Name: split-bioid — proteomic analysis of context-specific protein complexes in their native cellular environment
Uploaded: 2018-04-20T14:45:00.000+00:00
Duration: 9 min 2 s
Description: Watch this Scientific Journal Video about Split-BioID â€” Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment at JoVE.com

Bu çalışmalar Alman Araştırma Konseyi (DFG) Alman mükemmellik girişimi (CellNetworks DFG-hariç 81) ve SFB638 ortak araştırma merkezi tarafından kısmi bir finansman yoluyla destekleriyle gerçekleştirilmiştir.

<ol>
	<li>Scott, D. E., Bayly, A. R., Abell, C., Skidmore, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecules,+big+targets:+drug+discovery+faces+the+protein-protein+interaction+challenge.">Small molecules, big targets: drug discovery faces the protein-protein interaction challenge.</a> Nat Rev Drug Discov. 15 (8), 533-550 (2016).</li><li>Roux, K. J., Kim, D. I., Raida, M., Burke, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+promiscuous+biotin+ligase+fusion+protein+identifies+proximal+and+interacting+proteins+in+mammalian+cells.">A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells.</a> J Cell Biol. 196 (6), 801-810 (2012).</li><li>Lam, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+APEX2+for+electron+microscopy+and+proximity+labeling.">Directed evolution of APEX2 for electron microscopy and proximity labeling.</a> Nat Methods. 12 (1), 51-54 (2015).</li><li>Rhee, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+mapping+of+mitochondria+in+living+cells+via+spatially+restricted+enzymatic+tagging.">Proteomic mapping of mitochondria in living cells via spatially restricted enzymatic tagging.</a> Science. 339 (6125), 1328-1331 (2013).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+nuclear+pore+complex+architecture+with+proximity-dependent+biotinylation.">Probing nuclear pore complex architecture with proximity-dependent biotinylation.</a> P Natl Acad Sci USA. 111 (24), E2453-E2461 (2014).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+smaller+biotin+ligase+for+BioID+proximity+labeling.">An improved smaller biotin ligase for BioID proximity labeling.</a> Mol Biol Cell. 27 (8), 1188-1196 (2016).</li><li>Lambert, J. P., Tucholska, M., Go, C., Knight, J. D., Gingras, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proximity+biotinylation+and+affinity+purification+are+complementary+approaches+for+the+interactome+mapping+of+chromatin-associated+protein+complexes.">Proximity biotinylation and affinity purification are complementary approaches for the interactome mapping of chromatin-associated protein complexes.</a> J Proteomics. 118, 81-94 (2015).</li><li>Morriswood, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+bilobe+components+in+Trypanosoma+brucei+identified+using+proximity-dependent+biotinylation.">Novel bilobe components in Trypanosoma brucei identified using proximity-dependent biotinylation.</a> Eukaryot Cell. 12 (2), 356-367 (2013).</li><li>Schopp, I. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID+a+conditional+proteomics+approach+to+monitor+the+composition+of+spatiotemporally+defined+protein+complexes.">Split-BioID a conditional proteomics approach to monitor the composition of spatiotemporally defined protein complexes.</a> Nat Commun. 8, (2017).</li><li>B&#233;thune, J., Artus-Revel, C. G., Filipowicz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetic+analysis+reveals+successive+steps+leading+to+miRNA-mediated+silencing+in+mammalian+cells.">Kinetic analysis reveals successive steps leading to miRNA-mediated silencing in mammalian cells.</a> EMBO Rep. 13 (8), 716-723 (2012).</li><li>Inoue, H., Nojima, H., Okayama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+efficiency+transformation+of+Escherichia+coli+with+plasmids.">High efficiency transformation of Escherichia coli with plasmids.</a> Gene. 96 (1), 23-28 (1990).</li><li>Weidenfeld, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+expression+of+coding+and+inhibitory+RNAs+from+retargetable+genomic+loci.">Inducible expression of coding and inhibitory RNAs from retargetable genomic loci.