Name: toeprinting analysis of translation initiation complex formation on mammalian mrnas
Uploaded: 2018-05-10T13:00:00.000+00:00
Duration: 10 min 37 s
Description: Watch this Scientific Journal Video about Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs at JoVE.com

Bu eser bir Doğa Bilimleri ve mühendislik Araştırma Konseyi Kanada-keşif Grant'ın (RGPIN-2017-05463), Kanada Vakfı tarafından yenilik-John R. Evans liderleri Fonu (35017), kampüs Alberta yeniliklerin programı ve Alberta Bakanlığı için finanse edildi Ekonomik kalkınma ve ticaret.

Not: RNA ribonükleazlar (RNases) tarafından bozulması için son derece açıktır. RNA sağlam tutmak için standart önlemler almak. Eldiven sık sık değiştirin. Filtre uygulanmış pipet ipuçları, nükleaz ücretsiz plasticware ve kimyasallar nükleaz ücretsiz iletişim kuralının tüm adımlarını kullanın. Kullanım nükleaz içermeyen veya Dietil pyrocarbonate (DEPC)-tedavi su tüm çözümleri.
1. hazırlanması çözümleri
<ol><li>Toeprinting arabellek hazırlamak: 20 mM Tris-HCl (pH 7,6), 100 mM KOAc, 2.5 mM Mg(OAc)2, %5 (w/v) Sükroz, 2 mM dithiothreitol (DTT) ve 0,5 mM spermidine.<ol>
<li>DTT ve spermidine tek kullanımlık aliquots tekrarlanan donma-çözülme döngüsü önlemek için-20 ° C'de depolayın. Not: Kullanmadan önce hemen toeprinting arabelleğine DTT ve spermidine eklenmelidir. DTT ve spermidine yoksun bir çözümü-20 ° C'de depolanan</li>
	</ol>
</li>
	<li>Aliquots 85 mM 5'-guanylyl imidodiphosphate (GMP-PNP) ve 91 mM adenozin trifosfat (ATP) hazırlayın. Aliquots-20 ° C'de depolayın</li>
	<li>450 mL % 6 polyacrylamide - 7 M üre jel karışımı hazırlayın: 67,5 mL % 40 acrylamide:bis-Akrilamid (19:1), üre, 112.5 mL 5 x TBE (Tris/Bor/thylenediaminetetraacetic asit (EDTA)) ve 120 mL su 189 g. Üre 37 ° C su banyosu ya da sıcak bir tabak karıştırma ile ısınma tarafından çözülür. Çözüm filtre (örn., 0,2 mikron nitroselüloz vakum filtre). Not: Çözüm 4 ° C'de en az bir ay depolanabilir. Dikkat: Monomeric Akrilamid deri yoluyla absorbe edilebilir bir nörotoksin var. Cilt teması önlemek için büyük özen (i.e., eldiven, önlük, giyim ve göz koruma). Polimerizasyon için % 100 tamamlanma devam edemeyebilirsiniz gibi polyacrylamide da bakım ile ele alınmalıdır.</li>
	<li>Formamide boya yükleme hazırlamak: % 95'i formamide, 18 mM EDTA, % 0,025 (w/v) Sodyum Lauryl Sülfat (SDS), % 0,025 (w/v) bromophenol mavi, (w/v) % 0,025 Ksilen cyanol. -20 ° C'de mağaza</li>
	<li>10 pmol/μL bir çalışma konsantrasyonu su 100 μL içine astar (5' CTCGATATGTGCATCTGTA; 5' IRDye 800 ile son etiketli) 1 nmol geçiyoruz. Işıktan korunan-20 ° c tek kullanımlık aliquots (yaklaşık 10 µL), içinde saklayın.</li>
</ol>2. mRNA hazırlanması
<ol><li>Polimeraz zincir tepkimesi (PCR) uygun şablonları tarafından mRNA sentezi için DNA şablonları yükseltmek (i.e., genomik DNA veya uygun olarak plazmid DNA). Bir yüksek-sadakat DNA polimeraz üreticinin talimatlarına göre aşağıdaki reaksiyon koşulları (35 döngüleri) ile kullanın: eritmek, 98 ° C, 10 s; TAV, 53 ° C, 20 s; genişletmek, 72 ° C, 30 s. Not: İleri astar (5' AAGCTTAATACGACTCACTATAG) RNA transkripsiyonu için izin vermek için T7 organizatörü sıra içerir; ters astar (5' T51GAATTCGGATCCGACCGTGG) Poli-A kuyruk için transkripsiyonu RNA sağlamak için 51 timin kalıntıları içerir. Vitro plazmid DNA transkripsiyonu RNA da olabileceğine dikkat edin.</li>
	<li>Kullanım bir uygun transkripsiyon kiti vitro için uyarlamak IRES içeren RNA veya DNA şablonundaki kepli RNA. Üreticinin yönergeleri izleyin. RNA örnek standart 20 μL tepki cilt olarak hazırlayın. 37 ° C'de 2 adet RNase free Dnaz 30 dk ile yeni sentezlenmiş RNA tedavi</li>
	<li>Dnaz tedavi RNA 110 seyreltik µL nükleaz ücretsiz su ile 20.000 x g oda sıcaklığında de 110 µL asit fenol, girdap 5 s ve 3 dk santrifüj ekleyin. Sulu faz için yeni bir 1.5 mL microfuge tüp 100 µL kaldırmak, 3 M sodyum asetat ve girdap 2 s. Ekle, % 100 etanol, girdap 5 s, 3 Cilt 10 µL eklemek ve RNA-20 ° C'de gecede çökelti.</li>
