Bu eser bir İsrail Bilim Vakfı Hibe 514415 (js) ve bir BSF-NSF (MCB) hibe 2016707 (js) tarafından desteklenmiştir. Destek Siegfried ve Irma Ullman ne bağlı elektrikli sandalyeye (js) da kabul edilmektedir.

1. sonda tasarım
Not: Bu protokol piyasada bulunan Oligonükleotid probları zaten fluorophores ile öğesini kullanır. Sondalar belirli dizileri bir hedef için tamamlayıcı bir dizi oluşur mRNA, floresan molekülünü Birleşik her sonda. Alternatif olarak, başka bir yerde5,16açıklandığı gibi probları için floresan işaretleri eklemek mümkündür.
<ol>
	<li>Tasarım smFISH sondalar Arjun Raj (van Oudenaarden Lab, Massachusetts Institute of Technology); tarafından geliştirilen Probe Tasarımcısı16 algoritması kullanılarak Bu el yazması kullanılan smFISH sondalar dizisi malzemeleri tabloda listelenir. Not: Minimum algılanabilir sinyal için bir küme probları ~ 30 sayısıdır. Özellikle çok kısa transkript ölçülür Eğer hassas numarası faiz, gen göre değişebilir.</li>
	<li>Optik kurulum uygun bir boya seçin (malzemelerin tabloya bakın). Not: Cy3 boya veya düşük bir fotoğraf beyazlatma duyarlılık ile optik eşdeğer bir boya önerilir. Çift etiketleme için bir Cy5 ya da bir optik eşdeğer adaydır boya (malzemelerin tabloya bakın). Fırtına görüntüleme etiketli mRNA uygun boyaları kapasitelerini Floresans emisyon birden fazla döngüleri için karakterizedir. Bazı smFISH boya kullanılabilir fırtına görüntüleme için (malzeme tabloya bakın). İki (veya daha fazla) Tutanaklar aynı hücrede farklı genler karşılık gelen görüntü biri olan spectra az veya hiç çakışma var boyalar için Birleşik Oligonükleotid probları seçmelisiniz.</li>
</ol>
2. reaktif hazırlık
Not: Filtre uygulanmış pipet ipuçları ve tüpler gibi RNase free sarf malzemeleri kullanarak örnekleri RNAse free tutmak için ve herhangi bir çalışma ortamı temiz tutmak için önemlidir. Hedef transkript bozulma önlemek için hücre fiksasyon kullanılan tüm reaktifler nükleaz ücretsiz olması gerekir (malzemelerin tabloya bakın) veya diethylpyrocarbonate (DEPC)-tedavi ve sterilize.
<ol>
	<li>Arabellekleri için smFISH
	<ol>
		<li>1 x PBS (fosfat tamponlu tuz, bir fosfat tampon konsantrasyonu 0.01 M ve Sodyum Klorür konsantrasyon 0.154 m, (pH 7,4) ile çözüm) RNase free hazır olun. 10 x PBS RNase free seyreltik (malzemelerin tabloya bakın) nükleaz-serbest su (malzemelerin tabloya bakın) 1:10, v/v oranı.<ol>
			<li>Alternatif olarak DEPC tedavi 1 hazırlamak PBS x.</li>
		</ol>
		</li>
		<li>RNase free hazırlamak 2 x SSC (serum sodyum sitrat arabellek, 0,03 M sodyum sitrat, (pH 7,0) 0.3 M NaCl). RNase free seyreltik 20 x SSC (malzemelerin tabloya bakın) nükleaz ücretsiz su 1:10 v/v oranı.<ol>
			<li>Alternatif olarak, DEPC tedavi 2 hazırlamak x SSC.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Oligonükleotid sonda hisse senedi çözüm.
	<ol>
		<li>Bir sonda hazır 25 µM. oluşturmak için TE arabelleği (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) 200 µL kurutulmuş Oligonükleotid sonda grubunda yeniden dağıtılması Mix de tarafından yukarı ve aşağı, pipetting ve sonra girdap ve santrifüj kısaca.</li>
		<li>Donma ve hisse senedi çözüm tüp tezcan önlemek için karşılık gelen tutarı çalıştırmak tek bir deneysel kullanılacak beklenen stok çözümün birkaç aliquots edin. -20 ° c veya daha düşük stok çözüm depolamak ve ışıktan korumak. Not: 250 hibridizasyon reaksiyonlar 5 nmol sonda kümesi sağlar.</li>
	</ol>
	</li>
	<li>Hibridizasyon arabellek (aşağıdaki Skinner vd. 7 ):
	<ol>
		<li>5 mL su nükleaz ücretsiz 50 mL polipropilen alt konik tüp ekleyin. Dextran sülfat 1 g için su ekleyin ve dinç vortexing tarafından çözülür. Kadar kabarcıklar (~ 30 min) ortadan içeriği bir orbital shaker karıştırın.</li>
		<li>Deiyonize suyla formamide, E. coli tRNA, 10 mg çözüm 3,530 µL 20 SSC x 1 mL, 100 µL 200 mM vanadyl-ribonucleoside kompleks ve 50 mg/ml BSA 40 µL ekleyin. Homojen olana son hacim için 10 mL DEPC tedavi su veya su nükleaz-Alerjik ve girdap eklenmesi tarafından çözüm getirin. Not: donma ve erime çözüm önlemek için karşılık gelen tutarı çalıştırmak tek bir deneysel kullanılacak beklenen stok çözümün birkaç aliquots olun. Mağaza-20 ° C'de hisse senedi çözüm Şişeyi açmadan önce oda sıcaklığına kadar sıcak formamide bildirin emin olun. Arka plan azaltmak için en uygun formamide konsantrasyonu (% 10-40 hacmen oranı) kalibre için önerilmektedir. 
		Uyarı: UYARI! Formamide çok zehirli ve bilinen bir teratogen. Gözleri ya da deri, solunum veya sindirim ile temasından sakının. Bir duman başlık altında koruyucu eldiven ve önlük giyerken başa.</li>
		<li>Çözüm 0,22-µm filtreden geçirilerek sterilize. Aliquots içinde tutmak ve bir yıl için-20 ° C depolama yapar.</li>
	</ol>
	</li>
	<li>1 x PBS'ye % 37 formaldehit (v/v) ekleyerek fiksasyon arabellek (1 x PBS % 4.6 formaldehit) hazırlamak (bkz. 2.1.1) 1:8 v/v oranı ve girdap. DİKKAT: UYARI! Formaldehit çok zehirli ve bilinen bir kanserojen. Bir duman başlık altında koruyucu eldiven ve önlük giyerken başa.</li>
	<li>SmFISH için yıkama arabellek hazırlamak (% 20 formamide 2 x SSC) 2'ye deiyonize suyla formamide ekleyerek x SSC (bkz: 2.1.2) 1:4 v/v oranı ve girdap.</li>
	<li>Görüntüleme arabellek arabellek yıkamak için 5 mM cysteamine ve oksijen gidericiler (7 µM glikoz oksidaz, 56 nM katalaz ve % 10 glikoz (w/v)) ekleyerek smFISH için hazırlamak (% 20 formamide 2 x SSC)</li>
	<li>Fırtına arabellekleri
	<ol>
		<li>Arabellek A 50 mM Tris-HCl ve 10 mM NaCl nükleaz ücretsiz su ekleyerek hazırlayın. Not: RT yıl boyunca dükkanda.</li>
		<li>Arabellek B 50 mM Tris-HCl, 10 mM NaCl ve % 10 w/v ekleyerek glikoz nükleaz ücretsiz su için hazırlayın. Not: Mağaza 4 ° C'de için bir yıl kadar.</li>
		<li>MEA arabellek 77 mg cysteamine 1 ml (1 M çözüm sağlar) arabelleği A çözülerek hazırlayın. Not: Bu 4 ° C'de 1 ay boyunca saklanır.</li>
		<li>Gloxy arabellek 8,440 AU (rasgele adet) glikoz oksidaz ekleyerek hazırlamak ve 1 ml 70,200 AU katalaz tampon A. Not: 50 x hisse senedi çözüm, yapar o-ebilmek var olmak stok 4 ° C'de 1 ay için.</li>
		<li>MEA arabellek ve 1 Gloxy arabellek arabellek B. x 50 mM ekleyerek fırtına için görüntüleme arabellek hazırlamak Not: Görüntüleme arabellek fırtına için 5 mM cysteamine, oksijen gidericiler (7 µM glikoz oksidaz ve 56 nM katalaz) 50 mm Tris ile 10 mM NaCl ve % 10 glikoz pH 8.0 oluşur. Sadece görüntüleme önce hazırlamak, saklanır ve RT yaklaşık 2 saat için kullanılır.</li>
	</ol>
	</li>
</ol>
3. örnek fiksasyon
<ol>
	<li>Bakteri hücreleri (örneğin, E. büyümek</li></ol>coli MG1655) büyüme medya seçimi (örneğin, LB orta) gecede inan orbital shaker 260 devir/dakika ve 37 ° c Not: arka plan sondalar non-spesifik bağlanması nedeniyle belirlemek için faiz gen silinmiş bir yük ölçümlerde, (bkz: şekil 1 ve ΔsodB içinde Δgalk aynı yordamı yapılmalıdır Şekil 2).
	<li>Gecede kültür 1: taze ortamda 100 sulandırmak ve optik yoğunluğu (OD600) bir Spektrofotometre 0,2 - değeri kadar her ~ 1 h ölçü birimi 0.4; 4 mL kültür-meli var olmak yeterli. Not: Seçilen mikroskop faz kontrast veya fark girişim kontrast yetenekleri varsa, E. coli dış membran 2 mikron lipofilik floresan marker ile Etiketlenmiş (malzemelerin tabloya bakınız), hangi eklenmektedir Bakteriyel süspansiyon 20 dk önce fiksasyon17. Fiksasyon ve daha ileri tedavi aşağıda açıklandığı gibi gerçekleştirilir. Bir farklı emisyon spektral örtüşme etiketli-sonda seti ile en aza indirmek için spektrum, sahip bir floresan işaretçisi seçmeye özen göstermelidir.</li>
	<li>Pelet hücreleri tarafından Santrifüjü 4 ° C'de 4500 g de 5 min için Süpernatant tüm tüpler kaldırın.</li>
	<li>1 mL 1 x PBS için her tüpün ekleyin ve hücre-hücre toplama en aza indirmek için Pelet resuspend. Sonra yavaşça fiksasyon tampon ve girdap 4 mL ekleyin.</li>
	<li>24 ° C'de 30 min için bir orbital Çalkalayıcı-260 devirde örneklerinde kuluçkaya</li>
	<li>Pelet hücreleri tarafından Santrifüjü 10 dk, 1000 g, 4 ° C. Süpernatant kaldırın. 1 mL 1 x PBS ekleyin.</li>
	<li>Süspansiyonlar (malzemelerin tabloya bakın) 1.8 µL alt konik mikro-santrifüj tüpleri için aktarmak ve iki kere 3,6 adımı yineleyin.</li>