</a> Nucleic Acids Res. 37 (7), e50 (2009).</li><li>Dyballa, N., Metzger, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+sensitive+colloidal+coomassie+G-250+staining+for+proteins+in+polyacrylamide+gels.">Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels.</a> J Vis Exp. (30), (2009).</li><li>Jonas, S., Izaurralde, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+a+molecular+understanding+of+microRNA-mediated+gene+silencing.">Towards a molecular understanding of microRNA-mediated gene silencing.</a> Nat Rev Genet. 16 (7), 421-433 (2015).</li><li>MacRae, I. J., Ma, E., Zhou, M., Robinson, C. V., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reconstitution+of+the+human+RISC-loading+complex.">In vitro reconstitution of the human RISC-loading complex.</a> P Natl Acad Sci USA. 105 (2), 512-517 (2008).</li><li>Cox, J., Mann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MaxQuant+enables+high+peptide+identification+rates,+individualized+p.p.b.-range+mass+accuracies+and+proteome-wide+protein+quantification.">MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification.</a> Nat Biotechnol. 26 (12), 1367-1372 (2008).</li><li>Tyanova, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Perseus+computational+platform+for+comprehensive+analysis+of+(prote)omics+data.">The Perseus computational platform for comprehensive analysis of (prote)omics data.</a> Nat Methods. 13 (9), 731-740 (2016).</li><li>Opitz, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+the+Asc1p/Receptor+for+Activated+C+Kinase+1+(RACK1)+Microenvironment+at+the+Head+Region+of+the+40S+Ribosome+with+Quantitative+BioID+in+Yeast.">Capturing the Asc1p/Receptor for Activated C Kinase 1 (RACK1) Microenvironment at the Head Region of the 40S Ribosome with Quantitative BioID in Yeast.</a> Mol Cell Proteomics. 16 (12), 2199-2218 (2017).</li><li>Mackmull, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+of+nuclear+transport+receptor+cargo+specificity.">Landscape of nuclear transport receptor cargo specificity.</a> Mol Syst Biol. 13 (12), 962 (2017).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioSITe:+A+Method+for+Direct+Detection+and+Quantitation+of+Site-Specific+Biotinylation.">BioSITe: A Method for Direct Detection and Quantitation of Site-Specific Biotinylation.</a> J Proteome Res. , (2017).</li><li>Udeshi, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibodies+to+biotin+enable+large-scale+detection+of+biotinylation+sites+on+proteins.">Antibodies to biotin enable large-scale detection of biotinylation sites on proteins.</a> Nat Methods. 14 (12), 1167-1170 (2017).</li><li>Chapat, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cap-binding+protein+4EHP+effects+translation+silencing+by+microRNAs.">Cap-binding protein 4EHP effects translation silencing by microRNAs.</a> P Natl Acad Sci USA. 114 (21), 5425-5430 (2017).</li><li>Luker, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+regulated+protein-protein+interactions+revealed+with+firefly+luciferase+complementation+imaging+in+cells+and+living+animals.">Kinetics of regulated protein-protein interactions revealed with firefly luciferase complementation imaging in cells and living animals.</a> P Natl Acad Sci USA. 101 (33), 12288-12293 (2004).</li><li>De Munter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID:+a+proximity+biotinylation+assay+for+dimerization-dependent+protein+interactions.">Split-BioID: a proximity biotinylation assay for dimerization-dependent protein interactions.</a> FEBS Lett. 591 (2), 415-424 (2017).</li><li>Xue, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+the+fragment+complementation+of+APEX2+for+detection+of+specific+protein-protein+interactions+in+live+cells.">Optimizing the fragment complementation of APEX2 for detection of specific protein-protein interactions in live cells.</a> Sci Rep. 7 (1), 12039 (2017).</li><li>Branon, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+TurboID+for+efficient+proximity+labeling+in+living+cells+and+organisms.">Directed evolution of TurboID for efficient proximity labeling in living cells and organisms.</a> bioRxiv. , (2017).</li></ol>

