 ° C su banyosu içinde RNA inkübe ve daha sonra en az 2 dakika süreyle buza transfer. </li></ol> BrUTP etiketli RNA 5. Affinity Arıtma <ol><li> 25 mcL anti-BrdU ekleyin, boncuk yerleşti 500 0.25X SSPE (Sodyum Salin Fosfat EDTA) bağlayıcı tampon (20x SSPE uL: 3 M NaCl, 0.2 M NaH 2 PO 4 </sub&gt;, 0.02 M EDTA, pH 7.4, 1 mM EDTA,% 0.05 Tween, 37.5 mM NaCI). 4 ° C sıcaklıkta 30 saniye boyunca 200 xg&#39;de santrifüj ve supernatant çıkarın. </li><li> Adımı yineleyin 5.1 üç kez. </li><li> tanelerine (1 mg ultra saf sığır serum albümini (BSA) tampon,% 0.1 polivinilpirolidon, 1 x bağlama) blokaj tamponu içinde 500 ul ilave edin ve yavaşça 1 çalkalayın - bir çalkalama platformunda 4 ° C&#39;de, 2 saat. </li><li> Adım 5.1&#39;de tarif edildiği gibi, bağlama tamponu, 500 uL boncuk iki kez daha yıkanır. </li><li> tanelere bağlayıcı tampon 400 ul ekle. </li><li> boncuk doğrudan (adım 4.11 itibaren) RNA 100 uL aktarın. bir çalkalama platformunda 4 ° C&#39;de 2 saat - yumuşak 1 çalkalayarak kuluçkalayın. </li><li> bağlama tamponu, 500 uL, düşük tuz tamponu 500 uL (0.2x SSPE, 1 mM EDTA,% 0.05 Tween), yüksek tuz tamponu 500 uL (0.25X SSPE, 1 mM EDTA,% 0.05 Tween ile boncuk birbiri ardına yıkandı, 100 mM NaCI) ve iki kez TET tampon 500 uL (1X TE,% 0.05 Tween), sıkma ileHer yıkama arasında 4 ° C sıcaklıkta 30 saniye boyunca 200 x g. </li><li> 150 ul iki kez sıralı boncuklardan BrUTP etiketli RNA Zehir ve bir kez yıkama tamponu (20 mM DTT, 150 mM NaCI, 50 mM Tris-HCI pH 7.5, 1 mM EDTA,% 0.1 SDS), 200 ul, inkübe edilerek süpernatandan boncuk ayırmak için kısa bir sıkma ve ardından bir su banyosu içinde 42 ° C &#39;de 4 dakika karıştırıldı. </li></ol> BrUTP Etiketli RNA 6. Yağış <ol><li> izoamil alkol / soğuk fenol / kloroform, 500 uL ekleyin (: 24: 125 1), pH 4 - 5 BrUTP saflaştınldı afinite RNA etiketli. 4 ° C&#39;de 15 dakika boyunca 16.168 x g&#39;de vorteksli bir mikserde ve santrifüj ile karıştırın. </li><li> Yeni bir mikrosantrifüj tüpü, üst sulu faz transfer. </li><li> RNA çökeltilmesi için soğuk etanol, 0.3 M 3 kez hacimli bir son konsantrasyon elde etmek için 5 M NaCI stok ekleyin. </li><li> -20 ° C sıcaklıkta gece boyunca inkübe edilir. </li><li> 4 ° C&#39;de 30 dakika boyunca 16.168 x g&#39;de santrifüje edilerek çöktürüldü RNA toplayın. &lt;/ Li&gt; <li> Süpernatantı ve 10 dakika boyunca havada kurumaya pelet izin verir. </li><li> DEPC su 26 uL RNA pelletini. </li><li> bir spektrofotometre kullanılarak 260 nm&#39;de absorbans ölçülerek son RNA konsantrasyonunun belirlenmesi. Ayrıca, 260/280 oranını belirlemek. A oranı yaklaşık 2 saf RNA numunesinin bir göstergesidir. </li><li> cDNA sentezi için gerekli olana kadar -80 ° C &#39;de parçalar halinde RNA örnekleri saklayın. </li></ol> BrUTP etiketli RNA 7. Arka Transkripsiyon <ol><li> 100 ng RNA konsantrasyonu ayarlama / uL DEPC su ile. Her cDNA sentez reaksiyonu için RNA, 0.5 ug kullanın. Not: RNA şablonu konsantrasyonunun uygun cDNA sentezi elde etmek için 0.5 ile 1.0 ug değişebilir. </li><li> Şekil 3A&#39;da gösterildiği gibi, aşağı doğru poli (A) alanı (sonlanma) tasarlanmış çok sayıda ters primerleri kullanılarak RNA nın ters transkripsiyonunu. </li><li> Her bir ters transkripsiyon reaksiyonu için RNA templat ul 5 eklemeE (0.5 ug), 1 pL dNTP karışımı (her biri 10 mM), revers primer C, D, E, F ya da G&#39;nin 2 uL (50 uM her biri) ve nükleaz serbest su (Şekil 3A). Her bir tüp içinde son reaksiyon hacmi 13 ml. Not: Ters transkripsiyon reaksiyonları sayısı cDNA sentezi için kullanılan ters primer sayısına bağlıdır. Örneğin, ASC1 beş ters primerler kullanılmıştır ve bu nedenle, beş, ters transkripsiyon reaksiyonları kurulmuştur. cDNA sentezi için kullanılan ters primer temelinde C, D, E, F ve G gibi bir tüp etiketleyin. </li><li> Herhangi bir ikincil yapısal yapıyı çıkarmak için 5 dakika boyunca 65 ° C sıcaklıkta bir PCR RNA şablonu, dNTP karışımı ve primerler ihtiva eden tüpler inkübe ve en az 2 dakika süreyle 4 ° C&#39;ye kadar soğutulur. </li><li> 1 pL transkriptazı (200 U / ml) ters ekleme, 4 ul tampon ve RNA şablon ve primer ihtiva eden her tüpe 0.1 M DTT 2 uL (7.4 adım). yukarı ve aşağı hafifçe pipetleme karıştırın. </li><li> 60 dakika boyunca 42 ° C &#39;de bir PCR reaksiyon karışımı inkübe edilerek ters transkripsiyon gerçekleştirin. </li><li> 20 dakika boyunca, 65 ° C&#39;de ters transkriptaz inaktive. </li><li> -20 ° C&#39;de cDNA Mağaza ya da bir sonraki adıma geçin. </li></ol> cDNA 8. amplifikasyonu <ol><li> Aşama 7.8, 1.0 uL ileri primer B (10 uM), 1.0 ul den 3.0 uL cDNA şablonu aşağıdaki gibidir: Aşama 7.8 (ASC1 C, D, E, F ve G etiketli) Her cDNA hazırlanması amplifikasyonu için PCR reaksiyonunu gerçekleştirmek ters primer C veya D veya E veya F veya G (10 uM), 2.5 uL 10x polimeraz PCR tamponu, 0.5 uL dNTP karışımı (10 mM), 1.0 uL MgCl2 (2.5 mM), 15.5 pL PCR dereceli su ve 0.5 uL termostabil polimeraz enzimi. Not: 5 ila 1: 1 arasında değişen bir cDNA şablonu değişik seyreltileri 100 PCR ürünü verimini optimize etmek için test edilmelidir. Tek bir promotör-yakın ileri primer cDNA yı çoğaltmak için kullanılırFarklı geri primerler kullanılarak elde edilmiştir. Örneğin, promotör yakınındaki tek ileri primer B ASC1 G C beş ters primerler ile birlikte kullanılmıştır. BC, BD, Şekil 3A&#39;da gösterildiği gibi, BF ve BG, sırasıyla C, D, E, F ve G olarak işaretlenmiş tüplere kullanılmıştır, BE. </li><li> Aşağıdaki termal döngü parametreleri kullanılarak PCR çalışması: 1 döngü 2 dakika süreyle, 95 ° C (polimeraz aktivasyonu için sıcak başlangıç), 30-40 döngü 30 saniye (cinsini değiştirme), 15 saniye için 54 ° C, 95 ° C (tavlama) 1 dakika (uzatma) ve 1 devir 5 dakika için 68 ° C (son uzatma) için 68 ° C&#39;dir. Not: bağlanma sıcaklığı kullanılan özel primerler bağlı olarak değişir ve uzatma süresi Beklenen ürün boyutuna bağlı olarak değişir. </li><li> % 0.8,% 1.5 ya da ürünün beklenen boyutuna bağlı olarak% 2 agaroz jelleri üzerinde elektroforez ile PCR ürünü ayırın. </li><li> El kaderi ve diğerleri de tarif edildiği gibi bir PCR ürünü ölçmek. 2012 11. NOT: Alternatif olarak, doğmakta olan transkript miktarını ölçmek için gerçek zamanlı RT-qPCR stratejisini kullanın. </li></ol>