4. örnek Permeabilization
<ol>
	<li>Süpernatant çok dikkatli bir şekilde çıkarın. Küçük hacimli Pipetler, gerekirse, pelet dışında tüm sıvı kaldırmak kullanın.</li>
	<li>300 µL DEPC tedavi su veya su nükleaz ücretsiz resuspend. 350 µL yüksek dereceli mutlak etanol (% 99) ekleyin ve karışımı yavaşça tüp ters çevirme. Etanol ve mix yeniden, son etanol konsantrasyonu % 70 (v/v oranı) ulaşmak için başka bir 350 µL ekleyin. DİKKAT: UYARI! Etanol yanıcı.</li>
	<li>Örnek 20 rpm (RT) oda sıcaklığında 1 h için bir tüp rotator ile döndürme, veya bir gece 4 ° C'de. Örnekleri 4 ° C'de bir haftaya saklanabilir.</li>
</ol>
5. hibridizasyon
<ol>
	<li>Pelet hücreleri tarafından Santrifüjü 7 dk, 750 x g, 4 ° C. Süpernatant kaldırın.</li>
	<li>1 mL % 20 örnekleri arabelleğe yıkama ve ayakta birkaç dakika veya pipet Pelet tamamen erimesi için bırakın ekleyin.</li>
	<li>Pelet hücreleri Santrifüjü için 750 x g, 4 ° c de 7 min tarafından</li>
	<li>Süpernatant çok yavaşça pipetting tarafından çıkarın. Küçük hacimli Pipetler gerekirse, pelet dışında tüm sıvı kaldırmak kullanın.</li>
	<li>Oligonükleotid sonda ayarla hisse senedi çözüm hibridizasyon arabellek aliquot böylece son Oligonükleotid konsantrasyon 250 eklemek nM; girdap şiddetle. Not: Bir iki veya daha fazla farklı hedef mRNA'ların aynı hücrede aynı anda etiketleyebilirsiniz. Her iki hedef grupları sonda hibridizasyon arabelleğe ekleyin. Boyalar farklı emisyon spektral örtüşme (örneğin, Cy3 ve Cy5) en aza indirmek için spectra sahip seçmek için özen göstermelidir. Fırtına görüntüleme için amaçlanan örnekleri ayarla (örneğin, tablo malzemelerin) fırtına için uygun bir boya ile konjuge bir Oligonükleotid sonda ile melezleşmiştir emin olun.</li>
	<li>(Bkz. Adım 5,4) örnekleri (çözüm oldukça viskoz) kabarcıklar nesil kaçınırken Oligonükleotid probları içeren 50 µL hibridizasyon arabelleği askıya.</li>
	<li>Örnekleri gece karanlıkta 30 ° C sıcak bir blok üzerinde bırakın. Not: Bu örnekleri 6 ay 4 ° C'de depolanmış olabilir</li>
</ol>
6. çamaşır
<ol>
	<li>Görüntü için her örnek için bir yeni microcentrifuge tüp kullanın. 1 mL yıkama arabellek ekleyin.</li>
	<li>10-15 µL melezleşmiştir örneklerinden yıkama tamponu ve mix/girdap içeren yeni tüp ekleyin.</li>
	<li>Pelet hücreleri tarafından 7 dakika aralıklarla, 750 x g 4 ° C'de Süpernatant kaldırın. Not: arka plan azaltmak için 30 ° C'de 1 h için kuluçkaya</li>
	<li>İki kez daha fazla yıkamak (1 mL yıkama arabellekte resuspend, santrifüj kapasitesi ve Pelet kaldırın).</li>
	<li>25 µL yıkama arabellekte resuspend. Not: bir fotoğraf beyazlatma azaltmak için yıkama arabelleğe tek molekül Floresans deneyler6boya kararlılığını artırmak için sistem (2,6) atma bir oksijen ekleyebilirsiniz.</li>
</ol>
7. görüntüleme için örnek hazırlanması
Not: Hücreleri floresan ve faz kontrast mikroskop altında uygun görüntüleme izni vermesi için immobilize gerekir. Hangi bakış farklı alanları farklı odak uçaklar yansıma örnekleri hazırlamak için aşağıdaki yöntemleri kullanılabilir.
<ol>
	<li>Özel jel hazırlık
	<ol>
		<li>150 mg özel 10 mL 2 x SSC arabelleğe ekleyin. 2 eklemek değil x SSC için özel, ya da o değil düzgün dağıtılması.</li>
		<li>Mikrodalga fırında 10-15 s her zaman-e kadar büyük kabarcıklar oluşmaya başlar. Birkaç dakika soğuması için bir kenara koyun.</li>
		<li>Böylece slaytın Merkezi maruz kalır ayıran bir silikon çerçeve slayt üzerinde yer.</li>
		<li>Bir 10 mm çapında (1-2 mm kalınlığında) katı halka slaytın ortasına yerleştirin ve jel küçük bir miktar, sızdırmazlık için mevduat. Sertleşmesine o için birkaç dakika bekleyin.</li>
		<li>Yüksek kubbe şekli kurdu kadar daha jöle ekleyin. Sertleşmesine bunun için 10 dakika bekleyin ve (iyi cımbız veya başka bir yöntemi kullanarak) yüzük kaldırın.</li>
		<li>(Bkz: 6.5) yıkanmış bakteriyel hücre jel ve mühür #0 coverslip slayt ile ~ 10 μL Kasası.</li>
	</ol>
	</li>
	<li>Odası numune hazırlama smFISH için
	<ol>
		<li>Alternatif olarak (için adım 7.1) örnekleri (bkz: 6.5) yıkanmış bakteri hücreleri Poli-D-lizin-kaplı cam alt tek kullanımlık plastik petri yemekleri immobilizing tarafından görüntüleme için hazır olun.</li>
		<li>Karanlık gecede görselleştirme hücre yüzeyine yapışma sağlamak için önce oda sıcaklığında örneklerinde kuluçkaya. Görselleştirme daha önce bir kez yıkama arabellek ile yıkayın (. 5); smFISH (2,6) için yıkama buffer(2.5) veya görüntüleme arabellek ile ıslak örnek tutmak.</li>
	</ol>
	</li>
	<li>Fırtına için odası numune hazırlama
	<ol>
		<li>Örnekleri fırtına için Poli-D-lizin-kaplı cam alt tek kullanımlık plastik petri yemekler üzerinde görüntüleme için hazır olun.</li>
		<li>Örnekleri, RT, karanlık gecede kuluçkaya. Görselleştirme yıkama daha önce bir kez ile yıkama arabellek için smFISH (2.5); ve görüntüleme arabellek fırtına (2.7.5) ekleyin.</li>
	</ol>
	</li>
</ol>
8.Transkript görselleştirme
<ol>
	<li>Görüntü hücre motorlu bir sahne ile donatılmış geniş alanlı floresan mikroskop ile (malzemelerin tabloya bakın). Not: Bir boya ile floresan emisyon birden fazla döngüleri yetenekli etiketli hücreleri fırtına değiştirilmek üzere kullanın. 3D süper çözünürlük görüntüleme sistemi kullanarak örnek resim (örneğin, malzemelerin tabloya bakın).</li>
	<li>(Önerilen) kullan bir 60-100 x N.A &#62; 1.3 yağı daldırma faz kontrast objektif lens cıva veya metal halide lamba; gibi güçlü bir ışık kaynağı ile LED tabanlı ışık kaynakları da önerilir.</li>
	<li>Bir standart soğutmalı CCD kamera, ideal olarak düşük ışık düzeyi görüntüleme hızı (biz kullanmak yerine bir kamera ile 16 µm piksel boyutu) için optimize edilmiş kullanımı (malzeme tabloya bakın). Not: Kullanım bir soğutulmuş EMCCD (elektron birleştiğinde şarj cihaz çarparak) kamera CCD kamera algılama, özellikle tek moleküllerin engeller termal gürültü azaltmak gereklidir.</li>
	<li>Filtresi kullan seçilen fluorophores için uygun ayarlar.</li>
	<li>Düzgün hücre sınırlarını belirlemek için her örnek faz kontrast optik ile veya dış hücre membran fluorescently etiketleme görünümünde farklı alanları görüntülerini elde etmek. Görüntüleri tüm kanallar için farklı odak uçaklar (z-yığın), (genellikle 13 dilimleri ayırarak tarafından 250 nm alınır). Not: Mikroskop ve filtre setleri, motorlu sahne ticari tarafından kontrol edilmelidir (malzemelerin tabloya bakın) ya da bir yığın görüntülerin sırayla yakalayabilir şirket içi bilgisayar yazılımı.</li>
</ol>
9. veri analizi
<ol>
	<li>Görüntü yığınları veri analizi için uygun bir biçime dönüştürme.</li>
	<li>Hedef kopya sayısını tahmin mRNA floresan foci hücrede toplam yoğunluğunu, yerine ayrık 'noktalar' şu anda mevcut diğer iletişim kuralları olduğu gibi sayma.</li>
	<li>Görüntü analizi ile açık kaynak yazılım18 veya özel olarak oluşturulmuş bir program ile yerine getirir. Veri ayrıntıları için bkz: görüntüleme ve analiz Skinner vd. 7</li>
</ol>