	<li>Santrifüj kapasitesi > 20.000 x g 4 ° C ve atma süpernatant 30 dk için. Pelet 500 µL buz gibi % 70 (v/v) etanol ile yıkayın ve aralıklarla tekrarlayın. Büyük bir kısmını süpernatant mümkün olduğunca Aspire edin ve pelet pelet çıkarmak değil dikkatli olmak da 5-10 dakika kuruması.</li>
	<li>RNA nükleaz ücretsiz su bir çalışma konsantrasyonu 0.5 μg/μL vermeye uygun hacmi resuspend. Bu-80 ° C'de depolanan veya hemen kullanılabilir.</li>
</ol>3. Toeprinting tepki
<ol><li>Mix 15 μL, tavşan Retikülosit Lysate (RRL, nükleaz tedavi), RNase inhibitörü, 1 µL 91 mm ATP (1.82 mM son) ve 85 mm GMP-PNP (nihai 1.7 mM) 1.5 mL microfuge tüp içinde 1 μL 1 μL (40 adet). 30 ° c 5 min için kuluçkaya. Not: RRL tekrarlayan donma-çözülme önlemek Tek Kişilik Kullanım için bölünmemeli olmalıdır. Kritik kontrol RRL, RNA'ın ikincil yapı nedeniyle ters transkripsiyon doğal duraklar aydınlatmak için eksik bir tepkidir. Bu denetim için RRL eski yerine koymak için toeprinting tampon ekleyin.</li>
	<li>RNA'ın 0,5 µg (1 µL) ekleyin ve 5 min için 30 ° C'de kuluçkaya.</li>
	<li>Toeprinting arabellek 22 µL ekleyin ve 3 dakika 30 ° C'de kuluçkaya.</li>
	<li>IRDye etiketli astar 0.5 µL (5 pmol) ekleyin ve 10 dakika buz üzerinde kuluçkaya.</li>
	<li>25 mM dNTPs 2 µL ekleyin (son konsantrasyonu: 1 mM), 2 µL 100 mM Mg(OAc)2, 1 µL kuş Myeloblastosis virüs ters transkriptaz (AMV-RT), ve Toeprinting arabelleği 3,5 µL. Son 50 μL birimdir.</li>
	<li>Tepki için 45 dk 30 ° C'de kuluçkaya.</li>
	<li>200 µL nükleaz ücretsiz su ekleyin ve hemen 25:24:1 fenol: kloroform: izoamil alkol (pH yaklaşık 8.0) 250 µL ile ayıklayın. Girdap 5 s ve oda sıcaklığında 3 min için 20.000 x g, santrifüj. Yeni 1.5 mL microfuge Tube sulu faz kaldırmak, % 100 etanol, girdap 5 s, 3 cilt eklemek ve -20 ° C'de gecede çökelti.</li>
	<li>Santrifüj kapasitesi > 20.000 x g 4 ° C ve atma süpernatant 30 dk için. DNA Pelet 500 µL buz gibi % 70 (v/v) etanol ile yıkayın. Santrifüj kapasitesi > 4 ° C'de 15 dakika 20.000 x g Aspire edin kadar süpernatant mümkün ve hava kuru 5-10 dakika süreyle pelet pelet çıkarmak değil dikkatli olun.</li>
	<li>Pelet 6 μL nükleaz ücretsiz su içinde dağıtılması ve boya yükleme formamide 3 μL ekleyin.</li>
</ol>4. sıralama tepkiler
<ol><li>2.1 DNA şablondan ve adım 3.4 IRDye etiketli astar standart sıralama reaksiyonlar, dideoxynucleotides (ddNTPs) zincir sonlandırıcılar kullanma için kullanın. Uygun bir DNA sıralama setini kullanın ve üreticinin yönergeleri izleyin.</li>
	<li>Formamide boya yükleniyor 3 μL ile Mix 6 μL her sıralama tepki.</li>
</ol>5. hazırlık, jel ve Elektroforez sıralama
Not: Bu protokol bir floresan Imager jel tabanlı ve bir 21 cm x 23 cm x 0.2 mm jel kullanır, ancak diğer sıralayıcılar veya jel-boyutları, gerekirse adapte edilebilir.
<ol><li>İyice 0.2 mm boşluk ekleyiciler yanı sıra kısa (23 × 25 cm) ve uzun (30 × 25 cm) cam plakanın % 100 etanol ile temizleyin. Hava kuru.</li>
	<li>% 6 polyacrylamide - 7M üre jel karışımı 30 mL % 10 (w/v) amonyum persülfat (APS) 200 μL ile karıştırın ve tetramethylethylenediamine (TEMED) 20 μL. Kabarcıklar, önlemek için dikkat çekici jel dökmek ve 'köpekbalığı-dişli' jel tarak ekleyin. Oda sıcaklığında 1 h için polimerize jel izin.</li>
	<li>Sıralama cihazı montajı ve rezervuarlar 1 ile doldurun x TBE.</li>
	<li>55 ° C en uygun sıcaklık elde kadar 15dk için 1500 V'de önceden çalıştırın.</li>
	<li>(Kimden adım 3.9 veya 4.2) örnek/yükleme boya karıştırmak için sıralama jel üzerine 5 dk. yük 1 μL için 85 ° C ısı.</li>
	<li>Jel 1500 V 8 h için çalıştırın. Makine gerçek zamanlı bantlarında okuyacaktır.</li>
	<li>Aparatı sökmeye ve Akrilamid jel ve çalışan tampon atmayın.</li>
</ol>