<ol>
	<li>Birse, C. E., Minvielle-Sebastia, L., Lee, B. A., Keller, W., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coupling+termination+of+transcription+to+messenger+RNA+maturation+in+yeast.">Coupling termination of transcription to messenger RNA maturation in yeast.</a> Science. 280 (5361), 298-301 (1998).</li><li>Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+looping+facilitates+TFIIH+kinase-mediated+termination+of+transcription.">Gene looping facilitates TFIIH kinase-mediated termination of transcription.</a> Sci Rep. 5, 12586 (2015).</li><li>Richard, P., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+by+nuclear+RNA+polymerases.">Transcription termination by nuclear RNA polymerases.</a> Genes Dev. 23 (11), 1247-1269 (2009).</li><li>Mischo, H. E., Proudfoot, N. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disengaging+polymerase:+terminating+RNA+polymerase+II+transcription+in+budding+yeast.">Disengaging polymerase: terminating RNA polymerase II transcription in budding yeast.</a> Biochim Biophys Acta. 1829 (1), 174-185 (2013).</li><li>Porrua, O., Libri, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+termination+and+the+control+of+the+transcriptome:+why,+where+and+how+to+stop.">Transcription termination and the control of the transcriptome: why, where and how to stop.</a> Nat Rev Mol Cell Biol. 16 (3), 190-202 (2015).</li><li>Jacquier, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+complex+eukaryotic+transcriptome:+unexpected+pervasive+transcription+and+novel+small+RNAs.">The complex eukaryotic transcriptome: unexpected pervasive transcription and novel small RNAs.</a> Nat Rev Genet. 10 (12), 833-844 (2009).</li><li>Xu, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bidirectional+promoters+generate+pervasive+transcription+in+yeast.">Bidirectional promoters generate pervasive transcription in yeast.</a> Nature. 457 (7232), 1033-1037 (2009).</li><li>Neil, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Widespread+bidirectional+promoters+are+the+major+source+of+cryptic+transcripts+in+yeast.">Widespread bidirectional promoters are the major source of cryptic transcripts in yeast.</a> Nature. 457 (7232), 1038-1042 (2009).</li><li>Clark, M. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+reality+of+pervasive+transcription.">The reality of pervasive transcription.</a> PLoS Biol. 9 (7), e1000625 (2011).</li><li>Goodman, A. J., Daugharthy, E. R., Kim, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pervasive+antisense+transcription+is+evolutionarily+conserved+in+budding+yeast.">Pervasive antisense transcription is evolutionarily conserved in budding yeast.</a> Mol Biol Evol. 30 (2), 409-421 (2013).</li><li>El Kaderi, B., Medler, S., Ansari, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+interactions+between+genomic+loci+through+Chromosome+Conformation+Capture+(3C).">Analysis of interactions between genomic loci through Chromosome Conformation Capture (3C).</a> Curr Protoc Cell Biol. Chapter 22, Unit22 15 (2012).</li><li>Core, L. J., Waterfall, J. J., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nascent+RNA+sequencing+reveals+widespread+pausing+and+divergent+initiation+at+human+promoters.">Nascent RNA sequencing reveals widespread pausing and divergent initiation at human promoters.</a> Science. 322 (5909), 1845-1848 (2008).</li></ol>

The authors have nothing to disclose.