<ol>
	<li>Tsimring, L. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Noise+in+biology.">Noise in biology.</a> Reports Prog. Phys. 77 (2), 26601 (2014).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+degradation+and+noise+of+small+RNA-controlled+genes+in+a+switch+activated+network+in+Escherichia+coli.">Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.</a> Nucleic Acids Res. 44 (14), 6707-6720 (2016).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+post-transcriptional+regulation+on+phenotypic+noise+in+Escherichia+coli.">Effects of post-transcriptional regulation on phenotypic noise in Escherichia coli.</a> Nucleic Acids Res. 41 (9), 4825-4834 (2013).</li><li>van Gijtenbeek, L. A., Robinson, A., van Oijen, A. M., Poolman, B., Kok, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+Spatial+Organization+of+mRNA,+Plasmids,+and+Ribosomes+in+a+Bacterial+Host+Overexpressing+Membrane+Proteins.">On the Spatial Organization of mRNA, Plasmids, and Ribosomes in a Bacterial Host Overexpressing Membrane Proteins.</a> PLOS Genet. 12 (12), e1006523 (2016).</li><li>Raj, A., vanden Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes.">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nat. Methods. 5 (10), 877-879 (2008).</li><li>Raj, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+individual+endogenous+RNA+transcripts+in+situ+using+multiple+singly+labeled+probes.">Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes.</a> Methods Enzymol. 472 (10), (2010).</li><li>Skinner, S. O., La Sep&#250;lveda, ., Xu, H., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+mRNA+copy+number+in+individual+Escherichia+coli+cells+using+single-molecule+fluorescent+in+situ+hybridization.">Measuring mRNA copy number in individual Escherichia coli cells using single-molecule fluorescent in situ hybridization.</a> Nat. Protoc. 8 (6), 1100-1113 (2013).</li><li>Barakat, T. S., Gribnau, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+DNA-RNA+fluorescent+in+situ+hybridization+(FISH)+to+study+X+chromosome+inactivation+in+differentiated+female+mouse+embryonic+stem+cells.">Combined DNA-RNA fluorescent in situ hybridization (FISH) to study X chromosome inactivation in differentiated female mouse embryonic stem cells.</a> J. Vis. Exp. (88), e51628 (2014).</li><li>Chen, K. H., Boettiger, A. N., Moffitt, J. R., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+imaging.+Spatially+resolved,+highly+multiplexed+RNA+profiling+in+single+cells.">RNA imaging. Spatially resolved, highly multiplexed RNA profiling in single cells.</a> Science. 348 (6233), aaa6090 (2015).</li><li>van Gijtenbeek, L. A., Kok, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+messengers:+An+update+and+outlook+on+RNA+visualization+in+bacteria.">Illuminating messengers: An update and outlook on RNA visualization in bacteria.</a> Front. Microbiol. 8, 1-19 (2017).</li><li>Fei, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+in+vivo+target+search+kinetics+of+regulatory+noncoding+RNA.">Determination of in vivo target search kinetics of regulatory noncoding RNA.</a> Science. 347 (6228), 1371-1374 (2015).</li><li>Moffitt, J. R., Pandey, S., Boettiger, A. N., Wang, S., Zhuang, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spatial+organization+shapes+the+turnover+of+a+bacterial+transcriptome.">Spatial organization shapes the turnover of a bacterial transcriptome.</a> Elife. 5, 1-22 (2016).</li><li>Ong, W. Q., Citron, Y. R., Sekine, S., Huang, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Live+Cell+Imaging+of+Endogenous+mRNA+Using+RNA-Based+Fluorescence+"Turn-On"+Probe.">Live Cell Imaging of Endogenous mRNA Using RNA-Based Fluorescence "Turn-On" Probe.</a> ACS Chem. Biol. , (2016).</li><li>Golding, I., Paulsson, J., Zawilski, S. M., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+kinetics+of+gene+activity+in+individual+bacteria.">Real-time kinetics of gene activity in individual bacteria.</a> Cell. 123 (6), 1025-1036 (2005).</li><li>Golding, I., Cox, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+8+Spatiotemporal+Dynamics+in+Bacterial+Cells:+Real-Time+Studies+with+Single-Event+Resolution.">Chapter 8 Spatiotemporal Dynamics in Bacterial Cells: Real-Time Studies with Single-Event Resolution.</a> Methods Cell Biol. 89 (8), (2008).</li><li>So, L. H., Ghosh, A., Zong, C., Sepulveda, L. A., Segev, R., Golding, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+properties+of+transcriptional+time+series+in+Escherichia+coli.">General properties of transcriptional time series in Escherichia coli.</a> Nat. Genet. 43 (6), 554-560 (2011).</li><li>Spahn, C., Endesfelder, U., Heilemann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Super-resolution+imaging+of+Escherichia+coli+nucleoids+reveals+highly+structured+and+asymmetric+segregation+during+fast+growth.">Super-resolution imaging of Escherichia coli nucleoids reveals highly structured and asymmetric segregation during fast growth.</a> J. Struct. Biol. 185 (3), 243-249 (2014).</li><li>Sliusarenko, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbetracker+software.">Microbetracker software.</a> Mol Microbiol. 80 (3), 612-627 (2012).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, 8 (2006).</li><li>Arbel-Goren, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcript+degradation+and+noise+of+small+RNA-controlled+genes+in+a+switch+activated+network+in+Escherichia+coli.">Transcript degradation and noise of small RNA-controlled genes in a switch activated network in Escherichia coli.</a> Nucleic Acids Res. 44 (14), 6707-6720 (2016).</li><li>Brandt, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+two-state+stabilization-change+mechanism+for+proton-pumping+complex+I.">A two-state stabilization-change mechanism for proton-pumping complex I.</a> Biochimica et Biophysica Acta (BBA) - Bioenergetics. 1807 (10), 1364-1369 (2011).</li></ol>

