Bu eser bir Doğa Bilimleri ve mühendislik Araştırma Konseyi Kanada-keşif Grant'ın (RGPIN-2017-05463), Kanada Vakfı tarafından yenilik-John R. Evans liderleri Fonu (35017), kampüs Alberta yeniliklerin programı ve Alberta Bakanlığı için finanse edildi Ekonomik kalkınma ve ticaret.

Not: RNA ribonükleazlar (RNases) tarafından bozulması için son derece açıktır. RNA sağlam tutmak için standart önlemler almak. Eldiven sık sık değiştirin. Filtre uygulanmış pipet ipuçları, nükleaz ücretsiz plasticware ve kimyasallar nükleaz ücretsiz iletişim kuralının tüm adımlarını kullanın. Kullanım nükleaz içermeyen veya Dietil pyrocarbonate (DEPC)-tedavi su tüm çözümleri.
1. hazırlanması çözümleri
<ol><li>Toeprinting arabellek hazırlamak: 20 mM Tris-HCl (pH 7,6), 100 mM KOAc, 2.5 mM Mg(OAc)2, %5 (w/v) Sükroz, 2 mM dithiothreitol (DTT) ve 0,5 mM spermidine.<ol>
<li>DTT ve spermidine tek kullanımlık aliquots tekrarlanan donma-çözülme döngüsü önlemek için-20 ° C'de depolayın. Not: Kullanmadan önce hemen toeprinting arabelleğine DTT ve spermidine eklenmelidir. DTT ve spermidine yoksun bir çözümü-20 ° C'de depolanan</li>
	</ol>
</li>
	<li>Aliquots 85 mM 5'-guanylyl imidodiphosphate (GMP-PNP) ve 91 mM adenozin trifosfat (ATP) hazırlayın. Aliquots-20 ° C'de depolayın</li>
	<li>450 mL % 6 polyacrylamide - 7 M üre jel karışımı hazırlayın: 67,5 mL % 40 acrylamide:bis-Akrilamid (19:1), üre, 112.5 mL 5 x TBE (Tris/Bor/thylenediaminetetraacetic asit (EDTA)) ve 120 mL su 189 g. Üre 37 ° C su banyosu ya da sıcak bir tabak karıştırma ile ısınma tarafından çözülür. Çözüm filtre (örn., 0,2 mikron nitroselüloz vakum filtre). Not: Çözüm 4 ° C'de en az bir ay depolanabilir. Dikkat: Monomeric Akrilamid deri yoluyla absorbe edilebilir bir nörotoksin var. Cilt teması önlemek için büyük özen (i.e., eldiven, önlük, giyim ve göz koruma). Polimerizasyon için % 100 tamamlanma devam edemeyebilirsiniz gibi polyacrylamide da bakım ile ele alınmalıdır.</li>
	<li>Formamide boya yükleme hazırlamak: % 95'i formamide, 18 mM EDTA, % 0,025 (w/v) Sodyum Lauryl Sülfat (SDS), % 0,025 (w/v) bromophenol mavi, (w/v) % 0,025 Ksilen cyanol. -20 ° C'de mağaza</li>
	<li>10 pmol/μL bir çalışma konsantrasyonu su 100 μL içine astar (5' CTCGATATGTGCATCTGTA; 5' IRDye 800 ile son etiketli) 1 nmol geçiyoruz. Işıktan korunan-20 ° c tek kullanımlık aliquots (yaklaşık 10 µL), içinde saklayın.</li>
</ol>2. mRNA hazırlanması
<ol><li>Polimeraz zincir tepkimesi (PCR) uygun şablonları tarafından mRNA sentezi için DNA şablonları yükseltmek (i.e., genomik DNA veya uygun olarak plazmid DNA). Bir yüksek-sadakat DNA polimeraz üreticinin talimatlarına göre aşağıdaki reaksiyon koşulları (35 döngüleri) ile kullanın: eritmek, 98 ° C, 10 s; TAV, 53 ° C, 20 s; genişletmek, 72 ° C, 30 s. Not: İleri astar (5' AAGCTTAATACGACTCACTATAG) RNA transkripsiyonu için izin vermek için T7 organizatörü sıra içerir; ters astar (5' T51GAATTCGGATCCGACCGTGG) Poli-A kuyruk için transkripsiyonu RNA sağlamak için 51 timin kalıntıları içerir. Vitro plazmid DNA transkripsiyonu RNA da olabileceğine dikkat edin.</li>
	<li>Kullanım bir uygun transkripsiyon kiti vitro için uyarlamak IRES içeren RNA veya DNA şablonundaki kepli RNA. Üreticinin yönergeleri izleyin. RNA örnek standart 20 μL tepki cilt olarak hazırlayın. 37 ° C'de 2 adet RNase free Dnaz 30 dk ile yeni sentezlenmiş RNA tedavi</li>
	<li>Dnaz tedavi RNA 110 seyreltik µL nükleaz ücretsiz su ile 20.000 x g oda sıcaklığında de 110 µL asit fenol, girdap 5 s ve 3 dk santrifüj ekleyin. Sulu faz için yeni bir 1.5 mL microfuge tüp 100 µL kaldırmak, 3 M sodyum asetat ve girdap 2 s. Ekle, % 100 etanol, girdap 5 s, 3 Cilt 10 µL eklemek ve RNA-20 ° C'de gecede çökelti.</li>