<ol>
	<li>Holcik, M., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+stress+and+apoptosis.">Translational control in stress and apoptosis.</a> Nat Rev Mol Cell Biol. 6 (4), 318-327 (2005).</li><li>Lacerda, R., Menezes, J., Romao, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=More+than+just+scanning:+the+importance+of+cap-independent+mRNA+translation+initiation+for+cellular+stress+response+and+cancer.">More than just scanning: the importance of cap-independent mRNA translation initiation for cellular stress response and cancer.</a> Cell Mol Life Sci. 74 (9), 1659-1680 (2017).</li><li>Sharma, D. K., Bressler, K., Patel, H., Balasingam, N., Thakor, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Eukaryotic+Initiation+Factors+during+Cellular+Stress+and+Cancer+Progression.">Role of Eukaryotic Initiation Factors during Cellular Stress and Cancer Progression.</a> J Nucleic Acids. 2016, 8235121 (2016).</li><li>Gebauer, F., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+translational+control.">Molecular mechanisms of translational control.</a> Nat Rev Mol Cell Biol. 5 (10), 827-835 (2004).</li><li>Anthony, D. D., Merrick, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+40+S+and+80+S+complexes+with+mRNA+as+measured+by+sucrose+density+gradients+and+primer+extension+inhibition.">Analysis of 40 S and 80 S complexes with mRNA as measured by sucrose density gradients and primer extension inhibition.</a> J Biol Chem. 267 (3), 1554-1562 (1992).</li><li>Hartz, D., McPheeters, D. S., Traut, R., Gold, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extension+inhibition+analysis+of+translation+initiation+complexes.">Extension inhibition analysis of translation initiation complexes.</a> Methods Enzymol. 164, 419-425 (1988).</li><li>Shirokikh, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+analysis+of+ribosome-mRNA+complexes+at+different+translation+stages.">Quantitative analysis of ribosome-mRNA complexes at different translation stages.</a> Nucleic Acids Res. 38 (3), 15 (2010).</li><li>Thakor, N., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IRES-mediated+translation+of+cellular+messenger+RNA+operates+in+eIF2alpha-+independent+manner+during+stress.">IRES-mediated translation of cellular messenger RNA operates in eIF2alpha- independent manner during stress.</a> Nucleic Acids Res. 40 (2), 541-552 (2012).</li><li>Liwak, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+suppressor+PDCD4+represses+internal+ribosome+entry+site-mediated+translation+of+antiapoptotic+proteins+and+is+regulated+by+S6+kinase+2.">Tumor suppressor PDCD4 represses internal ribosome entry site-mediated translation of antiapoptotic proteins and is regulated by S6 kinase 2.</a> Mol Cell Biol. 32 (10), 1818-1829 (2012).</li><li>Thakor, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+mRNA+recruits+the+ribosome+via+eIF3-PABP+bridge+to+initiate+internal+translation.">Cellular mRNA recruits the ribosome via eIF3-PABP bridge to initiate internal translation.</a> RNA Biol. , 1-15 (2016).</li><li>Thoma, C., Bergamini, G., Galy, B., Hundsdoerfer, P., Hentze, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+IRES-mediated+translation+of+the+c-myc+and+BiP+mRNAs+by+the+poly(A)+tail+is+independent+of+intact+eIF4G+and+PABP.">Enhancement of IRES-mediated translation of the c-myc and BiP mRNAs by the poly(A) tail is independent of intact eIF4G and PABP.</a> Mol Cell. 15 (6), 925-935 (2004).</li><li>Baird, S. D., Lewis, S. M., Turcotte, M., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+search+for+structurally+similar+cellular+internal+ribosome+entry+sites.">A search for structurally similar cellular internal ribosome entry sites.</a> Nucleic Acids Res. 35 (14), 4664-4677 (2007).</li><li>Merrick, W. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+that+a+single+GTP+is+used+in+the+formation+of+80+S+initiation+complexes.">Evidence that a single GTP is used in the formation of 80 S initiation complexes.</a> J Biol Chem. 254 (10), 3708-3711 (1979).</li><li>Arnaud, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+New+34-Kilodalton+Isoform+of+Human+Fibroblast+Growth+Factor+2+Is+Cap+Dependently+Synthesized+by+Using+a+Non-AUG+Start+Codon+and+Behaves+as+a+Survival+Factor.">A New 34-Kilodalton Isoform of Human Fibroblast Growth Factor 2 Is Cap Dependently Synthesized by Using a Non-AUG Start Codon and Behaves as a Survival Factor.</a> Mol Cell Biol. 19 (1), 505-514 (1999).</li><li>Dmitriev, S. E., Pisarev, A. V., Rubtsova, M. P., Dunaevsky, Y. E., Shatsky, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Conversion+of+48S+translation+preinitiation+complexes+into+80S+initiation+complexes+as+revealed+by+toeprinting.">Conversion of 48S translation preinitiation complexes into 80S initiation complexes as revealed by toeprinting.</a> FEBS Lett. 533 (1-3), 99-104 (2003).</li><li>Faye, M. D., Graber, T. E., Holcik, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+selective+mRNA+translation+in+mammalian+cells+by+polysome+profiling.">Assessment of selective mRNA translation in mammalian cells by polysome profiling.</a> J Vis Exp. (92), e52295 (2014).</li><li>Duncan, C. D. S., Mata, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+cycloheximide+on+the+interpretation+of+ribosome+profiling+experiments+in+Schizosaccharomyces+pombe.">Effects of cycloheximide on the interpretation of ribosome profiling experiments in Schizosaccharomyces pombe.</a> Sci Rep. 7 (1), 10331 (2017).</li><li>Beck, H. J., Janssen, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+Translation+Initiation+Regulation+Mechanism+in+Escherichia+coli+ptrB+Mediated+by+a+5'-Terminal+AUG.">Novel Translation Initiation Regulation Mechanism in Escherichia coli ptrB Mediated by a 5'-Terminal AUG.</a> J Bacteriol. 199 (14), (2017).</li></ol>