Burada kullanılan iplikçik özgü TRO protokolü memeli hücrelerinde 12 Gro-Sek (Global Run On-Sıralama) analiz için kullanılan protokol uyarlanmıştır. Biz başarıyla maya tomurcuklanan doğmakta olan transkripsiyonu incelemek için protokol güncellenmiştir. Özellikle transkripsiyon sonlandırma kusur analiz etmek, biz RNA hidroliz adımı kurtularak daha protokolü ayarlanır. Bu bize özellikle promotör bölgenin yakınında transkripsiyon başlangıç ​​sitesinden başlatıla...

Ökaryotik transkripsiyon döngüsü üç ana adımdan oluşur; başlatma, uzama ve sonlanma. RNA polimeraz II transkripsiyonun sonlandırılması, iki farklı, birbirine Adım 3 oluşur. İlk adım, şablondan ayrılması, poliadenilasyonu ve mRNA&#39;nm salınmasını içerir ve hemen şablondan polimerazın ayrılma ile işaretlenmiş, ikinci aşama takip eder. Uygun sonlandırma ve RNA 4, 5 kodlayıcı olmayan yaygın transkripsiyonunu sınırlayarak kontrol anormal transkripsiyonu tutmak için aşağı genlerin transkripsiyonu müdahaleyi önlemek için, transkripsiyon başlama / yeniden başlatılması sırasında polimeraz geri dönüşümü için hayati önem taşımaktadır. Son gelişmelere rağmen, fesih RNA polimeraz II transkripsiyon döngüsü çok az anlaşılan adım olduğunu. Güvenilir bir sonlandırma tahlil mekanizmasını underlyin eğitim için gerekli olanin vivo RNA polimeraz II tarafından transkripsiyon g sonlandırma. Deneysel bir kısım yaklaşımlar, fizyolojik koşullar altında, bir aktif transkripsiyonu gen sonlandırma kusuru tespit etmek için kullanılır. Bunlar, Kuzey benek, fesih faktörü ChIP (Kromatin Immunoprecipitation) ve geleneksel TRO deneyini içerirler. Bu tekniklerin her biri bazı avantajları ve dezavantajları vardır. Kullanılan geleneksel TRO deney in vivo 1 bir transkripsiyon sonlandırma kusur tespiti için en güvenilir ve hassas bir yaklaşım olarak. Bu tahlil hücre içinde bir genin farklı bölgelerde transkripsiyonel olarak aktif polimeraz molekülleri lokalize. Normal koşullar altında, deney katı geni (Şekil 1A) promoter ve terminatör bölgesi arasında dağıtıldı transkripsiyonel kavranan polimeraz molekülleri gösterir. kusurlu sona ermesi üzerine, ancak, polimeraz sonlandırma sinyali okuyamıyorve gen (Şekil 1B) 3 &#39;ucunun alt baş bölgesinde saptanır. Bir transkripsiyon sonlandırma kusur promotör yakın bölgeden başlatılan duyu-transkripsiyon polimeraz mevcudiyetinde ortaya ve sonlandırma sinyali Okuyamamak olup, Şekil &#39;de gösterildiği gibi, bir genin 3&#39; ucunun alt baş bölgesi transkripsiyonu devam Şekil 2A. Genom ve bir genin 6, 7, 8, 9, 10 civarında ezici yaygın anlamda transkripsiyonu yanı sıra anti-sens yön gösteren gerçekleştirilmesi, yakında geleneksel TRO tahlil algılayamaz belli oldu polimeraz sinyali ise bir genin bir teşvikçinin akış aşağısına başlatılan transkript (Şekil 2A) ya da som başlatılan anormal RNA temsilbir gen ya da terminatör elemanı (Şekil 2B) ya da genin (Şekil 2C) 3 &#39;anti-sens yönünde polimeraz transkripsiyonu alt baş ortasına ewhere. gözlenen okuma domeyni polimeraz sinyal yükseltici tarafından başlatılan uzun sens mRNA veya inceleme konusu genin alt başlatılan bir anti-sens transkripti temsil ediyorsa kullanılarak BrUTP burada açıklanan şerit spesifik TRO deney ayırt edebilir. Biz başarıyla maya 2 tomurcuklanan transkripsiyon sonlandırılmasında Kin28 kinaz rolünü göstermek için bu yaklaşımı kullandık. Burada bir yaklaşımı uygulamak suretiyle Biz Rna14 maya tomurcuklanmasına ASC1 transkripsiyon sonlandırma için gerekli olduğunu göstermektedir.