	<li>Santrifüj kapasitesi > 20.000 x g 4 ° C ve atma süpernatant 30 dk için. Pelet 500 µL buz gibi % 70 (v/v) etanol ile yıkayın ve aralıklarla tekrarlayın. Büyük bir kısmını süpernatant mümkün olduğunca Aspire edin ve pelet pelet çıkarmak değil dikkatli olmak da 5-10 dakika kuruması.</li>
	<li>RNA nükleaz ücretsiz su bir çalışma konsantrasyonu 0.5 μg/μL vermeye uygun hacmi resuspend. Bu-80 ° C'de depolanan veya hemen kullanılabilir.</li>
</ol>3. Toeprinting tepki
<ol><li>Mix 15 μL, tavşan Retikülosit Lysate (RRL, nükleaz tedavi), RNase inhibitörü, 1 µL 91 mm ATP (1.82 mM son) ve 85 mm GMP-PNP (nihai 1.7 mM) 1.5 mL microfuge tüp içinde 1 μL 1 μL (40 adet). 30 ° c 5 min için kuluçkaya. Not: RRL tekrarlayan donma-çözülme önlemek Tek Kişilik Kullanım için bölünmemeli olmalıdır. Kritik kontrol RRL, RNA'ın ikincil yapı nedeniyle ters transkripsiyon doğal duraklar aydınlatmak için eksik bir tepkidir. Bu denetim için RRL eski yerine koymak için toeprinting tampon ekleyin.</li>
	<li>RNA'ın 0,5 µg (1 µL) ekleyin ve 5 min için 30 ° C'de kuluçkaya.</li>
	<li>Toeprinting arabellek 22 µL ekleyin ve 3 dakika 30 ° C'de kuluçkaya.</li>
	<li>IRDye etiketli astar 0.5 µL (5 pmol) ekleyin ve 10 dakika buz üzerinde kuluçkaya.</li>
	<li>25 mM dNTPs 2 µL ekleyin (son konsantrasyonu: 1 mM), 2 µL 100 mM Mg(OAc)2, 1 µL kuş Myeloblastosis virüs ters transkriptaz (AMV-RT), ve Toeprinting arabelleği 3,5 µL. Son 50 μL birimdir.</li>
	<li>Tepki için 45 dk 30 ° C'de kuluçkaya.</li>
	<li>200 µL nükleaz ücretsiz su ekleyin ve hemen 25:24:1 fenol: kloroform: izoamil alkol (pH yaklaşık 8.0) 250 µL ile ayıklayın. Girdap 5 s ve oda sıcaklığında 3 min için 20.000 x g, santrifüj. Yeni 1.5 mL microfuge Tube sulu faz kaldırmak, % 100 etanol, girdap 5 s, 3 cilt eklemek ve -20 ° C'de gecede çökelti.</li>
	<li>Santrifüj kapasitesi > 20.000 x g 4 ° C ve atma süpernatant 30 dk için. DNA Pelet 500 µL buz gibi % 70 (v/v) etanol ile yıkayın. Santrifüj kapasitesi > 4 ° C'de 15 dakika 20.000 x g Aspire edin kadar süpernatant mümkün ve hava kuru 5-10 dakika süreyle pelet pelet çıkarmak değil dikkatli olun.</li>
	<li>Pelet 6 μL nükleaz ücretsiz su içinde dağıtılması ve boya yükleme formamide 3 μL ekleyin.</li>
</ol>4. sıralama tepkiler
<ol><li>2.1 DNA şablondan ve adım 3.4 IRDye etiketli astar standart sıralama reaksiyonlar, dideoxynucleotides (ddNTPs) zincir sonlandırıcılar kullanma için kullanın. Uygun bir DNA sıralama setini kullanın ve üreticinin yönergeleri izleyin.</li>
	<li>Formamide boya yükleniyor 3 μL ile Mix 6 μL her sıralama tepki.</li>
</ol>5. hazırlık, jel ve Elektroforez sıralama
Not: Bu protokol bir floresan Imager jel tabanlı ve bir 21 cm x 23 cm x 0.2 mm jel kullanır, ancak diğer sıralayıcılar veya jel-boyutları, gerekirse adapte edilebilir.
<ol><li>İyice 0.2 mm boşluk ekleyiciler yanı sıra kısa (23 × 25 cm) ve uzun (30 × 25 cm) cam plakanın % 100 etanol ile temizleyin. Hava kuru.</li>
	<li>% 6 polyacrylamide - 7M üre jel karışımı 30 mL % 10 (w/v) amonyum persülfat (APS) 200 μL ile karıştırın ve tetramethylethylenediamine (TEMED) 20 μL. Kabarcıklar, önlemek için dikkat çekici jel dökmek ve 'köpekbalığı-dişli' jel tarak ekleyin. Oda sıcaklığında 1 h için polimerize jel izin.</li>
	<li>Sıralama cihazı montajı ve rezervuarlar 1 ile doldurun x TBE.</li>
	<li>55 ° C en uygun sıcaklık elde kadar 15dk için 1500 V'de önceden çalıştırın.</li>
	<li>(Kimden adım 3.9 veya 4.2) örnek/yükleme boya karıştırmak için sıralama jel üzerine 5 dk. yük 1 μL için 85 ° C ısı.</li>
	<li>Jel 1500 V 8 h için çalıştırın. Makine gerçek zamanlı bantlarında okuyacaktır.</li>
	<li>Aparatı sökmeye ve Akrilamid jel ve çalışan tampon atmayın.</li>
</ol>