Yazarlar çatışma-in-ifşa etmek niyetimiz yok.

Toeprinting doğrudan ilgi bir RNA çeviri başlatma kompleksleri son derece kontrollü koşullar altında oluşumunu desteklemek yeteneği ölçmek için güçlü bir tekniktir. Bu iletişim kuralı toeprinting için basitleştirilmiş bir teknik anlatılmaktadır memeli RNA'ların. Tavşan Retikülosit lysate (RRL) ribozomlar, mantolama, başlatıcı uygun kaynağı olarak kullanılan tRNA ve IRES trans-faktörler (ITAFs) hareket. Deneyci kendi RNA seçim sağlar ve ayrıca kendi seçtiğiniz belirli Kofaktör...

Çevirisi en hücresel enerji tüketir gibi bu çeviri sıkıca düzenlenmiş1olduğunu mantıklı. Diğer taraftan, bozukluk çeviri-protein çıktı bunun sonucunda değişiklik ve -genellikle kanser1,2gibi stres tepkisi ve hastalık durumları görülmektedir. Translasyonel kontrol önemli bir avantajı olan çeşitli uyaranlara3' e cevap için protein çıktılarını hücreleri değiştirebilirsiniz hızıdır. Çeviri yönetmelik böylece hücre yaşam ve ölüm1,2,3etkileyebilecek önemli bir mekanizma temsil eder. Çeviri adımlardan inisiyasyon en son derece düzenli ve karmaşık3' tür. Kısaca, en ökaryotik mRNA'ların hemen hemen her zaman onların çeviri için gerekli olan bir 5' m7G başlık içerir. Cap-bağımlı başlatma gerektirir ökaryotik başlama faktörleri eIF4E, Eıf4a ve eIF4G (cap-tanıma kompleksi 5' uç mRNA ile etkileşim kurmak için). EIF2 bağlı Başlatıcı içeren 43S preinitiation ribozom karmaşık, tRNA ve eIF3, 5' sonuna kadar mRNA yolu ile eIF4G eIF3 ile bir etkileşim işe. Karmaşık preinitiation Eıf4a tarafından destekli mRNA, tarama düşünülmektedir (RNA helikaz) başlama kodonu (AUG) bulunana kadar. Karmaşık 48S başlatma sonradan oluşmuş ve tRNA ribozom P-site teslim edilir. Son olarak, 60'lar ve 40'lı ribozom alt birimleri karmaşık, 80S başlatma oluşturmak için çeviri uzama1,3,4tarafından takip Birleşmiş. Buna ek olarak, iç ribozom giriş siteleri (IRESes) 40'lı ribozomal altbirimde başlama kodonu3için doğrudan işe alma tarafından 5' başlık gereksinimini devre dışı. Fizyolojik stres koşulları küresel mRNA çeviri değişikliklerini anahtar genel ökaryotik başlama faktörleri (mantolama) nedeniyle azalt. Ancak, kanonik olmayan çeviri başlatma mekanizmaları genellikle stres tepkisi protein kodlamak belirli mRNA seçici çeviri için izin ve kanonik olmayan çeviri inisiyasyon bozukluk gibi kanser hastalığı Devletleri'nde karıştığı 1 , 2. gizli RNA gibi hücresel IRESes, düzenleyici elemanlarının izin böyle mRNA'ların2,3çeviri için.
Bir özellikle ilginç yönü translasyonel kontrol mekanizmaları karşı verilen bir mRNA kanonik olmayan çeviri kurallı anlamaktır. Toeprinting belirli RNA'ların içinde vitroinisiyasyon çeviri ayrıntılı mekanik çalışma sağlayan bir tekniktir. Toeprinting genel amacı bir RNA ilgi hangi dizileri, yapı elemanlarının veya aksesuar belirlemek için bir çeviri başlatma koşulları, çeşitli altında ribozom ile karmaşık oluşumu nucleate yeteneği değerlendirmek etmektir verimli çeviri kabul töreni için gerekli faktörlerdir. Örneğin, ribozom işe alım 5' başlık yokluğunda engel ama bir IRES varlığı ile uyarılmış.
Vitro için teknik bir ilkesidir ilgi bir RNA uyarlamak başlatma kompleksleri forma ve tersine çevirmek için uyarlamak izin vermek için çeviri bileşenleri (veya saf bileşenleri) içeren hücre özleri huzurunda kuluçkaya RNA ile belirli bir astar. İstikrarlı RNA-ribozom kompleksleri 3' kenarında ribozom sözde 'toeprint'5,6,7durak ters transkripsiyon neden olur.
Bu iletişim kuralı, ribozomal alt birimleri, mantolama, tRNA ve IRES trans-oyunculuk faktörler (ITAFs) uygun tarafından tavşan Retikülosit lysate (RRL) katkıda bulunmuştur. Bu iletişim kuralı bir diğer avantajı radiolabeled astar yerine fluorescently etiketli bir astar ve floresan jel tabanlı Imager kullanmaktır. Bu astar, radiolabeling gibi jel kurutma ve kuvvetlenmesine ekranına açığa dahil olmak üzere ek adımlar ortadan kaldırır. Floresan bantları gerçek zamanlı olarak, daha fazla çözümleme için izin jel ishal olarak kaydedilir. Her ne kadar çok Millî olan mRNA'ların da bu tekniği8tarafından analiz edilebilir kapağını X'e inhibitörü Apoptozis protein (XIAP) IRES RNA'ın burada, bir örnek kullanılır.
Hücre lysates çeviri sürecinde son çıktı ölçer, Batı analiz farklı olarak, toeprinting bir RNA çeviri başlatma karmaşık oluşumu ölçmek için vitro yaklaşımıdır. Bu indirgemeci yaklaşımın yüzeylerde veya çeviri başlatma düzenleyen faktörler son derece ayrıntılı bir çalışma için izin verir (örn., kaplama veya un kepli mRNA, IRES yapısı, varlığı ya da yokluğu Poli-A kuyruk, belirli protein faktörler, hükmü vs.). Bu nedenle, toeprinting çeviri8 farklı mod veya protein sentezi9,10IRESes gibi bir mRNA yapıları etkileri eğitimi için kullanılabilir.