Yazarlar ifşa gerek yok.

E. coli hücrelerdeki smFISH yöntem2kullanarak farklı genler transkript sayısı bizim laboratuvar olarak ölçülen var. Kısacası, bu yordamı aşağıdaki adımlardan oluşur: hücre fiksasyon, membranlar sonda penetrasyon için izin vermek için permeabilization sonda hibridizasyon ve örnek bir standart floresan mikroskop kullanarak görüntüleme. Bu yordam önceden yayınlanmış olanlar bazı değişiklikler6,7,</s...

Stochasticity gen ifadesinin temel ve kaçınılmaz bir unsuru ve hücre-hücre heterojenite1, transkriptler ve proteinler2,3düzeyinde hem de açmaktadır. İyi tanımlanmış koşullar altında hücreler arasında değişkenlik miktarının benzersiz bir pencere gen ekspresyonu ve onun yönetmelik altında yatan temel işlemleri halinde sunmaktadır. Bakterilerde hücre-hücre heterojen bir önemli kaynağı transkripsiyon düzeyinde gerçekleşir. Transkript numaraları sadece stochasticity transkripsiyonu, aynı zamanda düzenleme gibi çoğu işlemleri nedeniyle küçük RNA'ların ve RNAases2tarafından değişir. Doğrudan erişim Bu heterojenlik nicel bir moda bir fluorescently smFISH içinde belirli bir gen bireysel Tutanaklar etiketleyerek yoludur. Bu metodoloji algılama ve belirli RNA molekülleri, hücre altı yerelleştirme sabit, bireysel bakteri hücreleri4sağlar. mRNA'ların seçmeli olarak faiz5,6transkript bağlamak için tasarlanmış fluorescently etiketli ~ 20 Bankası-uzun oligonucleotides bir dizi melezleşmiştir. Birden çok etiket yukarıda arka plan Floresans algılama sağlar ve bireysel mRNA molekülleri kırınım-sınırlı noktalar bir floresan mikroskop altında7 (bkz: şekil 1) olarak görünür. MRNA molekülleri, tamamlayıcı oligomer probları ikincil fluorescently etiketli muhabir teknikleri8kullanarak algılanır konjuge anhidridler (örneğin, biotin veya digoxigenin) taşımak etiketleme için diğer yaklaşım vardır.
Tutanaklar, ek olarak smFISH hakkında kantitatif bilgi başka yöntemleri de vardır. Kuzey gibi bazı leke veya kantitatif PCR, toplu yoklama ve böylece ne mRNA kopya sayısı ne de tek tek hücreler içindeki konumlarını ölçebilirsiniz. Bu nedenle bu yöntemler hücre hücre değişkenlik ölçmek uygun değildir. Hata-sağlam Floresans in situ hibridizasyon (MERFISH) hem RNA'ların kopya numarası hücrelerindeki hem de denilen hücre içi konumlarını miktar multiplexed için izin veren bir son görüntü tabanlı teknik geliştirilmiştir. MERFISH tanımlanmış bir arada sabit sayıda Oligonükleotid fluorescently etiketli sonda gelen oluşan benzersiz bir barkod atama temel alır. Bu barkodları smFISH ölçümleri sıralı tur olarak okunduğu, photobleaching ile hibridizasyon, böylece artan işlem hacmi iki büyüklük9,10tarafından aşağıdaki her yuvarlak. Bu teknik bir otomatik akışkan sistemi ve sonda kümesinin uygun tasarım gerektirir.
Birden çok floresan Stokastik optik imar mikroskobu (fırtına)11gibi roman süper çözümleme teknikleri ile birlikte bireysel transkript etiketlerine göre ile birlikte çözünürlükte panolarında bir artış sağlar transkript hücre altı lokalizasyonu. FIRTINADA, Floresans emisyon (yanıp sönen) prob molekül başına birden fazla döngüleri için uygun kombinasyonu floresan problar ve görüntüleme arabellek sağlar. Fırtına da E. coli transcriptome görüntü ve aynı anda transkriptlerinizin faiz12etiketleme tarafından RNA, genom çapında mekansal organizasyonu gözlemlemek için kullanılabilir.
Yukarıda gözden tüm tek hücreli yöntemleri sabit hücrelerdeki transkript görüntüleme üzerinde temel alır. Bu nedenle, onlar transkript hücrelerdeki Kinetik özelliklerinin ile ilgili herhangi bir bilgi vermeyin. Transkript canlı hücreleri13izlemek için mRNA'ların ilgi siteleri bağlama, bir dizi gen füzyonu tarafından etiketli. Bu ikinci o zaman bakteriyofaj gibi yeşil flüoresan protein (GFP)10,14,15floresan bir protein için erimiş MS2 kat protein gibi bir RNA-bağlayıcı protein tarafından tanınır.
Burada DNA probları fluorescently etiketli smFISH deneyler, kullanmak için bir dizi bireysel mRNA'ların özellikle E. colietiketleme yöntemi açıklanmaktadır. Ayrıca, aynı etiketleme şeması fırtına ölçümleri ile küçük değişiklikler için kullanılan gösterir.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Dextran sulfate sodium salt</td>
			<td >Sigma-Aldrich</td>
			<td >D8906</td>
			<td ></td>
		</tr>
		<tr >
			<td >Pure Ethanol, 99.5%, ACS reagent, absolute</td>
			<td >Mallinckrodt Baker - Avantor</td>
			<td >8025.25</td>
			<td ></td>
		</tr>
		<tr >
			<td >Diethylpyrocarbonate (DEPC)</td>
			<td >Sigma-Aldrich</td>
			<td >D5758</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free 20X SSC</td>
			<td >Life Technologies/Ambion</td>
			<td >AM9763</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free 10X PBS</td>
			<td >Life Technologies/Ambion</td>
			<td >AM9625</td>
			<td ></td>
		</tr>
		<tr >
			<td >TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) BioUltra, for molecular biology</td>
			<td >Sigma-Aldrich</td>
			<td >93283</td>
			<td ></td>
		</tr>
		<tr >
			<td >nuclease-free water</td>
			<td >Thermo Fisher Scientific</td>
			<td >10977035</td>
			<td ></td>
		</tr>
		<tr >
			<td >Formaldehyde solution for molecular biology, 36.5-38% in water</td>
			<td >Sigma-Aldrich</td>
			<td >F8775</td>
			<td ></td>
		</tr>
		<tr >
			<td >Deionized formamide, nuclease free</td>
			<td >Thermo Fisher Scientific/Ambion</td>
			<td >AM9342</td>
			<td ></td>
		</tr>
		<tr >
			<td >E. coli tRNA (ribonucleic acid, transfer type xx from escherichia)</td>
			<td >Sigma-Aldrich</td>
			<td >R1753-500UN</td>
			<td ></td>
		</tr>
		<tr >
			<td >UltraPure BSA (50mg/ml)</td>
			<td >Thermo Fisher Scientific/Ambion</td>
			<td >AM2616</td>
			<td ></td>
		</tr>
		<tr >
			<td >Vanadyl-ribonucleoside complex,VRC, 200 mM</td>
			<td >New England Biolab</td>
			<td >S1402S</td>
			<td ></td>
		</tr>
		<tr >
			<td >Poly-L-Lysine</td>
			<td>Sigma</td>
			<td >P4707</td>
			<td ></td>
		</tr>
		<tr >
			<td >Cysteamine and oxygen</td>
			<td >Sigma-Aldrich</td>
			<td >30070</td>
			<td ></td>
		</tr>
		<tr >
			<td >Glucose Oxidase from Aspergillus niger, Type VII, 50KU</td>
			<td >Sigma-Aldrich</td>
			<td >G2133</td>
			<td ></td>
		</tr>
		<tr >
			<td >Catalase</td>
			<td >Sigma-Aldrich</td>
			<td >C40</td>
			<td ></td>
		</tr>
		<tr >
			<td >D-glucose</td>
			<td >Sigma-Aldrich</td>
			<td >G8270</td>
			<td ></td>
		</tr>
		<tr >
			<td >D-fucose</td>
			<td >Sigma-Aldrich</td>
			<td >F8150</td>
			<td ></td>
		</tr>
		<tr >
			<td >Vybrant DiO Cell-Labeling Solution</td>
			<td >Life Technologies</td>
			<td >V2286</td>
			<td ></td>
		</tr>
		<tr >
			<td >Agarose,low melting reagent</td>
			<td >Sigma-Aldrich</td>
			<td >A9414</td>
			<td ></td>
		</tr>
		<tr >
			<td >Adhesive silicone isolator 24-2mm Dia. X 1.8 mm depth JTR24R-A2-2.0</td>
			<td >Grace Bio-Labs</td>
			<td >JTR24R-A2-2.0 666208</td>
			<td ></td>
		</tr>
		<tr >
			<td >poly-D-lysine-coated glass bottom Glass Bottom Culture Dishes</td>
			<td >MatTek Corporation</td>
			<td >P35GC-1.5-14-C</td>
			<td ></td>
		</tr>
		<tr >
			<td >Super life nitrile powder free examination gloves</td>
			<td >Supermax</td>
			<td >TC-N-9889</td>
			<td ></td>
		</tr>
		<tr >
			<td >Brand sterilization incubator tape</td>
			<td >Sigma-Aldrich</td>
			<td >BR61750</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microcentrifuge tubes (1.8 ml)</td>
			<td >Axygen - Corning Life Sciences</td>
			<td >MCT-175C</td>
			<td ></td>
		</tr>
		<tr >
			<td >Falcon round-bottom polypropylene tubes (14 ml)</td>
			<td >BD Biosciences</td>
			<td >352059</td>
			<td ></td>
		</tr>
		<tr >
			<td >Conical-bottom centrifuge polypropylene tubes (50 ml)</td>
			<td >Corning</td>
			<td >430828</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 5 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4051</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 10 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4488</td>
			<td ></td>
		</tr>
		<tr >
			<td >Serological pipettes (Corning 25 ml)</td>
			<td >Corning Life Sciences</td>
			<td >4251</td>
			<td ></td>
		</tr>
		<tr >
			<td >Spectrophotometer cuvettes</td>
			<td >Sarstedt</td>
			<td >67.742</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 0.2 - 20 &#956;l</td>
			<td >FroggaBio</td>
			<td >FT20</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 10 - 200 &#956;l</td>
			<td >Axigene/corning</td>
			<td >TF-200</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 100 - 1000 &#956;l</td>
			<td >FroggaBio</td>
			<td >FT1000</td>
			<td ></td>
		</tr>
		<tr >
			<td >RNase-free pipette tips 100 - 1000 &#956;l</td>
			<td>Sorenson</td>
			<td >14200</td>
			<td ></td>
		</tr>
		<tr >
			<td >Syringe disposile 10 mL needle G-21</td>
			<td>Becton Dickinson, Biosciences</td>
			<td >BD-309643</td>
			<td ></td>
		</tr>
		<tr >
			<td >Minisart 0.2 um Syringe Filter</td>
			<td >Sartorius</td>
			<td >16534 K</td>