<ol>
	<li>Holcik, M., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+stress+and+apoptosis.">Translational control in stress and apoptosis.</a> Nat Rev Mol Cell Biol. 6 (4), 318-327 (2005).</li><li>Lacerda, R., Menezes, J., Romao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+just+scanning:+the+importance+of+cap-independent+mRNA+translation+initiation+for+cellular+stress+response+and+cancer.">More than just scanning: the importance of cap-independent mRNA translation initiation for cellular stress response and cancer.</a> Cell Mol Life Sci. 74 (9), 1659-1680 (2017).</li><li>Sharma, D. K., Bressler, K., Patel, H., Balasingam, N., Thakor, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Eukaryotic+Initiation+Factors+during+Cellular+Stress+and+Cancer+Progression.">Role of Eukaryotic Initiation Factors during Cellular Stress and Cancer Progression.</a> J Nucleic Acids. 2016, 8235121 (2016).</li><li>Gebauer, F., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+translational+control.">Molecular mechanisms of translational control.</a> Nat Rev Mol Cell Biol. 5 (10), 827-835 (2004).</li><li>Anthony, D. D., Merrick, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+40+S+and+80+S+complexes+with+mRNA+as+measured+by+sucrose+density+gradients+and+primer+extension+inhibition.">Analysis of 40 S and 80 S complexes with mRNA as measured by sucrose density gradients and primer extension inhibition.</a> J Biol Chem. 267 (3), 1554-1562 (1992).</li><li>Hartz, D., McPheeters, D. S., Traut, R., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extension+inhibition+analysis+of+translation+initiation+complexes.">Extension inhibition analysis of translation initiation complexes.</a> Methods Enzymol. 164, 419-425 (1988).</li><li>Shirokikh, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+ribosome-mRNA+complexes+at+different+translation+stages.">Quantitative analysis of ribosome-mRNA complexes at different translation stages.</a> Nucleic Acids Res. 38 (3), 15 (2010).</li><li>Thakor, N., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRES-mediated+translation+of+cellular+messenger+RNA+operates+in+eIF2alpha-+independent+manner+during+stress.">IRES-mediated translation of cellular messenger RNA operates in eIF2alpha- independent manner during stress.</a> Nucleic Acids Res. 40 (2), 541-552 (2012).</li><li>Liwak, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+suppressor+PDCD4+represses+internal+ribosome+entry+site-mediated+translation+of+antiapoptotic+proteins+and+is+regulated+by+S6+kinase+2.">Tumor suppressor PDCD4 represses internal ribosome entry site-mediated translation of antiapoptotic proteins and is regulated by S6 kinase 2.</a> Mol Cell Biol. 32 (10), 1818-1829 (2012).</li><li>Thakor, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mRNA+recruits+the+ribosome+via+eIF3-PABP+bridge+to+initiate+internal+translation.">Cellular mRNA recruits the ribosome via eIF3-PABP bridge to initiate internal translation.</a> RNA Biol. , 1-15 (2016).</li><li>Thoma, C., Bergamini, G., Galy, B., Hundsdoerfer, P., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+IRES-mediated+translation+of+the+c-myc+and+BiP+mRNAs+by+the+poly(A)+tail+is+independent+of+intact+eIF4G+and+PABP.">Enhancement of IRES-mediated translation of the c-myc and BiP mRNAs by the poly(A) tail is independent of intact eIF4G and PABP.</a> Mol Cell. 15 (6), 925-935 (2004).</li><li>Baird, S. D., Lewis, S. M., Turcotte, M., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+search+for+structurally+similar+cellular+internal+ribosome+entry+sites.">A search for structurally similar cellular internal ribosome entry sites.</a> Nucleic Acids Res. 35 (14), 4664-4677 (2007).</li><li>Merrick, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+that+a+single+GTP+is+used+in+the+formation+of+80+S+initiation+complexes.">Evidence that a single GTP is used in the formation of 80 S initiation complexes.</a> J Biol Chem. 254 (10), 3708-3711 (1979).</li><li>Arnaud, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+New+34-Kilodalton+Isoform+of+Human+Fibroblast+Growth+Factor+2+Is+Cap+Dependently+Synthesized+by+Using+a+Non-AUG+Start+Codon+and+Behaves+as+a+Survival+Factor.">A New 34-Kilodalton Isoform of Human Fibroblast Growth Factor 2 Is Cap Dependently Synthesized by Using a Non-AUG Start Codon and Behaves as a Survival Factor.</a> Mol Cell Biol. 19 (1), 505-514 (1999).</li><li>Dmitriev, S. E., Pisarev, A. V., Rubtsova, M. P., Dunaevsky, Y. E., Shatsky, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conversion+of+48S+translation+preinitiation+complexes+into+80S+initiation+complexes+as+revealed+by+toeprinting.">Conversion of 48S translation preinitiation complexes into 80S initiation complexes as revealed by toeprinting.</a> FEBS Lett. 533 (1-3), 99-104 (2003).</li><li>Faye, M. D., Graber, T. E., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+selective+mRNA+translation+in+mammalian+cells+by+polysome+profiling.">Assessment of selective mRNA translation in mammalian cells by polysome profiling.</a> J Vis Exp. (92), e52295 (2014).</li><li>Duncan, C. D. S., Mata, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+cycloheximide+on+the+interpretation+of+ribosome+profiling+experiments+in+Schizosaccharomyces+pombe.">Effects of cycloheximide on the interpretation of ribosome profiling experiments in Schizosaccharomyces pombe.</a> Sci Rep. 7 (1), 10331 (2017).</li><li>Beck, H. J., Janssen, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Translation+Initiation+Regulation+Mechanism+in+Escherichia+coli+ptrB+Mediated+by+a+5'-Terminal+AUG.">Novel Translation Initiation Regulation Mechanism in Escherichia coli ptrB Mediated by a 5'-Terminal AUG.</a> J Bacteriol. 199 (14), (2017).</li></ol>

Yazarlar çatışma-in-ifşa etmek niyetimiz yok.