<table><tbody><tr><td>DEPC (Diethyl pyrocarbonate)</td><td>Sigma</td><td>D5758-100ML</td><td></td></tr><tr><td>TRIS base, Ultrapure</td><td>JT Baker</td><td>4109-01</td><td></td></tr><tr><td>KOAc (Potassium acetate)</td><td>Bio Basic</td><td>PB0438</td><td></td></tr><tr><td>Mg(OAc)&lt;sub&gt;2&lt;/sub&gt; (Magnesium acetate tetrahydrate)</td><td>Bio Basic</td><td>MB0326</td><td></td></tr><tr><td>Sucrose, molecular biology grade</td><td>Calbiochem</td><td>573113-1KG</td><td></td></tr><tr><td>Spermidine</td><td>Sigma</td><td>85558</td><td></td></tr><tr><td>GMP-PNP (Guanosine 5&amp;prime;-[&amp;beta;,&amp;gamma;-imido]triphosphate trisodium salt hydrate) 0.1 M solution</td><td>Sigma</td><td>G0635</td><td></td></tr><tr><td>ATP (Adenosine 5&amp;prime;-triphosphate) disodium salt, 100 mM solution</td><td>Sigma</td><td>A6559</td><td></td></tr><tr><td>19:1 Acrylamide:bis-acrylamide, 40%</td><td>Bio Basic</td><td>A0006</td><td></td></tr><tr><td>Urea</td><td>Bio Basic</td><td>UB0148</td><td></td></tr><tr><td>500mL bottle top filtration units, 0.2 &amp;micro;m</td><td>Sarstedt</td><td>83.1823.101</td><td></td></tr><tr><td>Formamide</td><td>Sigma</td><td>F9037-100ML</td><td></td></tr><tr><td>EDTA (disodium salt, dihydrate)</td><td>Bio Basic</td><td>EB0185</td><td></td></tr><tr><td>SDS</td><td>Bio Basic</td><td>SB0485</td><td></td></tr><tr><td>Bromophenol blue</td><td>Bio Basic</td><td>BDB0001</td><td></td></tr><tr><td>Xylene cyanol FF</td><td>Bio Basic</td><td>XB0005</td><td></td></tr><tr><td>MEGAshortscript T7 transcription kit</td><td>Ambion</td><td>AM1354</td><td></td></tr><tr><td>mMESSAGE mMACHINE T7 transcription kit</td><td>Ambion</td><td>AM1344</td><td></td></tr><tr><td>Acid Phenol:Chloroform (5:1)</td><td>Ambion</td><td>AM9722</td><td></td></tr><tr><td>25:24:1 Phenol:Chloroform:Isoamyl Alcohol</td><td>Invitrogen</td><td>15593-049</td><td></td></tr><tr><td>Rabbit Reticulocyte Lysate (RRL). Should NOT be nuclease-treated.</td><td>Green Hectares, USA</td><td></td><td>Contact Green Hectares, ask for 1:1 RRL:water</td></tr><tr><td>RiboLock RNase Inhibitor (40 U/&amp;micro;L)</td><td>Thermo Fisher</td><td>E00382</td><td></td></tr><tr><td>100 mM dNTPs</td><td>Invitrogen</td><td>56172, 56173, 56174, 56175</td><td>Mix equal parts for a stock of 25 mM each.</td></tr><tr><td>AMV-RT, 10 U/&amp;micro;L</td><td>Promega</td><td>M5101</td><td></td></tr><tr><td>Sequenase Version 2.0 DNA Sequencing Kit</td><td>Thermo Fisher</td><td>707701KT</td><td></td></tr><tr><td>Model 4200 IR2 DNA analyzer</td><td>LI-COR</td><td></td><td>Product has been discontinued</td></tr><tr><td>APS (Ammonium Persulfate)</td><td>Bio Basic</td><td>AB0072</td><td></td></tr><tr><td>TEMED</td><td>Bio Basic</td><td>TB0508</td><td></td></tr><tr><td>Phusion High Fidelity Polymerase</td><td>New England Biolabs</td><td>M0530</td><td></td></tr><tr><td>Turbo Dnase</td><td>Thermo Fisher</td><td>AM2238</td><td></td></tr></tbody></table>

toeprinting analysis of translation initiation complex formation on mammalian mrnas

Çeviri başlatma hızı sınırlaması adım protein sentezi ve hangi hücrelerin protein çıktılarını düzenleyen önemli bir nokta temsil eder. Düzenleme protein sentezi, hücresel stres tepkisi anahtarıdır ve bozukluk birçok hastalık durumlarında, kanser gibi merkezi bir noktada bulunuyor. Örneğin, hücresel stres küresel çeviri inhibisyonu inceltiyorum kap bağımlı başlatma tarafından leads rağmen bazı stres tepkisi proteinler seçerek bir kap bağımsız şekilde çevrilir. Hücresel iç ribozom giriş siteleri (IRESes), gibi sağduyulu RNA düzenleyici elemanlarının bu belirli mRNA'ların çeviri için izin. Böyle mRNA'ların tanımlaması ve düzenleyici mekanizmaları, karakterizasyonu Moleküler biyolojide önemli bir alan olmuştur. Gibi çeviri başlatma için ilgilidir Toeprinting, RNA yapısı ve işlevi için bir yöntemdir. Toeprinting vitro yeteneği değerlendirmek için hangi dizileri, yapı elemanlarının veya aksesuar faktörler ribozom içinde söz konusu belirlemek için koşullar, çeşitli altında ribozomlar ile kararlı kompleksler oluşturmak için RNA transkripsiyonu hedeftir bağlama — için verimli çeviri başlatma öncesi bir imleç. Batı analiz ve polysome profil oluşturma, gibi diğer teknikleri ile birlikte çeviri başlatma düzenlenmesi için mekanizmalar sağlam bir karakterizasyonu için toeprinting sağlar.

XIAP IRES kap bağımsız çeviri başlatma vitro8,10destek yeteneği daha önce anlatmıştık. Toeprinting mekanik ayrıntıları karmaşık XIAP IRES inisiyasyon sorguya çekmek için anahtar yöntem oldu. XIAP IRES (şekil 1A) içeren bir mRNA kodlama bir DNA yapısı transkripsiyonu ve toeprinting analize tabi vitro yapıldı. Burada kullanılan XIAP IRES mRNA m...