<table><tbody><tr><td>Phenol-chloroform-isoamyl alcohol mixture</td><td>Sigma-Aldrich</td><td>77619</td><td>pH 4-5</td></tr><tr><td>TRIzol reagent</td><td>Life technologies</td><td>15596-026</td><td></td></tr><tr><td>RNase Inhibitor, human placenta</td><td>New England Biolabs</td><td>M0307S</td><td></td></tr><tr><td>Anti-BrdU beads</td><td>Santa Cruz Biotechnology</td><td>sc-32323AC</td><td></td></tr><tr><td>Protoscript II</td><td>New England Biolabs</td><td>M03368L</td><td>or an equivalent enzyme</td></tr><tr><td>Advantage 2 polymerase Mix</td><td>Clontech</td><td>639201</td><td>or an equivalent enzyme</td></tr><tr><td>5-Bromouridine 5&#039; triphosphate sodium salt</td><td>Santa Cruz Biotechnology</td><td>sc-214314A</td><td></td></tr><tr><td>RNeasy Mini kit</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>ATP</td><td>New England Biolabs</td><td>N0451AA</td><td></td></tr><tr><td>CTP</td><td></td><td>N0454AA</td><td></td></tr><tr><td>GTP</td><td></td><td>N0452AA</td><td></td></tr><tr><td>Ultra-pure bovine serum albumin (BSA)</td><td>MC Labs</td><td>UBSA-100</td><td></td></tr><tr><td>Asc1 B</td><td></td><td></td><td>AGATTCGTCGGTCACAAGTCC</td></tr><tr><td>Asc1 C</td><td></td><td></td><td>GAACTTTATACATATTCTTAGTT&lt;br/&gt; AGCAGTC</td></tr><tr><td>Asc1 D</td><td></td><td></td><td>TGTACATATGTATTTTCGCAGCA</td></tr><tr><td>Asc1 E</td><td></td><td></td><td>GCCAAGGAGACTGAATTTAATG</td></tr><tr><td>Asc1 F</td><td></td><td></td><td>CTATGGAATGGGGGTTTTAAG</td></tr><tr><td>Asc1 G</td><td></td><td></td><td>GGTTATGGCAGACATGCCAC</td></tr><tr><td>5s cDNA</td><td></td><td></td><td>AGATTGCAGCACCTGAGT</td></tr><tr><td>5&amp;rsquo; 5s reverse</td><td></td><td></td><td>GGTTGCGGCCATATCTAC</td></tr><tr><td>3&amp;rsquo; 5s reverse</td><td></td><td></td><td>TGAGTTTCGCGTATGGTC</td></tr></tbody></table>

analysis of termination of transcription using brutp-strand-specific transcription run-on (tro) approach

Bu el yazması in vivo transkripsiyon sonlandırma kusuru tespit etmek için bir protokol tanımlamaktadır. kullanarak BrUTP Burada anlatılan iplikçik özgü TRO protokolü fizyolojik koşullar altında transkripsiyon sonlandırma kusuru analiz etmek için güçlü bir deneysel yaklaşımdır. Geleneksel TRO tahlilinde olduğu gibi, bir transkripsiyon sonlandırma kusuru 1 bir göstergesi olarak genin 3 &#39;ucunun ötesine, transkripsiyonal olarak aktif polimeraz varlığına dayanır. Geleneksel TRO testi ile karşılaştı iki büyük sorunlar üstesinden gelir. Birincisi, bu sonlandırma sinyalleri aracılığıyla okuma polimeraz promotör-proksimal bölgeden transkripsiyonu başlatılan biridir olmadığını algılamak, ya da basitçe bir yerde vücutta gelen non-spesifik olarak başlatılan yaygın bir transkripsiyonu polimeraz ya da 3 &#39;temsil eğer genin sonu. İkinci olarak, ayırt eğer ötesinde transkripsiyonel olarak aktif polimeraz sinyalisonlandırıcı bölge gerçek okuma domeyni sens mRNA transkripsiyonu polimeraz ya da bir terminatör başlatılan kodlayıcı olmayan anti-sens RNA sinyalidir. Kısaca, protokol, katlanarak büyüyen maya hücrelerini geçirimli afinite yaklaşımla BrUTP etiketli RNA saflaştırılması, BrUTP nükleotid mevcudiyetinde ince uzun in vivo olarak başlatılan transkript izin içerir saflaştırılmış Yeni oluşan RNA transkripsiyonu ve cDNA amplifiye kullanılarak ters promoteri ve gen 2&#39;nin sonlandırıcı bölgeleri çevreleyen tel-spesifik primerler.

Bir transkripsiyon sonlandırma kusur tespit BrUTP iplikli spesifik TRO prosedürü uygulanabilirliğini göstermek için, RNA14 bir sonlandırma arızalı, sıcaklığa duyarlı bir mutant rna14-1 adı kullanılır. RNA polimeraz II, transkripsiyon sona erdirilmesi Rna14 rolü seçilen gen 1 terminatör-proksimal bölgesinde RNA tespit geleneksel TRO tahlili kullanılarak ortaya çıkartılmıştır. Permisif olmayan sıcaklıkta rna14-1</em...

Watch this Scientific Journal Video about Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach at JoVE.com

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes.

BrUTP iplikli özgü Transkripsiyon Run-on (TRO) Yaklaşımı ile Transkripsiyon Feshi Analizi

This manuscript describes a protocol for detecting transcription termination defect in vivo. The strand-specific TRO protocol using BrUTP described here ...

analysis-termination-transcription-using-brutp-strand-specific

Research

JoVE Journal

Genetics

Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on (TRO) Approach

9.8K Görüntüleme.  Wayne State University. We describe a basic experimental approach for analysis of termination of transcription by RNA polymerase II in vivo using BrUTP by the strand-specific transcription run-on (TRO) approach in budding yeast. This protocol can be extended to study transcription termination by other RNA polymerases both in yeast and higher eukaryotes. 