Toeprinting doğrudan ilgi bir RNA çeviri başlatma kompleksleri son derece kontrollü koşullar altında oluşumunu desteklemek yeteneği ölçmek için güçlü bir tekniktir. Bu iletişim kuralı toeprinting için basitleştirilmiş bir teknik anlatılmaktadır memeli RNA'ların. Tavşan Retikülosit lysate (RRL) ribozomlar, mantolama, başlatıcı uygun kaynağı olarak kullanılan tRNA ve IRES trans-faktörler (ITAFs) hareket. Deneyci kendi RNA seçim sağlar ve ayrıca kendi seçtiğiniz belirli Kofaktör...

Çevirisi en hücresel enerji tüketir gibi bu çeviri sıkıca düzenlenmiş1olduğunu mantıklı. Diğer taraftan, bozukluk çeviri-protein çıktı bunun sonucunda değişiklik ve -genellikle kanser1,2gibi stres tepkisi ve hastalık durumları görülmektedir. Translasyonel kontrol önemli bir avantajı olan çeşitli uyaranlara3' e cevap için protein çıktılarını hücreleri değiştirebilirsiniz hızıdır. Çeviri yönetmelik böylece hücre yaşam ve ölüm1,2,3etkileyebilecek önemli bir mekanizma temsil eder. Çeviri adımlardan inisiyasyon en son derece düzenli ve karmaşık3' tür. Kısaca, en ökaryotik mRNA'ların hemen hemen her zaman onların çeviri için gerekli olan bir 5' m7G başlık içerir. Cap-bağımlı başlatma gerektirir ökaryotik başlama faktörleri eIF4E, Eıf4a ve eIF4G (cap-tanıma kompleksi 5' uç mRNA ile etkileşim kurmak için). EIF2 bağlı Başlatıcı içeren 43S preinitiation ribozom karmaşık, tRNA ve eIF3, 5' sonuna kadar mRNA yolu ile eIF4G eIF3 ile bir etkileşim işe. Karmaşık preinitiation Eıf4a tarafından destekli mRNA, tarama düşünülmektedir (RNA helikaz) başlama kodonu (AUG) bulunana kadar. Karmaşık 48S başlatma sonradan oluşmuş ve tRNA ribozom P-site teslim edilir. Son olarak, 60'lar ve 40'lı ribozom alt birimleri karmaşık, 80S başlatma oluşturmak için çeviri uzama1,3,4tarafından takip Birleşmiş. Buna ek olarak, iç ribozom giriş siteleri (IRESes) 40'lı ribozomal altbirimde başlama kodonu3için doğrudan işe alma tarafından 5' başlık gereksinimini devre dışı. Fizyolojik stres koşulları küresel mRNA çeviri değişikliklerini anahtar genel ökaryotik başlama faktörleri (mantolama) nedeniyle azalt. Ancak, kanonik olmayan çeviri başlatma mekanizmaları genellikle stres tepkisi protein kodlamak belirli mRNA seçici çeviri için izin ve kanonik olmayan çeviri inisiyasyon bozukluk gibi kanser hastalığı Devletleri'nde karıştığı 1 , 2. gizli RNA gibi hücresel IRESes, düzenleyici elemanlarının izin böyle mRNA'ların2,3çeviri için.
Bir özellikle ilginç yönü translasyonel kontrol mekanizmaları karşı verilen bir mRNA kanonik olmayan çeviri kurallı anlamaktır. Toeprinting belirli RNA'ların içinde vitroinisiyasyon çeviri ayrıntılı mekanik çalışma sağlayan bir tekniktir. Toeprinting genel amacı bir RNA ilgi hangi dizileri, yapı elemanlarının veya aksesuar belirlemek için bir çeviri başlatma koşulları, çeşitli altında ribozom ile karmaşık oluşumu nucleate yeteneği değerlendirmek etmektir verimli çeviri kabul töreni için gerekli faktörlerdir. Örneğin, ribozom işe alım 5' başlık yokluğunda engel ama bir IRES varlığı ile uyarılmış.
Vitro için teknik bir ilkesidir ilgi bir RNA uyarlamak başlatma kompleksleri forma ve tersine çevirmek için uyarlamak izin vermek için çeviri bileşenleri (veya saf bileşenleri) içeren hücre özleri huzurunda kuluçkaya RNA ile belirli bir astar. İstikrarlı RNA-ribozom kompleksleri 3' kenarında ribozom sözde 'toeprint'5,6,7durak ters transkripsiyon neden olur.
Bu iletişim kuralı, ribozomal alt birimleri, mantolama, tRNA ve IRES trans-oyunculuk faktörler (ITAFs) uygun tarafından tavşan Retikülosit lysate (RRL) katkıda bulunmuştur. Bu iletişim kuralı bir diğer avantajı radiolabeled astar yerine fluorescently etiketli bir astar ve floresan jel tabanlı Imager kullanmaktır. Bu astar, radiolabeling gibi jel kurutma ve kuvvetlenmesine ekranına açığa dahil olmak üzere ek adımlar ortadan kaldırır. Floresan bantları gerçek zamanlı olarak, daha fazla çözümleme için izin jel ishal olarak kaydedilir. Her ne kadar çok Millî olan mRNA'ların da bu tekniği8tarafından analiz edilebilir kapağını X'e inhibitörü Apoptozis protein (XIAP) IRES RNA'ın burada, bir örnek kullanılır.
Hücre lysates çeviri sürecinde son çıktı ölçer, Batı analiz farklı olarak, toeprinting bir RNA çeviri başlatma karmaşık oluşumu ölçmek için vitro yaklaşımıdır. Bu indirgemeci yaklaşımın yüzeylerde veya çeviri başlatma düzenleyen faktörler son derece ayrıntılı bir çalışma için izin verir (örn., kaplama veya un kepli mRNA, IRES yapısı, varlığı ya da yokluğu Poli-A kuyruk, belirli protein faktörler, hükmü vs.). Bu nedenle, toeprinting çeviri8 farklı mod veya protein sentezi9,10IRESes gibi bir mRNA yapıları etkileri eğitimi için kullanılabilir.