Watch this Scientific Journal Video about Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs at JoVE.com

Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Çeviri başlatma karmaşık oluşumu memeli mRNA'ların Toeprinting analizi

Vitro becerisini ölçmek için Toeprinting amaçları için formu çeviri başlatma kompleksleri ile ribozomlara koşulları çeşitli altında RNA transkripsiyonu. Bu iletişim kuralı toeprinting memeli RNA için bir yöntem açıklanır ve kap-bağımlı ve IRES uygulamalı çeviri çalışma için kullanılabilir.

Translation initiation is the rate-limiting step of protein synthesis and represents a key point at which cells regulate their protein output. Regulation ...

toeprinting-analysis-translation-initiation-complex-formation-on

Research

JoVE Journal

Biochemistry

12.4K Görüntüleme.  University of Lethbridge. Vitro becerisini ölçmek için Toeprinting amaçları için formu çeviri başlatma kompleksleri ile ribozomlara koşulları çeşitli altında RNA transkripsiyonu. Bu iletişim kuralı toeprinting memeli RNA için bir yöntem açıklanır ve kap-bağımlı ve IRES uygulamalı çeviri çalışma için kullanılabilir.

Video: Toeprinting Analysis of Translation Initiation Complex Formation on Mammalian mRNAs

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

Nicel ayirt ölçmek küresel çeviri lokalize

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

Biyokimya

Artificial RNA Polymerase II Elongation Complexes for Dissecting Co-transcriptional RNA Processing Events

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA polymerase II and co-transcriptional capping and splicing of the precursor RNA to form the mature mRNA. During mRNA synthesis, the RNA polymerase II elongation complex is a target for regulation by a large collection of transcription factors that control its catalytic activity, as well as the capping, splicing, and 3&#8217;-processing enzymes that create the mature mRNA. Because of the inherent complexity of mRNA synthesis, simpler experimental systems enabling isolation and investigation of its various co-transcriptional stages have great utility.
In this article, we describe one such simple experimental system suitable for investigating co-transcriptional RNA capping. This system relies on defined RNA polymerase II elongation complexes assembled from purified polymerase and artificial transcription bubbles. When immobilized via biotinylated DNA, these RNA polymerase II elongation complexes provide an easily manipulable tool for dissecting co-transcriptional RNA capping and mechanisms by which the elongation complex recruits and regulates capping enzyme during co-transcriptional RNA capping. We anticipate this system could be adapted for studying recruitment and/or assembly of proteins or protein complexes with roles in other stages of mRNA maturation coupled to the RNA polymerase II elongation complex.

Here, we describe the assembly of RNA polymerase II (Pol II) elongation complexes requiring only short synthetic DNA and RNA oligonucleotides and purified Pol II. These complexes are useful for studying mechanisms underlying co-transcriptional processing of transcripts associated with the Pol II elongation complex.

Diseksiyon eş transkripsiyon RNA Işleme etkinlikleri için suni RNA polimeraz II uzama kompleksler

Eukaryotic mRNA synthesis is a complex biochemical process requiring transcription of a DNA template into a precursor RNA by the multi-subunit enzyme RNA ...

Genetik

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed extensive studies of cap-dependent translation and its regulation, high resolution kinetic characterization of this translation pathway is still lacking. Recently, we developed an in vitro assay to measure cap-dependent translation kinetics with single-molecule resolution. The assay is based on fluorescently labeled antibody binding to nascent epitope-tagged polypeptide. By imaging the binding and dissociation of antibodies to and from nascent peptide&#8211;ribosome&#8211;mRNA complexes, the translation progression on individual mRNAs can be tracked. Here, we present a protocol for establishing this assay, including mRNA and PEGylated slide preparations, real-time imaging of translation, and analysis of single molecule trajectories. This assay enables tracking of individual cap-dependent translation events and resolves key translation kinetics, such as initiation and elongation rates. The assay can be widely applied to distinct translation systems and should broadly benefit in vitro studies of cap-dependent translation kinetics and translational control mechanisms.

An In Vitro Single-Molecule Imaging Assay for the Analysis of Cap-Dependent Translation Kinetics

Tracking individual translation events allows for high-resolution kinetic studies of cap-dependent translation mechanisms. Here we demonstrate an in vitro single-molecule assay based on imaging interactions between fluorescently labeled antibodies and epitope-tagged nascent peptides. This method enables single-molecule characterization of initiation and peptide elongation kinetics during active in vitro cap-dependent translation.

Kapak Bağımlı Çeviri Kinetiğinin Analizi için Bir In Vitro Tek Moleküllü Görüntüleme Tahlili

Cap-dependent protein synthesis is the predominant translation pathway in eukaryotic cells. While various biochemical and genetic approaches have allowed ...

Optical Tweezers to Study RNA-Protein Interactions in Translation Regulation

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the structure and function of an RNA can be modulated by various trans-acting factors, such as proteins, metabolites or other RNAs. Frameshifting RNA molecules, for instance, are regulatory RNAs located in coding regions, which direct translating ribosomes into an alternative open reading frame, and thereby act as gene switches. They may also adopt different folds after binding to proteins or other trans-factors. To dissect the role of RNA-binding proteins in translation and how they modulate RNA structure and stability, it is crucial to study the interplay and mechanical features of these RNA-protein complexes simultaneously.&#160;This work illustrates how to employ single-molecule-fluorescence-coupled optical tweezers to explore the conformational and thermodynamic landscape of RNA-protein complexes at a high resolution. As an example, the interaction of the SARS-CoV-2 programmed ribosomal frameshifting element with the trans-acting factor short isoform of zinc-finger antiviral protein is elaborated. In addition, fluorescence-labeled ribosomes were monitored using the confocal unit, which would ultimately enable the study of translation elongation. The fluorescence coupled OT assay can be widely applied to explore diverse RNA-protein complexes or trans-acting factors regulating translation and could facilitate studies of RNA-based gene regulation.