Video: Analysis of Termination of Transcription Using BrUTP-strand-specific Transcription Run-on TRO Approach

Real-time Analysis of Transcription Factor Binding, Transcription, Translation, and Turnover to Display Global Events During Cellular Activation

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for example, during cellular differentiation, morphogenesis, and functional stimulation (such as activation of immune cells), or after exposure to drugs and other factors from the local environment. Depending on the stimulus and cell type, these changes occur rapidly and at any possible level of gene regulation. Displaying all molecular processes of a responding cell to a certain type of stimulus/drug is one of the hardest tasks in molecular biology. Here, we describe a protocol that enables the simultaneous analysis of multiple layers of gene regulation. We compare, in particular, transcription factor binding (Chromatin-immunoprecipitation-sequencing (ChIP-seq)), de novo transcription (4-thiouridine-sequencing (4sU-seq)), mRNA processing, and turnover as well as translation (ribosome profiling). By combining these methods, it is possible to display a detailed and genome-wide course of action.
Sequencing newly transcribed RNA is especially recommended when analyzing rapidly adapting or changing systems, since this depicts the transcriptional activity of all genes during the time of 4sU exposure (irrespective of whether they are up- or downregulated). The combinatorial use of total RNA-seq and ribosome profiling additionally allows the calculation of RNA turnover and translation rates. Bioinformatic analysis of high-throughput sequencing results allows for many means for analysis and interpretation of the data. The generated data also enables tracking co-transcriptional and alternative splicing, just to mention a few possible outcomes.
The combined approach described here can be applied for different model organisms or cell types, including primary cells. Furthermore, we provide detailed protocols for each method used, including quality controls, and discuss potential problems and pitfalls.

This protocol describes the combinatorial use of ChIP-seq, 4sU-seq, total RNA-seq, and ribosome profiling for cell lines and primary cells. It enables tracking changes in transcription-factor binding, de novo transcription, RNA processing, turnover and translation over time, and displaying the overall course of events in activated and/or rapidly changing cells.

Gerçek zamanlı analiz bağlama, transkripsiyon, çeviri ve ciro hücresel etkinleştirme sırasında küresel olayları görüntülemek üzere transkripsiyon faktörü

Upon activation, cells rapidly change their functional programs and, thereby, their gene expression profile. Massive changes in gene expression occur, for ...

Genetik

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation of protein synthesis is the key to cellular stress-response, and dysregulation is central to many disease states, such as cancer. For instance, although cellular stress leads to the inhibition of global translation by attenuating cap-dependent initiation, certain stress-response proteins are selectively translated in a cap-independent manner. Discreet RNA regulatory elements, such as cellular internal ribosome entry sites (IRESes), allow for the translation of these specific mRNAs. Identification of such mRNAs, and the characterization of their regulatory mechanisms, have been a key area in molecular biology. Toeprinting is a method for the study of RNA structure and function as it pertains to translation initiation. The goal of toeprinting is to assess the ability of in vitro transcribed RNA to form stable complexes with ribosomes under a variety of conditions, in order to determine which sequences, structural elements, or accessory factors are involved in ribosome binding&#8212;a pre-cursor for efficient translation initiation. Alongside other techniques, such as western analysis and polysome profiling, toeprinting allows for a robust characterization of mechanisms for the regulation of translation initiation.

Toeprinting aims to measure the ability of in vitro transcribed RNA to form translation initiation complexes with ribosomes under a variety of conditions. This protocol describes a method for toeprinting mammalian RNA and can be used to study both cap-dependent and IRES-driven translation.

Çeviri başlatma karmaşık oluşumu memeli mRNA'ların Toeprinting analizi

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

Biyokimya

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA polymerase II and co-transcriptional capping and splicing of the precursor RNA to form the mature mRNA. During mRNA synthesis, the RNA polymerase II elongation complex is a target for regulation by a large collection of transcription factors that control its catalytic activity, as well as the capping, splicing, and 3&#8217;-processing enzymes that create the mature mRNA. Because of the inherent complexity of mRNA synthesis, simpler experimental systems enabling isolation and investigation of its various co-transcriptional stages have great utility.
In this article, we describe one such simple experimental system suitable for investigating co-transcriptional RNA capping. This system relies on defined RNA polymerase II elongation complexes assembled from purified polymerase and artificial transcription bubbles. When immobilized via biotinylated DNA, these RNA polymerase II elongation complexes provide an easily manipulable tool for dissecting co-transcriptional RNA capping and mechanisms by which the elongation complex recruits and regulates capping enzyme during co-transcriptional RNA capping. We anticipate this system could be adapted for studying recruitment and/or assembly of proteins or protein complexes with roles in other stages of mRNA maturation coupled to the RNA polymerase II elongation complex.

Here, we describe the assembly of RNA polymerase II (Pol II) elongation complexes requiring only short synthetic DNA and RNA oligonucleotides and purified Pol II. These complexes are useful for studying mechanisms underlying co-transcriptional processing of transcripts associated with the Pol II elongation complex.

Diseksiyon eş transkripsiyon RNA Işleme etkinlikleri için suni RNA polimeraz II uzama kompleksler

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

Mapping the Structure-Function Relationships of Disordered Oncogenic Transcription Factors Using Transcriptomic Analysis

Many cancers are characterized by chromosomal translocations which result in the expression of oncogenic fusion transcription factors. Typically, these proteins contain an intrinsically disordered domain (IDD) fused with the DNA-binding domain (DBD) of another protein and orchestrate widespread transcriptional changes to promote malignancy. These fusions are often the sole recurring genomic aberration in the cancers they cause, making them attractive therapeutic targets. However, targeting oncogenic transcription factors requires a better understanding of the mechanistic role that low-complexity, IDDs play in their function. The N-terminal domain of EWSR1 is an IDD involved in a variety of oncogenic fusion transcription factors, including EWS/FLI, EWS/ATF, and EWS/WT1. Here, we use RNA-sequencing to investigate the structural features of the EWS domain important for transcriptional function of EWS/FLI in Ewing sarcoma. First shRNA-mediated depletion of the endogenous fusion from Ewing sarcoma cells paired with ectopic expression of a variety of EWS-mutant constructs is performed. Then RNA-sequencing is used to analyze the transcriptomes of cells expressing these constructs to characterize the functional deficits associated with mutations in the EWS domain. By integrating the transcriptomic analyses with previously published information about EWS/FLI DNA binding motifs, and genomic localization, as well as functional assays for transforming ability, we were able to identify structural features of EWS/FLI important for oncogenesis and define a novel set of EWS/FLI target genes critical for Ewing sarcoma. This paper demonstrates the use of RNA-sequencing as a method to map the structure-function relationship of the intrinsically disordered domain of oncogenic transcription factors.