<table border="0" cellpadding="0" cellspacing="0" style="width:1045px;" width="1043">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="40">
			<td height="40" style="height:40px;width:405px;">DEPC (Diethyl pyrocarbonate)</td>
			<td style="width:159px;">Sigma</td>
			<td style="width:191px;">D5758-100ML</td>
			<td style="width:291px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">TRIS base, Ultrapure</td>
			<td>JT Baker</td>
			<td>4109-01</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">KOAc (Potassium acetate)</td>
			<td>Bio Basic</td>
			<td>PB0438</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Mg(OAc)2 (Magnesium acetate tetrahydrate)</td>
			<td>Bio Basic</td>
			<td>MB0326</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sucrose, molecular biology grade</td>
			<td>Calbiochem</td>
			<td>573113-1KG</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Spermidine</td>
			<td>Sigma</td>
			<td>85558</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">GMP-PNP (Guanosine 5&#8242;-[&#946;,&#947;-imido]triphosphate trisodium salt hydrate) 0.1 M solution</td>
			<td>Sigma</td>
			<td>G0635</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">ATP (Adenosine 5&#8242;-triphosphate) disodium salt, 100 mM solution</td>
			<td>Sigma</td>
			<td>A6559</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">19:1 Acrylamide:bis-acrylamide, 40%</td>
			<td>Bio Basic</td>
			<td>A0006</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Urea</td>
			<td>Bio Basic</td>
			<td>UB0148</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">500mL bottle top filtration units, 0.2 &#181;m</td>
			<td>Sarstedt</td>
			<td>83.1823.101</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Formamide</td>
			<td>Sigma</td>
			<td>F9037-100ML</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">EDTA (disodium salt, dihydrate)</td>
			<td>Bio Basic</td>
			<td>EB0185</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">SDS</td>
			<td>Bio Basic</td>
			<td>SB0485</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Bromophenol blue</td>
			<td>Bio Basic</td>
			<td>BDB0001</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Xylene cyanol FF</td>
			<td>Bio Basic</td>
			<td>XB0005</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">MEGAshortscript T7 transcription kit</td>
			<td>Ambion</td>
			<td>AM1354</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">mMESSAGE mMACHINE T7 transcription kit</td>
			<td>Ambion</td>
			<td>AM1344</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Acid Phenol:Chloroform (5:1)</td>
			<td>Ambion</td>
			<td>AM9722</td>
			<td></td>
		</tr>
		<tr height="33">
			<td height="33" style="height:33px;width:405px;">25:24:1 Phenol:Chloroform:Isoamyl Alcohol</td>
			<td style="width:159px;">Invitrogen</td>
			<td style="width:191px;">15593-049</td>
			<td style="width:291px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Rabbit Reticulocyte Lysate (RRL). Should NOT be nuclease-treated.</td>
			<td>Green Hectares, USA</td>
			<td></td>
			<td>Contact Green Hectares, ask for 1:1 RRL:water</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">RiboLock RNase Inhibitor (40 U/&#181;L)</td>
			<td>Thermo Fisher</td>
			<td>E00382</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">100 mM dNTPs</td>
			<td>Invitrogen</td>
			<td>56172, 56173, 56174, 56175</td>
			<td>Mix equal parts for a stock of 25 mM each.</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">AMV-RT, 10 U/&#181;L</td>
			<td>Promega</td>
			<td>M5101</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Sequenase Version 2.0 DNA Sequencing Kit</td>
			<td>Thermo Fisher</td>
			<td>707701KT</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Model 4200 IR2 DNA analyzer</td>
			<td>LI-COR</td>
			<td></td>
			<td>Product has been discontinued</td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">APS (Ammonium Persulfate)</td>
			<td>Bio Basic</td>
			<td>AB0072</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">TEMED</td>
			<td>Bio Basic</td>
			<td>TB0508</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:405px;">Phusion High Fidelity Polymerase</td>
			<td style="width:159px;">New England Biolabs</td>
			<td style="width:191px;">M0530</td>
			<td style="width:291px;"></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;">Turbo Dnase</td>
			<td>Thermo Fisher</td>
			<td>AM2238</td>
			<td></td>
		</tr>
	</tbody>
</table>

toeprinting analysis of translation initiation complex formation on mammalian mrnas