This protocol presents a complete experimental workflow for studying RNA-protein interactions using optical tweezers. Several possible experimental setups are outlined including the combination of optical tweezers with confocal microscopy.

Çeviri Yönetmeliğinde RNA-Protein Etkileşimlerini İncelemek için Optik Cımbız

RNA adopts diverse structural folds, which are essential for its functions and thereby can impact diverse processes in the cell. In addition, the ...

Defining the Program of Maternal mRNA Translation during In vitro Maturation using a Single Oocyte Reporter Assay

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that take place in the cytoplasm in preparation for fertilization and acquisition of totipotency. During oocyte maturation, changes in gene expression depend exclusively on the translation and degradation of maternal messenger RNAs (mRNAs) rather than on transcription. Execution of the translational program, therefore, plays a key role in establishing oocyte developmental competence to sustain embryo development. This paper is part of a focus on defining the program of maternal mRNA translation that takes place during meiotic maturation and at the oocyte-to-zygote transition. In this method paper, a strategy is presented to study the regulation of translation of target mRNAs during in vitro oocyte maturation. Here, a Ypet reporter is fused to the 3&#39; untranslated region (UTR) of the gene of interest and then micro-injected into oocytes together with polyadenylated mRNA encoding for mCherry to control for injected volume. By using time-lapse microscopy to measure reporter accumulation, translation rates are calculated at different transitions during oocyte meiotic maturation. Here, the protocols for oocyte isolation and injection, time-lapse recording, and data analysis have been described, using the Ypet/interleukin-7 (IL-7)-3&#39; UTR reporter as an example.

This protocol describes a reporter assay to study the regulation of mRNA translation in single oocytes during in vitro maturation.

Tek Bir Oocyte Reporter Tahlil Kullanarak In vitro Olgunlaşma Sırasında Maternal mRNA Çeviri Programını Tanımlama

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that ...

Gelişim Biyolojisi

Isolation of Translating Ribosomes Containing Peptidyl-tRNAs for Functional and Structural Analyses

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis by antibiotics and during nascent polypeptide synthesis. Some of these antibiotics, and regulatory nascent polypeptides mostly in the form of peptidyl-tRNAs, inhibit either peptide bond formation or translation termination1-7. These inhibitory events can stop the movement of the ribosome, a phenomenon termed "translational arrest". Translation arrest induced by either an antibiotic or a nascent polypeptide has been shown to regulate the expression of genes involved in diverse cellular functions such as cell growth, antibiotic resistance, protein translocation and cell metabolism8-13. Knowledge of how antibiotics and regulatory nascent polypeptides alter ribosome function is essential if we are to understand the complete role of the ribosome in translation, in every organism.
Here, we describe a simple methodology that can be used to purify, exclusively, for analysis, those ribosomes translating a specific mRNA and containing a specific peptidyl-tRNA14. This procedure is based on selective isolation of translating ribosomes bound to a biotin-labeled mRNA. These translational complexes are separated from other ribosomes in the same mixture, using streptavidin paramagnetic beads (SMB) and a magnetic field (MF). Biotin-labeled mRNAs are synthesized by run-off transcription assays using as templates PCR-generated DNA fragments that contain T7 transcriptional promoters. T7 RNA polymerase incorporates biotin-16-UMP from biotin-UTP; under our conditions approximately ten biotin-16-UMP molecules are incorporated in a 600 nt mRNA with a 25% UMP content. These biotin-labeled mRNAs are then isolated, and used in in vitro translation assays performed with release factor 2 (RF2)-depleted cell-free extracts obtained from Escherichia coli strains containing wild type or mutant ribosomes. Ribosomes translating the biotin-labeled mRNA sequences are stalled at the stop codon region, due to the absence of the RF2 protein, which normally accomplishes translation termination. Stalled ribosomes containing the newly synthesized peptidyl-tRNA are isolated and removed from the translation reactions using SMB and an MF. These beads only bind biotin-containing messages.
The isolated, translational complexes, can be used to analyze the structural and functional features of wild type or mutant ribosomal components, or peptidyl-tRNA sequences, as well as determining ribosome interaction with antibiotics or other molecular factors 1,14-16. To examine the function of these isolated ribosome complexes, peptidyl-transferase assays can be performed in the presence of the antibiotic puromycin1. To study structural changes in translational complexes, well established procedures can be used, such as i) crosslinking to specific amino acids14 and/or ii) alkylation protection assays1,14,17.

A major impediment to biochemical analyses of ribosomes containing nascent peptidyl-tRNAs has been the presence of other ribosomes in the same samples, ribosomes not involved in the translation of the specific mRNA sequence being analyzed. We developed a simple methodology to purify, exclusively, the ribosomes containing the nascent peptidyl-tRNA of interest.

Fonksiyonel ve Yapısal Analizler için Peptidil tRNAs İçeren Çeviri Ribozomlar izolasyonu

Recently, structural and biochemical studies have detailed many of the molecular events that occur in the ribosome during inhibition of protein synthesis ...

Biyoloji

Analysis of Translation Initiation During Stress Conditions by Polysome Profiling

Precise control of mRNA translation is fundamental for eukaryotic cell homeostasis, particularly in response to physiological and pathological stress. Alterations of this program can lead to the growth of damaged cells, a hallmark of cancer development, or to premature cell death such as seen in neurodegenerative diseases. Much of what is known concerning the molecular basis for translational control has been obtained from polysome analysis using a density gradient fractionation system. This technique relies on ultracentrifugation of cytoplasmic extracts on a linear sucrose gradient. Once the spin is completed, the system allows fractionation and quantification of centrifuged zones corresponding to different translating ribosomes populations, thus resulting in a polysome profile. Changes in the polysome profile are indicative of changes or defects in translation initiation that occur in response to various types of stress. This technique also allows to assess the role of specific proteins on translation initiation, and to measure translational activity of specific mRNAs. Here we describe our protocol to perform polysome profiles in order to assess translation initiation of eukaryotic cells and tissues under either normal or stress growth conditions.