Intrinsically disordered domains are important for oncogenic fusion transcription factor function. To therapeutically target these proteins, a more detailed understanding of the regulatory mechanisms employed by these domains is required. Here, we use transcriptomics to map important structural features of the intrinsically disordered EWS domain in Ewing sarcoma.

Transcriptomik Analiz Kullanarak Düzensiz Onkojenik Transkripsiyon Faktörlerinin Yapı-fonksiyon İlişkilerinin Eşlenmesini

Many cancers are characterized by chromosomal translocations which result in the expression of oncogenic fusion transcription factors. Typically, these ...

Kanser Araştırmaları

A Rapid High-throughput Method for Mapping Ribonucleoproteins (RNPs) on Human pre-mRNA

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding location often influences function of a splicing factor.  However, as with any sampling strategy the chance of identifying an RNA bound to a splicing factor is proportional to its cellular abundance.  We have developed a novel in vitro approach for surveying binding specificity on otherwise transient pre-mRNA. This approach utilizes a specifically designed oligonucleotide pool that tiles across introns, exons, splice junctions, or other pre-mRNA.  The pool is subjected to some kind of molecular selection. Here, we demonstrate the method by separating the oligonucleotide into a bound and unbound fraction and utilize a two color array strategy to record the enrichment of each oligonucleotide in the bound fraction. The array data generates high-resolution maps with the ability to identify sequence-specific and structural determinates of ribonucleoprotein (RNP) binding on pre-mRNA.  A unique advantage to this method is its ability to avoid the sampling bias towards mRNA associated with current IP and SELEX techniques, as the pool is specifically designed and synthesized from pre-mRNA sequence. The flexibility of the oligonucleotide pool is another advantage since the experimenter chooses which regions to study and tile across, tailoring the pool to their individual needs.  Using this technique, one can assay the effects of polymorphisms or mutations on binding on a large scale or clone the library into a functional splicing reporter and identify oligonucleotides that are enriched in the included fraction.  This novel in vitro high-resolution mapping scheme provides a unique way to study RNP interactions with transient pre-mRNA species, whose low abundance makes them difficult to study with current in vivo techniques.  



A Rapid High-throughput Method for Mapping Ribonucleoproteins RNPs on Human pre-mRNA

Due to the transient nature of pre-mRNA, it can be difficult to isolate and study in vivo. Here, we present a novel in vitro approach to investigate RNA-protein interactions using a synthetic oligo pool that tiles across selected regions of pre-mRNA.

İnsan pre-mRNA üzerinde Haritalama Ribonucleoproteins Hızlı Yüksek verim için Yöntemi (RNPs)

Sequencing RNAs that co-immunoprecipitate (co-IP) with RNA binding proteins has increased our understanding of splicing by demonstrating that binding ...

Biyoloji

PAR-CliP - A Method to Identify Transcriptome-wide the Binding Sites of RNA Binding Proteins

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) that are often expressed in a cell-type dependently. To understand how the interplay of these RNA-binding factors affects the regulation of individual transcripts, high resolution maps of in vivo protein-RNA interactions are necessary1.
A combination of genetic, biochemical and computational approaches are typically applied to identify RNA-RBP or RNA-RNP interactions. Microarray profiling of RNAs associated with immunopurified RBPs (RIP-Chip)2 defines targets at a transcriptome level, but its application is limited to the characterization of kinetically stable interactions and only in rare cases3,4 allows to identify the RBP recognition element (RRE) within the long target RNA. More direct RBP target site information is obtained by combining in vivo UV crosslinking5,6 with immunoprecipitation7-9 followed by the isolation of crosslinked RNA segments and cDNA sequencing (CLIP)10. CLIP was used to identify targets of a number of RBPs11-17. However, CLIP is limited by the low efficiency of UV 254 nm RNA-protein crosslinking, and the location of the crosslink is not readily identifiable within the sequenced crosslinked fragments, making it difficult to separate UV-crosslinked target RNA segments from background non-crosslinked RNA fragments also present in the sample.
We developed a powerful cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs that we term PAR-CliP (Photoactivatable-Ribonucleoside-Enhanced Crosslinking and Immunoprecipitation) (see Fig. 1A for an outline of the method). The method relies on the incorporation of photoreactive ribonucleoside analogs, such as 4-thiouridine (4-SU) and 6-thioguanosine (6-SG) into nascent RNA transcripts by living cells. Irradiation of the cells by UV light of 365 nm induces efficient crosslinking of photoreactive nucleoside-labeled cellular RNAs to interacting RBPs. Immunoprecipitation of the RBP of interest is followed by isolation of the crosslinked and coimmunoprecipitated RNA. The isolated RNA is converted into a cDNA library and deep sequenced using Solexa technology. One characteristic feature of cDNA libraries prepared by PAR-CliP is that the precise position of crosslinking can be identified by mutations residing in the sequenced cDNA. When using 4-SU, crosslinked sequences thymidine to cytidine transition, whereas using 6-SG results in guanosine to adenosine mutations. The presence of the mutations in crosslinked sequences makes it possible to separate them from the background of sequences derived from abundant cellular RNAs.
Application of the method to a number of diverse RNA binding proteins was reported in Hafner et al.18

RNA transcripts are subject to extensive posttranscriptional regulation that is mediated by a multitude of trans-acting RNA-binding proteins (RBPs). Here we present a generalizable method to identify precisely and on a transcriptome-wide scale the RNA binding sites of RBPs.