			<td ></td>
		</tr>
		<tr >
			<td >Nikon instruments microscope type A immersion oil A, 8cc</td>
			<td >Nikon</td>
			<td >MXA20233</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microscope slides 76 x26, 3&#34;x1&#34;x1mm</td>
			<td >Thermo Fisher Scientific</td>
			<td >421-004ET</td>
			<td ></td>
		</tr>
		<tr >
			<td >#0 coverslip slide 24x60</td>
			<td >Thermo Fisher Scientific/Menzel</td>
			<td >BNBB024060A0</td>
			<td ></td>
		</tr>
		<tr >
			<td >Orbital shaker</td>
			<td >M.R.C</td>
			<td >TOU-50</td>
			<td ></td>
		</tr>
		<tr >
			<td >Hot block</td>
			<td >M.R.C</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Vortex</td>
			<td >Fried Electric Company</td>
			<td >G-560-E</td>
			<td ></td>
		</tr>
		<tr >
			<td >Microcentrifuge</td>
			<td >Eppendorf</td>
			<td >5427R</td>
			<td ></td>
		</tr>
		<tr >
			<td >Centrifuge</td>
			<td >Eppendorf</td>
			<td >5810R</td>
			<td ></td>
		</tr>
		<tr >
			<td >Portable Pipet-Aid XP2, Pipette Controller</td>
			<td >Drummond Scientific Company</td>
			<td >4-000-501-I</td>
			<td ></td>
		</tr>
		<tr >
			<td >OD600 Spectrophotometer for Bacterial Growth Rates DiluPhotometer</td>
			<td >Midsci</td>
			<td >OD600-10</td>
			<td ></td>
		</tr>
		<tr >
			<td >iXon X3 EMCCD camera</td>
			<td >Andor</td>
			<td >DU-897E-CS0-#BV</td>
			<td > </td>
		</tr>
		<tr >
			<td >Eclipse Ti microscope</td>
			<td >Nikon</td>
			<td >MEA53100</td>
			<td > </td>
		</tr>
		<tr >
			<td >CFI plan apochromat DM 100X oil objective lambda PH-3 N.A 1.45 WD 0.13</td>
			<td >Nikon</td>
			<td >MRD31905</td>
			<td > </td>
		</tr>
		<tr >
			<td >Filter set (TRITC/CY3): EX - ET545/30X; EM - ET620/60M; BS - T570LP</td>
			<td >Nikon</td>
			<td >49005</td>
			<td > </td>
		</tr>
		<tr >
			<td >Filter set (CY5): EX - ET640/30X; EM - ET690/50M; BS - T660P</td>
			<td >Nikon</td>
			<td >49009</td>
			<td > </td>
		</tr>
		<tr >
			<td >Nis-elements AR auto reaserch software</td>
			<td >Nikon</td>
			<td >MQS31000</td>
			<td > </td>
		</tr>
		<tr >
			<td >STORM microscope</td>
			<td >Vutara</td>
			<td >SR-200</td>
			<td > </td>
		</tr>
		<tr >
			<td >NA 1.2 water immersion objective </td>
			<td >Olympus</td>
			<td > </td>
			<td > </td>
		</tr>
		<tr >
			<td >SRX image acquisition and analysis software</td>
			<td >Vutara</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Evolve 512 EMCCD camera</td>
			<td >Photometrics</td>
			<td ></td>
			<td ></td>
		</tr>
		<tr >
			<td >Stellaris&#174; FISH Probes, Custom Assay with CAL Fluor&#174; Red 590 Dye</td>
			<td >Biosearch Technologies Inc</td>
			<td >SMF-1083-5</td>
			<td ></td>
		</tr>
		<tr >
			<td >Probe Sequence for galK mRNA:</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttttttctttcagactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tagccaaatgcgttggcaaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctgaatggtgtgagtggcag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caccaatcaaattcacgcgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgaaaccgtcgttgtagtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgataatcaatcgcgcaggg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtggtgcacaactgatcacg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgcgaactttacggtcatc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gctgattttcataatcggct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcatcgagggaaaactcgtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gttttcatgtgcgacaatgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cacgccacgaacgtagttag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttacgcagttgcagatgttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tccagtgaagcggaagaact</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgctgcaatacggttccgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtccagcggcagatgataaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgaccgttaagcgcgatttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >agcctacaaactggttttct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcggaaattagctgatccat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >aaggcatgatctttcttgcc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cagtgagcggcaatcgatca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgggcatggaaactgctttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gatgatgacgacagccacac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gggtacgtttgaagttactg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttgtattcgctgccaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggtttcgcactgttcacgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tggctgctggaagaaacgcg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttcaatggtgacatcacgca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >catgcgcaacagcgttgaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggcgttttcagtcagtatat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atacgtttcaggtcgccttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgagactccgccatcaactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gaaatcatcgcgcatagagg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caatttgcggcacggtgatt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttgacgatttctaccagagt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acctttgtcgccaatcacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggatcagcgcgacgatacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atattgttcagcgacagctt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtctctttaatacctgtttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctccttgtgatggtttacaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >Stellaris&#174; FISH Probes, Custom Assay with Quaser Fluor&#174; Red 670 Dye</td>
			<td >Biosearch Technologies Inc</td>
			<td >SMF-1083-5</td>
			<td ></td>
		</tr>
		<tr >
			<td >Probe Sequence for sodB mRNA:</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttttttctttcagactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tagccaaatgcgttggcaaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctgaatggtgtgagtggcag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caccaatcaaattcacgcgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgaaaccgtcgttgtagtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgataatcaatcgcgcaggg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtggtgcacaactgatcacg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acgcgaactttacggtcatc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gctgattttcataatcggct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcatcgagggaaaactcgtc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gttttcatgtgcgacaatgg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cacgccacgaacgtagttag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttacgcagttgcagatgttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tccagtgaagcggaagaact</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgctgcaatacggttccgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtccagcggcagatgataaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgaccgttaagcgcgatttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >agcctacaaactggttttct</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gcggaaattagctgatccat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >aaggcatgatctttcttgcc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >cagtgagcggcaatcgatca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgggcatggaaactgctttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gatgatgacgacagccacac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gggtacgtttgaagttactg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtgttgtattcgctgccaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggtttcgcactgttcacgac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tggctgctggaagaaacgcg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttcaatggtgacatcacgca</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >catgcgcaacagcgttgaac</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggcgttttcagtcagtatat</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atacgtttcaggtcgccttg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >tgagactccgccatcaactc</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gaaatcatcgcgcatagagg</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >caatttgcggcacggtgatt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ttgacgatttctaccagagt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >acctttgtcgccaatcacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ggatcagcgcgacgatacag</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >atattgttcagcgacagctt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >gtctctttaatacctgtttt</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
		<tr >
			<td >ctccttgtgatggtttacaa</td>
			<td > </td>
			<td > </td>
			<td ></td>
		</tr>
	</tbody>
</table>