Çeviri başlatma hızı sınırlaması adım protein sentezi ve hangi hücrelerin protein çıktılarını düzenleyen önemli bir nokta temsil eder. Düzenleme protein sentezi, hücresel stres tepkisi anahtarıdır ve bozukluk birçok hastalık durumlarında, kanser gibi merkezi bir noktada bulunuyor. Örneğin, hücresel stres küresel çeviri inhibisyonu inceltiyorum kap bağımlı başlatma tarafından leads rağmen bazı stres tepkisi proteinler seçerek bir kap bağımsız şekilde çevrilir. Hücresel iç ribozom giriş siteleri (IRESes), gibi sağduyulu RNA düzenleyici elemanlarının bu belirli mRNA'ların çeviri için izin. Böyle mRNA'ların tanımlaması ve düzenleyici mekanizmaları, karakterizasyonu Moleküler biyolojide önemli bir alan olmuştur. Gibi çeviri başlatma için ilgilidir Toeprinting, RNA yapısı ve işlevi için bir yöntemdir. Toeprinting vitro yeteneği değerlendirmek için hangi dizileri, yapı elemanlarının veya aksesuar faktörler ribozom içinde söz konusu belirlemek için koşullar, çeşitli altında ribozomlar ile kararlı kompleksler oluşturmak için RNA transkripsiyonu hedeftir bağlama — için verimli çeviri başlatma öncesi bir imleç. Batı analiz ve polysome profil oluşturma, gibi diğer teknikleri ile birlikte çeviri başlatma düzenlenmesi için mekanizmalar sağlam bir karakterizasyonu için toeprinting sağlar.

XIAP IRES kap bağımsız çeviri başlatma vitro8,10destek yeteneği daha önce anlatmıştık. Toeprinting mekanik ayrıntıları karmaşık XIAP IRES inisiyasyon sorguya çekmek için anahtar yöntem oldu. XIAP IRES (şekil 1A) içeren bir mRNA kodlama bir DNA yapısı transkripsiyonu ve toeprinting analize tabi vitro yapıldı. Burada kullanılan XIAP IRES mRNA m...

Watch this Scientific Journal Video about Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs at JoVE.com

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Çeviri başlatma karmaşık oluşumu memeli mRNA'ların Toeprinting analizi

Vitro becerisini ölçmek için Toeprinting amaçları için formu çeviri başlatma kompleksleri ile ribozomlara koşulları çeşitli altında RNA transkripsiyonu. Bu iletişim kuralı toeprinting memeli RNA için bir yöntem açıklanır ve kap-bağımlı ve IRES uygulamalı çeviri çalışma için kullanılabilir.

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

toeprinting-analysis-translation-initiation-complex-formation-on

Research

JoVE Journal

Biochemistry

12.4K Görüntüleme.  University of Lethbridge. Vitro becerisini ölçmek için Toeprinting amaçları için formu çeviri başlatma kompleksleri ile ribozomlara koşulları çeşitli altında RNA transkripsiyonu. Bu iletişim kuralı toeprinting memeli RNA için bir yöntem açıklanır ve kap-bağımlı ve IRES uygulamalı çeviri çalışma için kullanılabilir.

Video: Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Protein Complex Affinity Capture from Cryomilled Mammalian Cells

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this technique is also frequently referred to as immunoprecipitation. Affinity capture can be applied in a bench-scale and in a high-throughput context. When coupled with protein mass spectrometry, affinity capture has proven to be a workhorse of interactome analysis. Although there are potentially many ways to execute the numerous steps involved, the following protocols implement our favored methods. Two features are distinctive: the use of cryomilled cell powder to produce cell extracts, and antibody-coupled paramagnetic beads as the affinity medium. In many cases, we have obtained superior results to those obtained with more conventional affinity capture practices. Cryomilling avoids numerous problems associated with other forms of cell breakage. It provides efficient breakage of the material, while avoiding denaturation issues associated with heating or foaming. It retains the native protein concentration up to the point of extraction, mitigating macromolecular dissociation. It reduces the time extracted proteins spend in solution, limiting deleterious enzymatic activities, and it may reduce the non-specific adsorption of proteins by the affinity medium. Micron-scale magnetic affinity media have become more commonplace over the last several years, increasingly replacing the traditional agarose- and Sepharose-based media. Primary benefits of magnetic media include typically lower non-specific protein adsorption; no size exclusion limit because protein complex binding occurs on the bead surface rather than within pores; and ease of manipulation and handling using magnets.

Here we describe protocols to disrupt mammalian cells by solid-state milling at a cryogenic temperature, produce a cell extract from the resulting cell powder, and isolate protein complexes of interest by affinity capture upon antibody-coupled micron-scale paramagnetic beads.

Cryomilled memeli hücrelerinden protein kompleksi olan ele geçirme kapasitesini

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this ...