PAR-Klip - RNA Cilt Proteinler Transcriptome geniş Cilt Siteleri Belirlemek Amacıyla Bir Yöntem

RNA transcripts are subjected to post-transcriptional gene regulation by interacting with hundreds of RNA-binding proteins (RBPs) and microRNA-containing ...

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

The 3&#8217; end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes precursor mRNA beyond the end of mature RNAs, and an active process of endonuclease activity is required at a specific site. Cleavage of the precursor RNA normally occurs 10-30 nt downstream from the consensus polyA site (AAUAAA) after the CA dinucleotides. Proteins from the cleavage complex, a multifactorial protein complex of approximately 800 kDa, accomplish this specific nuclease activity. Specific RNA sequences upstream and downstream of the polyA site control the recruitment of the cleavage complex. Immediately after cleavage, pre-mRNAs are polyadenylated by the polyA polymerase (PAP) to produce mature stable RNA messages.
Processing of the 3&#8217; end of an RNA transcript may be studied using cellular nuclear extracts with specific radiolabeled RNA substrates. In sum, a long 32P-labeled uncleaved precursor RNA is incubated with nuclear extracts in vitro, and cleavage is assessed by gel electrophoresis and autoradiography. When proper cleavage occurs, a shorter 5&#8217; cleaved product is detected and quantified. Here, we describe the cleavage assay in detail using, as an example, the 3&#8217; end processing of HIV-1 mRNAs.

Analysis of RNA Processing Reactions Using Cell Free Systems: 3' End Cleavage of Pre-mRNA Substrates in vitro

RNA polymerase II synthesizes a precursor RNA that extends beyond the 3' end of the mature mRNA. The end of the mature RNA is generated cotranscriptionally, at a site dictated by RNA sequences, via the endonuclease activity of the cleavage complex. Here, we detail the method to study cleavage reactions in vitro.

Pre-mRNA Substratlarm 3 &#39;End Bölünme: Hücre Ücretsiz Sistemlerini Kullanma RNA İşleme Reaksiyonları Analizi<em&gt; In vitro</em

The 3&#8217; end of mammalian mRNAs is not formed by abrupt termination of transcription by RNA polymerase II (RNPII). Instead, RNPII synthesizes ...

Fluorescence Based Primer Extension Technique to Determine Transcriptional Starting Points and Cleavage Sites of RNases In Vivo

Fluorescence based primer extension (FPE) is a molecular method to determine transcriptional starting points or processing sites of RNA molecules. This is achieved by reverse transcription of the RNA of interest using specific fluorescently labeled primers and subsequent analysis of the resulting cDNA fragments by denaturing polyacrylamide gel electrophoresis. Simultaneously, a traditional Sanger sequencing reaction is run on the gel to map the ends of the cDNA fragments to their exact corresponding bases. In contrast to 5&#39;-RACE (Rapid Amplification of cDNA Ends), where the product must be cloned and multiple candidates sequenced, the bulk of cDNA fragments generated by primer extension can be simultaneously detected in one gel run. In addition, the whole procedure (from reverse transcription to final analysis of the results) can be completed in one working day. By using fluorescently labeled primers, the use of hazardous radioactive isotope labeled reagents can be avoided and processing times are reduced as products can be detected during the electrophoresis procedure.
In the following protocol, we describe an in vivo fluorescent primer extension method to reliably and rapidly detect the 5&#39; ends of RNAs to deduce transcriptional starting points and RNA processing sites (e.g., by toxin-antitoxin system components) in S. aureus, E. coli and other bacteria.

Fluorescence Based Primer Extension Technique to Determine Transcriptional Starting Points and Cleavage Sites of RNases In Vivo

We here describe a fluorescence based primer extension method to determine transcriptional starting points from bacterial transcripts and RNA processing in vivo using an automated gel sequencer.

Floresan Bazlı Astar Uzatma Tekniği Transkripsiyonal Başlangıç ​​Noktalarını ve RNases yarılması Siteleri belirleme<em&gt; In Vivo</em

Fluorescence based primer extension (FPE) is a molecular method to determine transcriptional starting points or processing sites of RNA molecules. This is ...

Strand-Specific Analysis of Proteins at Replicating DNA Strands by Enrichment and Sequencing of Protein-Associated Nascent DNA Method

Genome duplication is orchestrated by replisome proteins, including helicases, which unwind double-stranded DNA into individual antiparallel single strands, each requiring distinct modes of replication: continuous (leading) and discontinuous (lagging). Understanding the interactions of chromatin-associated proteins with replicating DNA strands in vivo is crucial for elucidating the mechanisms of chromatin assembly and DNA repair coupled to DNA replication. This protocol presents the enrichment and sequencing of protein-associated nascent DNA (eSPAN) method, designed to quantify relative protein levels on nascent leading and lagging DNA strands at replication forks. The eSPAN procedure starts with chromatin immunoprecipitation (ChIP, in yeast) or cleavage under targets and tagmentation (CUT&amp;Tag; in mammalian cells) of a protein of interest, followed by enrichment of the protein-associated nascent DNA by bromodeoxyuridine (BrdU) immunoprecipitation. Strand-specific next-generation sequencing is applied to isolated ssDNA. This technique can be used to determine whether a protein is enriched at leading or lagging replication forks. The eSPAN provides genome-wide strand-preference of chromatin-associated proteins, including histones at replication forks.

Enrichment and sequencing of protein-associated nascent DNA (eSPAN) was developed to detect the relative abundance of a chromatin-associated protein on two replicating DNA strands, thereby revealing molecular insight into chromatin replication and its coupled processes. This protocol describes eSPAN procedures in yeast and mouse embryonic stem (ES) cells.

Genome duplication is orchestrated by replisome proteins, including helicases, which unwind double-stranded DNA into individual antiparallel single ...