Here, we describe a method to analyze changes in the initiation of mRNA translation of eukaryotic cells in response to stress conditions. This method is based on the velocity separation on sucrose gradients of translating ribosomes from non-translating ribosomes.

Polizom profilleme Stres Durumlardaki Çeviri başlatılması Analizi

Precise control of mRNA translation is fundamental for eukaryotic cell homeostasis, particularly in response to physiological and pathological stress. ...

Polysome Fractionation and Analysis of Mammalian Translatomes on a Genome-wide Scale

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. Accordingly, dysregulation of mRNA translation is considered to play a major role in a variety of pathological states including cancer. Ribosomes also host chaperones, which facilitate folding of nascent polypeptides, thereby modulating function and stability of newly synthesized polypeptides. In addition, emerging data indicate that ribosomes serve as a platform for a repertoire of signaling molecules, which are implicated in a variety of post-translational modifications of newly synthesized polypeptides as they emerge from the ribosome, and/or components of translational machinery. Herein, a well-established method of ribosome fractionation using sucrose density gradient centrifugation is described. In conjunction with the in-house developed &#8220;anota&#8221; algorithm this method allows direct determination of differential translation of individual mRNAs on a genome-wide scale. Moreover, this versatile protocol can be used for a variety of biochemical studies aiming to dissect the function of ribosome-associated protein complexes, including those that play a central role in folding and degradation of newly synthesized polypeptides.

Ribosomes play a central role in protein synthesis. Polyribosome (polysome) fractionation by sucrose density gradient centrifugation allows direct determination of translation efficiencies of individual mRNAs on a genome-wide scale. In addition, this method can be used for biochemical analysis of ribosome- and polysome-associated factors such as chaperones and signaling molecules.

Bir genom Ölçeği Polizom Fraksiyonu ve Memeli Translatomes Analizi

mRNA translation plays a central role in the regulation of gene expression and represents the most energy consuming process in mammalian cells. ...

Analysis of Translation in the Developing Mouse Brain using Polysome Profiling

The proper development of the mammalian brain relies on a fine balance of neural stem cell proliferation and differentiation into different neural cell types. This balance is tightly controlled by gene expression that is fine-tuned at multiple levels, including transcription, post-transcription and translation. In this regard, a growing body of evidence highlights a critical role of translational regulation in coordinating neural stem cell fate decisions. Polysome fractionation is a powerful tool for the assessment of mRNA translational status at both global and individual gene levels. Here, we present an in-house polysome profiling pipeline to assess translational efficiency in cells from the developing mouse cerebral cortex. We describe the protocols for sucrose gradient preparation, tissue lysis, ultracentrifugation and fractionation-based analysis of mRNA translational status.

The development of the mammalian brain requires proper control of gene expression at the level of translation. Here, we describe a polysome profiling system with an easy-to-assemble sucrose gradient-making and fractionation platform to assess the translational status of mRNAs in the developing brain.

Polisome Profilleme Kullanarak Gelişen Fare Beyninde Çeviri Analizi

The proper development of the mammalian brain relies on a fine balance of neural stem cell proliferation and differentiation into different neural cell ...

Nörobilim

Rapid In Vivo Fixation and Isolation of Translational Complexes from Eukaryotic Cells

Rapid responses involving fast redistribution of messenger(m)RNA and alterations of mRNA translation are pertinent to ongoing homeostatic adjustments of the cells. These adjustments are critical to eukaryotic cell survivability and &#39;damage control&#39; during fluctuating nutrient and salinity levels, temperature, and various chemical and radiation stresses. Due to the highly dynamic nature of the RNA-level responses, and the instability of many of the RNA:RNA and RNA:protein intermediates, obtaining a meaningful snapshot of the cytoplasmic RNA state is only possible with a limited number of methods. Transcriptome-wide, RNA-seq-based ribosome profiling-type experiments are among the most informative sources of data for the control of translation. However, absence of a uniform RNA and RNA:protein intermediate stabilization can lead to different biases, particularly in the fast-paced cellular response pathways. In this article, we provide a detailed protocol of rapid fixation applicable to eukaryotic cells of different permeability, to aid in RNA and RNA:protein intermediate stabilization. We further provide examples of isolation of the stabilized RNA:protein complexes based on their co-sedimentation with ribosomal and poly(ribo)somal fractions. The separated stabilized material can be subsequently used as part of ribosome profiling-type experiments, such as in Translation Complex Profile sequencing (TCP-seq) approach and its derivatives. Versatility of the TCP-seq-style methods has now been demonstrated by the applications in a variety of organisms and cell types. The stabilized complexes can also be additionally affinity-purified and imaged using electron microscopy, separated into different poly(ribo)somal fractions and subjected to RNA sequencing, owing to the ease of the crosslink reversal. Therefore, methods based on snap-chilling and formaldehyde fixation, followed by the sedimentation-based or other type of RNA:protein complex enrichment, can be of particular interest in investigating finer details of rapid RNA:protein complex dynamics in live cells.

Rapid In Vivo Fixation and Isolation of Translational Complexes from Eukaryotic Cells

We present a technique to rapidly stabilize translational (protein biosynthesis) complexes with formaldehyde crosslinking in live yeast and mammalian cells. The approach enables dissecting transient intermediates and dynamic RNA:protein interactions. The crosslinked complexes can be used in multiple downstream applications such as in deep sequencing-based profiling methods, microscopy, and mass-spectrometry.

Ökaryotik Hücrelerden Çeviri Komplekslerinin Hızlı In Vivo Fiksasyonu ve İzolasyonu

Rapid responses involving fast redistribution of messenger(m)RNA and alterations of mRNA translation are pertinent to ongoing homeostatic adjustments of ...