Biyokimya

Preparation of Giant Vesicles Encapsulating Microspheres by Centrifugation of a Water-in-oil Emulsion

The constructive biology and the synthetic biology approach to creating artificial life involve the bottom-up assembly of biological or nonbiological materials. Such approaches have received considerable attention in research on the boundary between living and nonliving matter and have been used to construct artificial cells over the past two decades. In particular, Giant Vesicles (GVs) have often been used as artificial cell membranes. In this paper, we describe the preparation of GVs encapsulating highly packed microspheres as a model of cells containing highly condensed biomolecules. The GVs were prepared by means of a simple water-in-oil emulsion centrifugation method. Specifically, a homogenizer was used to emulsify an aqueous solution containing the materials to be encapsulated and an oil containing dissolved phospholipids, and the resulting emulsion was layered carefully on the surface of another aqueous solution. The layered system was then centrifuged to generate the GVs. This powerful method was used to encapsulate materials ranging from small molecules to microspheres.

Giant vesicles containing highly packed micrometer-sized components are useful cell models. The water-in-oil emulsion centrifugation method is a simple, powerful tool for the preparation of giant vesicles with encapsulated materials.

bir su-içinde-yağ emülsiyonu santrifüj Dev veziküller Kapsüllenen Mikrokürelerin hazırlanması

The constructive biology and the synthetic biology approach to creating artificial life involve the bottom-up assembly of biological or nonbiological ...

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

Nicel ayirt ölçmek küresel çeviri lokalize

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Biochemical and Structural Characterization of the Carbohydrate Transport Substrate-binding-protein SP0092

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant strains. Carbohydrate substrate binding proteins (SBPs) represent viable targets for the development of protein-based vaccines and new antimicrobials because of their extracellular localization and the centrality of carbohydrate import for pneumococcal metabolism, respectively. Described here is a rationalized integrated protocol to carry out a comprehensive characterization of SP0092, which can be extended to other carbohydrate SBPs from the pneumococcus and other bacteria. This procedure can aid the structure-based design of inhibitors for this class of proteins. Presented in the first part of this manuscript are protocols for biochemical analysis by thermal shift assay, multi angle light scattering (MALS), and size exclusion chromatography (SEC), which optimize the stability and homogeneity of the sample directed to crystallization trials and so enhance the probability of success. The second part of this procedure describes the characterization of the SBP crystals using a tunable wavelength anomalous diffraction synchrotron beamline, and data collection protocols for measuring data that can be used to resolve the crystallized protein structure.

A streamlined protocol for performing an extensive biochemical and structural characterization of a carbohydrate substrate binding protein from Streptococcus pneumoniae is presented.

Karbonhidrat taşıma substrat-bağlayıcı-protein SP0092 biyokimyasal ve yapısal karakterizasyonu

Development of new antimicrobials and vaccines for Streptococcus pneumoniae (pneumococcus) are necessary to halt the rapid rise in multiple resistant ...

Genome-wide Quantification of Translation in Budding Yeast by Ribosome Profiling

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription reflect changes in protein synthesis, but many exceptions have been observed. Recently, a technique called ribosome profiling (or Ribo-Seq) has emerged as a powerful method that allows identification, with high accuracy, which regions of mRNA are translated into proteins and quantification of translation at the genome-wide level. Here, we present a generalized protocol for genome-wide quantification of translation using Ribo-Seq in budding yeast. In addition, combining Ribo-Seq data with mRNA abundance measurements allows us to simultaneously quantify translation efficiency of thousands of mRNA transcripts in the same sample and compare changes in these parameters in response to experimental manipulations or in different physiological states. We describe a detailed protocol for generation of ribosome footprints using nuclease digestion, isolation of intact ribosome-footprint complexes via sucrose gradient fractionation, and preparation of DNA libraries for deep sequencing along with appropriate quality controls necessary to ensure accurate analysis of in vivo translation.

Translational regulation plays an important role in the control of protein abundance. Here, we describe a high-throughput method for quantitative analysis of translation in the budding yeast Saccharomyces cerevisiae.

Genom çapında Quantification ribozom profil oluşturma tarafından mayası çeviri

Translation of mRNA into proteins is a complex process involving several layers of regulation. It is often assumed that changes in mRNA transcription ...

A Simple Method for High Throughput Chemical Screening in Caenorhabditis Elegans

Caenorhabditis elegans is a useful organism for testing chemical effects on physiology. Whole organism small molecule screens offer significant advantages for identifying biologically active chemical structures that can modify complex phenotypes such as lifespan. Described here is a simple protocol for producing hundreds of 96-well culture plates with fairly consistent numbers of C. elegans in each well. Next, we specified how to use these cultures to screen thousands of chemicals for effects on the lifespan of the nematode C. elegans. This protocol makes use of temperature sensitive sterile strains, agar plate conditions, and simple animal handling to facilitate the rapid and high throughput production of synchronized animal cultures for screening.

A Simple Method for High Throughput Chemical Screening in Caenorhabditis Elegans

Here we describe a simple protocol for rapidly producing hundreds of nematode growth media agar, 96-well culture plates with consistent numbers of Caenorhhabditis elegans per well. These cultures are useful for the phenotypic screening of whole organisms. We focus here on using these cultures to screen chemicals for pro-longevity effects.

Yüksek işlem hacmi Caenorhabditis Elegans kimyasal tarama için basit bir yöntem

Caenorhabditis elegans is a useful organism for testing chemical effects on physiology. Whole organism small molecule screens offer significant advantages ...