Transcription Attenuation in Prokaryotes

Transcriptional attenuation occurs when&#160;RNA transcription is prematurely terminated due to the formation of a terminator mRNA hairpin structure.&#160; Bacteria use these hairpins to regulate the transcription process and control the synthesis of several amino acids including histidine, lysine, threonine, and phenylalanine. Transcription attenuation takes place in the non-coding regions of mRNA.
There are several different mechanisms used to attenuate transcription. In ribosome mediated transcriptional attenuation, the movement of a ribosome on the transcript is stalled or proceeds forward depending upon the availability of the tRNAs charged with a specific amino acid. High amino acid concentrations allow the ribosome to move forward leading to the formation of the terminator structure; deficiency of the amino acid stalls the ribosome and causes formation of the anti-terminator structure. The trp operon in E. coli, discussed below, is a good example of this type of mechanism. tRNA mediated transcriptional attenuation, as observed in trp operon of Lactococcus lactis, depends on an RNA-RNA interaction. When uncharged tRNAs are present in sufficient numbers, they directly bind to the mRNA and stabilize the anti-terminator structure. Transcriptional attenuation is also known to be mediated by proteins as found in bgl (beta-glucoside) operon in E. coli.&#160; This involves an RNA&#8212;protein interaction where a protein binds to the transcript and regulates the formation of an anti-terminator structure. More recently, another transcriptional attenuation mechanism was discovered where small metabolites like thiamine were observed to regulate transcription by directly binding to the non-coding mRNA segments, also known as riboswitches. Riboswitches can form a terminator or an anti-terminator structure depending upon the concentration and nature of a metabolite.&#160;
Trp Operon
The trp operon in E. coli contains a 140 nucleotide leader sequence before its first structural gene. This leader sequence has four distinct segments &#8211; 1 through 4&#8211; and regulates the transcription of the downstream structural genes. Segment&#160; 1 can form a hairpin structure with segment&#160; 2. This 1-2 hairpin structure is known as a pause structure, as during transcription, it stalls RNA polymerase until the ribosome binds the newly transcribed RNA. This synchronizes transcription and translation in bacteria.&#160; When tryptophan concentrations are low, a hairpin structure forms between segments 2 and 3, known as the anti-terminator structure. This anti-terminator structure allows the continuous transcription of the downstream genes which produce enzymes for tryptophan synthesis. In contrast, when tryptophan concentrations are sufficient, a hairpin structure forms between segments 3 and 4, called the terminator structure. Along with a&#160; series of uracil bases that follow, the terminator structure causes RNA polymerase to dissociate from the RNA and template DNA strands, resulting in the termination of the transcription.

BrUTP iplikli özgü Transkripsiyon Run-on (TRO) Yaklaşımı ile Transkripsiyon Feshi Analizi

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Gerçek zamanlı analiz bağlama, transkripsiyon, çeviri ve ciro hücresel etkinleştirme sırasında küresel olayları görüntülemek üzere transkripsiyon faktörü

Çeviri başlatma karmaşık oluşumu memeli mRNA'ların Toeprinting analizi

Diseksiyon eş transkripsiyon RNA Işleme etkinlikleri için suni RNA polimeraz II uzama kompleksler

Transcriptomik Analiz Kullanarak Düzensiz Onkojenik Transkripsiyon Faktörlerinin Yapı-fonksiyon İlişkilerinin Eşlenmesini

İnsan pre-mRNA üzerinde Haritalama Ribonucleoproteins Hızlı Yüksek verim için Yöntemi (RNPs)

PAR-Klip - RNA Cilt Proteinler Transcriptome geniş Cilt Siteleri Belirlemek Amacıyla Bir Yöntem

Pre-mRNA Substratlarm 3 'End Bölünme: Hücre Ücretsiz Sistemlerini Kullanma RNA İşleme Reaksiyonları Analizi

Floresan Bazlı Astar Uzatma Tekniği Transkripsiyonal Başlangıç Noktalarını ve RNases yarılması Siteleri belirleme

Strand-Specific Analysis of Proteins at Replicating DNA Strands by Enrichment and Sequencing of Protein-Associated Nascent DNA Method

Prokaryotlarda Transkripsiyon Zayıflaması

BrUTP iplikli özgü Transkripsiyon Run-on (TRO) Yaklaşımı ile Transkripsiyon Feshi Analizi

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Gerçek zamanlı analiz bağlama, transkripsiyon, çeviri ve ciro hücresel etkinleştirme sırasında küresel olayları görüntülemek üzere transkripsiyon faktörü

Çeviri başlatma karmaşık oluşumu memeli mRNA'ların Toeprinting analizi

Diseksiyon eş transkripsiyon RNA Işleme etkinlikleri için suni RNA polimeraz II uzama kompleksler

Transcriptomik Analiz Kullanarak Düzensiz Onkojenik Transkripsiyon Faktörlerinin Yapı-fonksiyon İlişkilerinin Eşlenmesini

İnsan pre-mRNA üzerinde Haritalama Ribonucleoproteins Hızlı Yüksek verim için Yöntemi (RNPs)

PAR-Klip - RNA Cilt Proteinler Transcriptome geniş Cilt Siteleri Belirlemek Amacıyla Bir Yöntem

Pre-mRNA Substratlarm 3 'End Bölünme: Hücre Ücretsiz Sistemlerini Kullanma RNA İşleme Reaksiyonları Analizi

Floresan Bazlı Astar Uzatma Tekniği Transkripsiyonal Başlangıç ​​Noktalarını ve RNases yarılması Siteleri belirleme

Strand-Specific Analysis of Proteins at Replicating DNA Strands by Enrichment and Sequencing of Protein-Associated Nascent DNA Method

Prokaryotlarda Transkripsiyon Zayıflaması

Floresan Bazlı Astar Uzatma Tekniği Transkripsiyonal Başlangıç Noktalarını ve RNases yarılması Siteleri belirleme