method for labeling transcripts in individual escherichia coli cells for single-molecule fluorescence in situ hybridization experiments

Bir yöntem bireysel mesajcı RNA (mRNA) Tutanaklar tek molekül Floresans in situ hibridizasyon (smFISH) E. colideneylerde kullanmak için sabit bakterilerde etiketleme için tanımlanır. smFISH mRNA kopya numarası ilgi genlerin hücre hücre değişkenlik ölçümü transkriptleri hücre altı konumunu sağlar. Ana adımları bakteriyel hücre kültürü fiksasyonu, hücre zarları permeabilization ve hedef transkript hibridizasyon setleri ile piyasada kısa Oligonükleotid fluorescently etiketli probları vardır. smFISH farklı floresan işaretleri arasında spektral örtüşme tarafından uygulanan sınırlamaları ile aynı hücrede birden çok gen transkript görüntüleme izin verebilirsiniz. Aşağıda resimli Protokolü tamamlanmasını takiben, hücreleri kolayca düşük yoğunluktaki floresan için uygun bir fotoğraf makinesi ile birleştiğinde bir mikroskop kullanarak yansıması. Bu görüntüler, segmentasyon faz kontrast kare veya hücre zarı boyama, elde edilen hücre dağılımları ile birlikte mRNA kopya numarası dağıtım örneği açık kaynak veya özel olarak yazılmış yazılım kullanarak hücre hesaplama sağlar. Burada açıklanan etiketleme yöntemi Ayrıca resmi transkript Stokastik optik imar mikroskobu (fırtına) ile uygulanabilir.

Biz smFISH ölçümleri galK ve sodB transkript E. coli hücrelerdeki yürüttü. Transkript belirli dizileri için hedef sıra, floresan molekülünü Birleşik her sonda tamamlayıcı bir dizi melezleşmiştir (malzemelerin tabloya bakın). Floresan ve faz kontrast görüntüleri MG1655 vahşi-tip e.coli suşu (WT) veya bir JW0740 (Keio koleksiyon)19 galK silinmiş yük (ΔgalK) 2 mm D-fucose şekil 1A ve <...

Watch this Scientific Journal Video about Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments at JoVE.com

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

Transkript bireysel Escherichia coli hücrelerdeki tek molekül Floresans In Situ hibridizasyon deneyleri için etiketleme yöntemi

Bu el yazması ile DNA probları fluorescently etiketli tek molekül Floresans in situ hibridizasyon (smFISH) E. colideneylerde kullanmak için bireysel mesajcı RNA (mRNA) Tutanaklar etiketleme yöntemi açıklar. smFISH eş zamanlı algılama, Yerelleştirme ve miktar tek mRNA molekülleri sabit tek tek hücreleri içinde izin veren bir görselleştirme yöntemidir.