Study on the Metabolism of Six Systemic Insecticides in a Newly Established Cell Suspension Culture Derived from Tea (Camellia Sinensis L.) Leaves

A platform for studying insecticide metabolism using in vitro tissues of tea plant was developed. Leaves from sterile tea plantlets were induced to form loose callus on Murashige and Skoog (MS) basal media with the plant hormones 2,4-dichlorophenoxyacetic acid (2,4-D, 1.0 mg L-1) and kinetin (KT, 0.1 mg L-1). Callus formed after 3 or 4 rounds of subculturing, each lasting 28 days. Loose callus (about 3 g) was then inoculated into B5 liquid media containing the same plant hormones and was cultured in a shaking incubator (120 rpm) in the dark at 25 &#177; 1 &#176;C. After 3&#8722;4 subcultures, a cell suspension derived from tea leaf was established at a subculture ratio ranging between 1:1 and 1:2 (suspension mother liquid: fresh medium). Using this platform, six insecticides (5 &#181;g mL-1 each thiamethoxam, imidacloprid, acetamiprid, imidaclothiz, dimethoate, and omethoate) were added into the tea leaf-derived cell suspension culture. The metabolism of the insecticides was tracked using liquid chromatography and gas chromatography. To validate the usefulness of the tea cell suspension culture, the metabolites of thiamethoxan and dimethoate present in treated cell cultures and intact plants were compared using mass spectrometry. In treated tea cell cultures, seven metabolites of thiamethoxan and two metabolites of dimethoate were found, while in treated intact plants, only two metabolites of thiamethoxam and one of dimethoate were found. The use of a cell suspension simplified the metabolic analysis compared to the use of intact tea plants, especially for a difficult matrix such as tea.

Study on the Metabolism of Six Systemic Insecticides in a Newly Established Cell Suspension Culture Derived from Tea Camellia Sinensis L. Leaves

This work presents a protocol for establishing a cell suspension culture derived from tea (Camellia sinensis L.) leaves that can be used to study the metabolism of external compounds that can be taken up by the whole plant, such as insecticides.

Çay (Camellia sinensis L.) türetilmiştir yeni kurulan hücre süspansiyon kültürü altı sistemik Böcek Ilacı metabolizması üzerinde çalışma Yaprak -ları

A platform for studying insecticide metabolism using in vitro tissues of tea plant was developed. Leaves from sterile tea plantlets were induced to form ...

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed extensive studies of cap-dependent translation and its regulation, high resolution kinetic characterization of this translation pathway is still lacking. Recently, we developed an in vitro assay to measure cap-dependent translation kinetics with single-molecule resolution. The assay is based on fluorescently labeled antibody binding to nascent epitope-tagged polypeptide. By imaging the binding and dissociation of antibodies to and from nascent peptide&#8211;ribosome&#8211;mRNA complexes, the translation progression on individual mRNAs can be tracked. Here, we present a protocol for establishing this assay, including mRNA and PEGylated slide preparations, real-time imaging of translation, and analysis of single molecule trajectories. This assay enables tracking of individual cap-dependent translation events and resolves key translation kinetics, such as initiation and elongation rates. The assay can be widely applied to distinct translation systems and should broadly benefit in vitro studies of cap-dependent translation kinetics and translational control mechanisms.

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Tracking individual translation events allows for high-resolution kinetic studies of cap-dependent translation mechanisms. Here we demonstrate an in vitro single-molecule assay based on imaging interactions between fluorescently labeled antibodies and epitope-tagged nascent peptides. This method enables single-molecule characterization of initiation and peptide elongation kinetics during active in vitro cap-dependent translation.

Kapak Bağımlı Çeviri Kinetiğinin Analizi için Bir In Vitro Tek Moleküllü Görüntüleme Tahlili

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed ...

Complementation of Splicing Activity by a Galectin-3 - U1 snRNP Complex on Beads

Classic depletion-reconstitution experiments indicate that galectin-3 is a required splicing factor in nuclear extracts. The mechanism of incorporation of galectin-3 into the splicing pathway is addressed in this paper. Sedimentation of HeLa cell nuclear extracts on 12%-32% glycerol gradients yields fractions enriched in an endogenous ~10S particle that contains galectin-3 and U1 snRNP. We now describe a protocol to deplete nuclear extracts of U1 snRNP with concomitant loss of splicing activity. Splicing activity in the U1-depleted extract can be reconstituted by the galectin-3 - U1 snRNP particle trapped on agarose beads covalently coupled with anti-galectin-3 antibodies. The results indicate that the galectin-3 - U1 snRNP - pre-mRNA ternary complex is a functional E complex leading to intermediates and products of the splicing reaction and that galectin-3 enters the splicing pathway through its association with U1 snRNP. The scheme of using complexes affinity- or immuno-selected on beads to reconstitute splicing activity in extracts depleted of a specific splicing factor may be generally applicable to other systems.

This article describes the experimental procedures for (a) depletion of U1 snRNP from nuclear extracts, with concomitant loss of splicing activity; and (b) reconstitution of splicing activity in the U1-depleted extract by galectin-3 - U1 snRNP particles bound to beads covalently coupled with anti-galectin-3 antibodies.

Boncuklar Üzerinde Galectin-3 - U1 snRNP Kompleksi ile Birleştirme Etkinliğinin Tamamlayıcısı

Classic depletion-reconstitution experiments indicate that galectin-3 is a required splicing factor in nuclear extracts. The mechanism of incorporation of ...

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously.&#160;This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.