A method is described for labeling individual messenger RNA (mRNA) transcripts in fixed bacteria for use in single-molecule fluorescence in situ ...

method-for-labeling-transcripts-individual-escherichia-coli-cells-for

Research

JoVE Journal

Biology

Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

8.1K Görüntüleme.  Weizmann Institute of Science. Bu el yazması ile DNA probları fluorescently etiketli tek molekül Floresans in situ hibridizasyon (smFISH) E. colideneylerde kullanmak için bireysel mesajcı RNA (mRNA) Tutanaklar etiketleme yöntemi açıklar. smFISH eş zamanlı algılama, Yerelleştirme ve miktar tek mRNA molekülleri sabit tek tek hücreleri içinde izin veren bir görselleştirme yöntemidir.

Video: Method for Labeling Transcripts in Individual Escherichia coli Cells for Single-molecule Fluorescence In Situ Hybridization Experiments

Pyrosequencing: A Simple Method for Accurate Genotyping

Pharmacogenetic research benefits first-hand from the abundance of information provided by the completion of the Human Genome Project. With such a tremendous amount of data available comes an explosion of genotyping methods. Pyrosequencing(R) is one of the most thorough yet simple methods to date used to analyze polymorphisms. It also has the ability to identify tri-allelic, indels, short-repeat polymorphisms, along with determining allele percentages for methylation or pooled sample assessment. In addition, there is a standardized control sequence that provides internal quality control. This method has led to rapid and efficient single-nucleotide polymorphism evaluation including many clinically relevant polymorphisms. The technique and methodology of Pyrosequencing is explained.


Pyrosequencing(R) is one of the most thorough yet simple methods to date used to analyze polymorphisms. This method has led to rapid and efficient single-nucleotide polymorphism evaluation including many clinically relevant polymorphisms. The technique and methodology of Pyrosequencing is explained.

Pyrosequencing: Doğru Genotiplendirme için Basit Bir Yöntem

Pharmacogenetic research benefits first-hand from the abundance of information provided by the completion of the Human Genome Project. With such a ...

Biyoloji

Double Whole Mount in situ Hybridization of Early Chick Embryos

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ideal tool for studying  gene expression in brain, neural tube, somite and heart primordia formation. This video demonstrates the different steps in 2-color whole mount in situ hybridization; First, the embryo is dissected from the egg and fixed in paraformaldehyde. Second, the embryo is processed for prehybridization. The embryo is then hybridized with two different probes, one coupled to DIG, and one coupled to FITC.  Following overnight hybridization, the embryo is incubated with DIG coupled antibody. Color reaction for DIG substrate is performed, and the region of interest appears blue. The embryo is then incubated with FITC coupled antibody. The embryo is processed for color reaction with FITC, and the region of interest appears red. Finally, the embryo is fixed and processed for phtograph and sectioning. A troubleshooting guide is also presented.

This video demonstrates 2-color whole mount in situ hybridization, a method by which the spatial and temporal expression pattern of 2 different genes can be visualized in young chick embryos. This method was originally introduced by David Wilkinson, Domingos Henrique, Phil Ingham and David Ish -Horowicz.

Erken Civciv Embriyolar in situ Hibridizasyon Çift Tüm Dağı

The chick embryo is a valuable tool in the study of early embryonic development. Its transparency, accessibility and ease of manipulation, make it an ...

Fluorescence in situ hybridization (FISH) Protocol in Human Sperm

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic process in the parents. In human males, these errors can lead to the production of spermatozoa with numerical chromosome abnormalities which represent an increased risk of transmitting these anomalies to the offspring.
For this reason, the technique of fluorescence in situ hybridization (FISH) on sperm nuclei has become a protocol widely incorporated in the context of clinical diagnosis. This practice provides an estimate of the frequencies of numerical chromosome abnormalities in the gametes of the patients that seek for genetic reproductive advice.
To date, the chromosomes most frequently included in sperm FISH analysis are chromosomes X, Y, 13, 18 and 21.
This video-article describes, step by step, how to process and fix a human semen sample, how to decondense and denature the sperm chromatin, how to proceed to obtain sperm FISH preparations, and how to visualize the results at the microscope. Special remarks of the most relevant steps are given to achieve the best results.

Fluorescence in situ hybridization FISH Protocol in Human Sperm

This video-article describes, step by step, how to process a semen sample to achieve good-quality fluorescence in situ hybridization on human spermatozoa. Preparations obtained can be used for aneuploidy screening in the context of clinical diagnosis.

Floresan In situ İnsan Sperm hibridizasyon (FISH) Protokolü

Aneuploidies are the most frequent chromosomal abnormalities in humans. Most of these abnormalities result from meiotic errors during the gametogenic ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

Yüzey immobilize Biyomoleküller Tek Molekül Floresans Ölçümler için Otomatik Sistem

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

In Situ Hybridization for the Precise Localization of Transcripts in Plants

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene expression. Microarray and next generation sequencing approaches are being used to investigate developmental, physiological and stress response processes, dissect epigenetic and small RNA pathways, and build large gene regulatory networks1-3. While these techniques facilitate the simultaneous analysis of large gene sets, they typically provide a very limited spatiotemporal resolution of gene expression changes. This limitation can be partially overcome by using either profiling method in conjunction with lasermicrodissection or fluorescence-activated cell sorting4-7. However, to fully understand the biological role of a gene, knowledge of its spatiotemporal pattern of expression at a cellular resolution is essential. Particularly, when studying development or the effects of environmental stimuli and mutants can the detailed analysis of a gene's expression pattern become essential. For instance, subtle quantitative differences in the expression levels of key regulatory genes can lead to dramatic phenotypes when associated with the loss or gain of expression in specific cell types. 
Several methods are routinely used for the detailed examination of gene expression patterns. One is through analysis of transgenic reporter lines. Such analysis can, however, become time-consuming when analyzing multiple genes or working in plants recalcitrant to transformation. Moreover, an independent validation to ensure that the transgene expression pattern mimics that of the endogenous gene is typically required. Immunohistochemical protein localization or mRNA in situ hybridization present relatively fast alternatives for the direct visualization of gene expression within cells and tissues. The latter has the distinct advantage that it can be readily used on any gene of interest. In situ hybridization allows detection of target mRNAs in cells by hybridization with a labeled anti-sense RNA probe obtained by in vitro transcription of the gene of interest. 
Here we outline a protocol for the in situ localization of gene expression in plants that is highly sensitivity and specific. It is optimized for use with paraformaldehyde fixed, paraffin-embedded sections, which give excellent preservation of histology, and DIG-labeled probes that are visualized by immuno-detection and alkaline-phosphatase colorimetric reaction. This protocol has been successfully applied to a number of tissues from a wide range of plant species, and can be used to analyze expression of mRNAs as well as small RNAs8-14.

In Situ Hybridization for the Precise Localization of Transcripts in Plants

The in situ hybridization protocol described here allows a direct localization of mRNA and small RNA expression at the cellular level with high sensitivity and specificity. The procedure is optimized for paraffin-embedded plant tissue sections, is applicable to a wide range of plants and tissues, and can be completed within ten days.

Bitkilerde Transkriptler Hassas Yerelleştirme Situ Hibridizasyon

With the advances in genomics research of the past decade, plant biology has seen numerous studies presenting large-scale quantitative analyses of gene ...

Detection of Viral RNA by Fluorescence in situ Hybridization (FISH)

Viruses that infect cells elicit specific changes to normal cell functions which serve to divert energy and resources for viral replication. Many aspects of host cell function are commandeered by viruses, usually by the expression of viral gene products that recruit host cell proteins and machineries. Moreover, viruses engineer specific membrane organelles or tag on to mobile vesicles and motor proteins to target regions of the cell (during de novo infection, viruses co-opt molecular motor proteins to target the nucleus; later, during virus assembly, they will hijack cellular machineries that will help in the assembly of viruses). Less is understood on how viruses, in particular those with RNA genomes, coordinate the intracellular trafficking of both protein and RNA components and how they achieve assembly of infectious particles at specific loci in the cell. The study of RNA localization began in earlier work. Developing lower eukaryotic embryos and neuronal cells provided important biological information, and also underscored the importance of RNA localization in the programming of gene expression cascades. The study in other organisms and cell systems has yielded similar important information. Viruses are obligate parasites and must utilise their host cells to replicate. Thus, it is critical to understand how RNA viruses direct their RNA genomes from the nucleus, through the nuclear pore, through the cytoplasm and on to one of its final destinations, into progeny virus particles 1.
FISH serves as a useful tool to identify changes in steady-state localization of viral RNA. When combined with immunofluorescence (IF) analysis 22, FISH/IF co-analyses will provide information on the co-localization of proteins with the viral RNA3. This analysis therefore provides a good starting point to test for RNA-protein interactions by other biochemical or biophysical tests 4,5, since co-localization by itself is not enough evidence to be certain of an interaction. In studying viral RNA localization using a method like this, abundant information has been gained on both viral and cellular RNA trafficking events 6. For instance, HIV-1 produces RNA in the nucleus of infected cells but the RNA is only translated in the cytoplasm. When one key viral protein is missing (Rev) 7, FISH of the viral RNA has revealed that the block to viral replication is due to the retention of the HIV-1 genomic RNA in the nucleus 8. 
Here, we present the method for visual analysis of viral genomic RNA in situ. The method makes use of a labelled RNA probe. This probe is designed to be complementary to the viral genomic RNA. During the in vitro synthesis of the antisense RNA probe, the ribonucleotide that is modified with digoxigenin (DIG) is included in an in vitro transcription reaction. Once the probe has hybridized to the target mRNA in cells, subsequent antibody labelling steps (Figure 1) will reveal the localization of the mRNA as well as proteins of interest when performing FISH/IF.

Detection of Viral RNA by Fluorescence in situ Hybridization FISH

A fluorescence in situ hybridization (FISH) method was developed to visually detect viral genomic RNA using fluorescence microscopy. A probe is made with specificity to the viral RNA that can then be identified using a combination of hybridization and immunofluorescence techniques. This technique offers the advantage of identifying the localization of the viral RNA or DNA at steady-state, providing information on the control of intracellular virus trafficking events.

Floresans tarafından viral RNA tespit edilmesi<em&gt; In situ</em&gt; Hibridizasyon (FISH)

Viruses  that infect cells elicit specific changes to normal cell functions which serve  to divert energy and resources for viral replication. Many ...

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for using FISH to quantify the number of mRNAs in single yeast cells. Cells can be grown in any condition of interest and then fixed and made permeable. Subsequently, multiple single-stranded deoxyoligonucleotides conjugated to fluorescent dyes are used to label and visualize mRNAs. Diffraction-limited fluorescence from single mRNA molecules is quantified using a spot-detection algorithm to identify and count the number of mRNAs per cell. While the more standard quantification methods of northern blots, RT-PCR and gene expression microarrays provide information on average mRNAs in the bulk population, FISH facilitates both the counting and localization of these mRNAs in single cells at single-molecule resolution.

Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae

This protocol describes an experimental procedure for performing Fluorescence in situ Hybridization (FISH) for counting mRNAs in single cells at single-molecule resolution.

Floresan kullanarak mRNA Moleküllerin Görselleştirme ve Analiz<em&gt; Yerinde</emIn&gt; Hibridizasyon<em&gt; Saccharomyces cerevisiae</em

The Fluorescence in situ Hybridization (FISH) method allows one to detect nucleic acids in the native cellular environment. Here we provide a protocol for ...

MicroRNA In situ Hybridization for Formalin Fixed Kidney Tissues

In this article we describe a method for colorimetric detection of miRNA in the kidney through in situ hybridization with digoxigenin tagged microRNA probes. This protocol, originally developed by Kloosterman and colleagues for broad use with Exiqon miRNA probes1, has been modified to overcome challenges inherent in miRNA analysis in kidney tissues. These include issues such as structure identification and hard to remove residual probe and antibody. Use of relatively thin, 5 mm thick, tissue sections allowed for clear visualization of kidney structures, while a strong probe signal was retained in cells. Additionally, probe concentration and incubation conditions were optimized to facilitate visualization of microRNA expression with low background and nonspecific signal. Here, the optimized protocol is described, covering the initial tissue collection and preparation through the mounting of slides at the end of the procedure. The basic components of this protocol can be altered for application to other tissues and cell culture models.

MicroRNA In situ Hybridization for Formalin Fixed Kidney Tissues

This article describes an in situ hybridization protocol optimized for colormetric detection of microRNA expression in formalin fixed kidney sections.

MicroRNA<em&gt; In situ</em&gt; Formalin Sabit Böbrek Dokular Hibridizasyon

In this article we describe a method for colorimetric detection of miRNA in the kidney through in situ hybridization with digoxigenin tagged microRNA ...

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. coli O157:H7 by targeting ORF Z3276. With this assay, we can detect as low as a few copies of the genome of DNA of E. coli O157:H7. The sensitivity and specificity of the assay were confirmed by intensive validation tests with a large number of E. coli O157:H7 strains (n = 369) and non-O157 strains (n = 112). Furthermore, we have combined propidium monoazide (PMA) procedure with the newly developed qPCR protocol for selective detection of live cells from dead cells. Amplification of DNA from PMA-treated dead cells was almost completely inhibited in contrast to virtually unaffected amplification of DNA from PMA-treated live cells. Additionally, the protocol has been modified and adapted to a 96-well plate format for an easy and consistent handling of a large number of samples. This method is expected to have an impact on accurate microbiological and epidemiological monitoring of food safety and environmental source.

Detection of Live Escherichia coli O157:H7 Cells by PMA-qPCR

A qPCR assay was developed for detection of Escherichia coli O157:H7 targeting a unique genetic marker, Z3276. The qPCR was combined with propidium monoazide (PMA) treatment for live cell detection. This protocol has been modified and adapted to a 96-well plate format for easy and consistent handling of numerous samples

Live Algılama<em&gt; Escherichia coli</em&gt; O157: PMA-qPCR H7 Hücreler

A unique open reading frame (ORF) Z3276 was identified as a specific genetic marker for E. coli O157:H7. A qPCR assay was developed for detection of E. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Kantitatif RT-PCR ile Bireysel İnsan Embriyonik Kök Hücreleri profilleme

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Transkript bireysel Escherichia coli hücrelerdeki tek molekül Floresans In Situ hibridizasyon deneyleri için etiketleme yöntemi

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler

Pyrosequencing: Doğru Genotiplendirme için Basit Bir Yöntem

Erken Civciv Embriyolar in situ Hibridizasyon Çift Tüm Dağı

Floresan In situ İnsan Sperm hibridizasyon (FISH) Protokolü

Yüzey immobilize Biyomoleküller Tek Molekül Floresans Ölçümler için Otomatik Sistem

Bitkilerde Transkriptler Hassas Yerelleştirme Situ Hibridizasyon

Floresans tarafından viral RNA tespit edilmesi

Floresan kullanarak mRNA Moleküllerin Görselleştirme ve Analiz

MicroRNA

Live Algılama

Kantitatif RT-PCR ile Bireysel İnsan Embriyonik Kök Hücreleri profilleme