Yazarlar ifşa gerek yok.

Seviyelendirilmiş yordamı genler ilgi Böl-BioID clone Plazmidler, etkileşim kaynaklı biotinylation için test edileceğini ve kütle spektrometresi analiz için biotinylated proteinler yalıtmak nasıl açıklar. Biz burada geçici transfection dayalı bir açıklayınız. Ifade füzyon proteinlerin Orta olarak eklendi dox miktarına göre ayarlanmış olsa da, geçici transfection fena halde endojen için karşılaştırıldığında füzyon protein overexpress bazı hücreler homojen olmayan protein ifadeyle neden olabilir meslektaşları. Bu distorsiyonları karşılık gelen interactomes ve sadakatle endojen protein içeren etkileşimlerin yansıtmıyor PPI neden olabilir. Böylece Böl-BioID ile geçici sistem kurulduktan sonra istikrarlı hücre hatları oluşturmak için genellikle tavsiye edilir. Plazmid Flp aracılı rekombinasyon sistemi ile uyumlu ve faiz aynı tet-yanıt veren öğe düzenleme altında her iki genler yer. Gerekirse ve uyumlu memeli hücreleri ile kullanıldığında, onlar istikrarlı indüklenebilir hücre hatları kolay oluşturulmasına olanak sağlar. Örneğin, rtTA transkripsiyon tetrasiklin-harekete geçirmek harekete geçirmek ve benzersiz bir targetable genomik locus tetrasiklin-aracılı gen ekspresyonu sıkıca düzenlenmiş12olabilen ifade HeLa-EM2-11 satırını kullanın. Bu hücre kültürünü ve Flp aracılı rekombinasyon kullanarak, tek bir kopyasını transgene içeren istikrarlı hücre hatları iki-üç hafta içinde elde edilebilir. Alternatif olarak, bir de yerel genomik loci ilgi genlerin içinde BirA * parçaları tanıtmak için geçerli genom düzenleme teknikleri kullanabilirsiniz.
Bir protein etiketleme dayanır herhangi bir tahlil olduğu gibi bir sonuç füzyon protein fonksiyonel olup olmadığını düşünün gerekir. Kullanılabilir veri hangi faiz proteinler (örneğin için çalışmalar düşsel GFP) takip ve işlevsel test yararlıdır BirA * parçaları olmalıdır karar için yukarı veya aşağı faiz genler klonlanmış. Böyle bir veri yoksa, bir N-ölümcül sınamanız gerekir veya C-ölümcül öğesini proteinler işlevsel bir tahlil. Örneğin, füzyon proteinlerin etkinlik içinde endojen protein edilmiş çaldı-out ve vahşi türü duruma kıyasla bir hücre kültürünü test edilebilir. Proteinler ilgi her iki N ve C terminali Etiketler hoş görürsen, her ikisi de test edilmelidir. Gerçekten de, BioID deneylerde füzyon protein yönünü22etiketleme verimliliğini etkileyebilir. Böl-BioID protein bir çift için uygulamak, hangi iki proteinlerin ya NBirA * için eklenir veya CBirA * parçalara ayırması da etkisi9etiketleme verimliliğini biz bu Ayrıca, gözlemledim. Böl-BioID plazmid 16 amino asit uzun glisin/zengin bağlayıcı proteinler ilgi BirA * parçaları için kaplin başka bir PCA23 almış ve bizim için tüm etkileşen proteinler için çalıştı serin defa test ettik. Ancak, bir bazı protein çiftleri daha kısa veya daha uzun halkalı ile daha iyi işe yarayabilecek düşünmelisiniz. Son Not başka bir tahlil Bollen grup24tarafından tanımlanmıştır. Bu tahlil, BirA * bizimkinden (E256/G257) başka bir yerinde (E140/Q141) ayrılmıştır. Biz her iki Böl-BioID tatlar-yan yana test ve E256/G257, bu protokol için açıklanan iki etkileşen protein birleştiğinde daha güçlü yeniden etkinleştirme yol açar bulunan9.
Bu yöntemin bir dezavantajı genel etiketleme yavaş hızıdır. Tipik olarak, 6-24 h kuluçka biotin zamanla kayda değer biotinylation6protein kompleksleri dinamik modelleme eğitimi için bu tekniğin kullanımı engellemek, elde etmek gereklidir. İki protein etkileşim kurulduğunda sadece aktif olarak bu tahlil kısmen bu bilmeniz gereken adresleri ise çok dinamik süreçler için ya da kısa ömürlü proteinlerin analiz etmek için çalışmak için kullanımı engel etiketleme yavaş hızı. Mühendislik peroksidaz APEX2 1 dk3içinde proksimal proteinlerin verimli etiketleme teşvik bilinmektedir. APEX2 üzerinde dayalı bir PCA böylece BioID kaynaklı deneyleri yavaş etiketleme hız sınırlamaları adresi. Bir kanıt prensibi çalışma böyle bir split-APEX2 tahlil25nitelendirdi. Bir homodimerizing protein başarıyla biotinylated olsa da, ancak, tahlil de etiket ve etkileşen proteinler bir çift bir araya proteinler tanımlamak için kullanılıp kullanılamayacağı göstermiş kalmaya devam eder. Son zamanlarda, yönlendirilmiş evrim TurboID ve miniTurbo, 10 dk26aşağı daha kısa etiketleme zaman windows sağlayan iki çeşidini BirA * gelişmiş aktivite ile oluşturmak için kullanılan. Böl-BioID bu yeni çeşitleri için adapte uygulamaların daha geniş bir alana bu tekniğin kullanımı daha da uzatır.

En hücresel işlevler dinamik olarak makromoleküllerin kompleksleri araya proteinler tarafından gerçekleştirilen gibi protein-protein etkileşimleri (PPI) kimlik Biyomedikal Araştırma büyük bir çaba değildir. Nitekim, ÜFE kez hastalığında deregüle ve tedavi1için potansiyel hedefleri temsil eder. ÜFE tanımlaması benzeşme arıtma (AP) yaklaşım olan, için en yaygın yöntem kullanılan hücre lizis, ardından bir protein ilgi özellikle bir matris üzerinde saflaştırılmış ve ilişkili proteinler daha sonra kütle spektrometresi tarafından tespit (MS). AP-MS güçlü bir yaklaşım olmakla birlikte, bu genellikle de kötü çözünür protein kompleksleri, geçici çok etkileşimler veya sağlam bir hücre altı yapısı gerektiren PPI gerçekleştirmez. Ayrıca, tek bir protein genellikle birkaç farklı protein kompleksleri parçası olarak verilerin yorumlanması PPI ağlar, dinamik doğası gereği karmaşık.
BioID2 veya APEX23,4 gibi teknikleri yakınlık etiketleme son zamanlarda bazı AP-MS yaklaşımlar sınırlamaları gidermek üzere geliştirilmiştir. BioID içinde enzim BirA * (yabani tip e.coli enzimi G115R değişkenine karşılık gelen) değişken biotinyl-AMP ile Birincil aminler tepki verebilir (biyo-AMP) tromboksan. Biyo-AMFİ için aktif merkezini korur, vahşi türü enzim aksine BirA * biyo-AMP kendi Difüzyon komşu çevresi için izin serbest bırakır. Bu nedenle, faiz bir protein için erimiş ve hücrelerde ifade, proksimal proteinler 10 nm5tahmini bir yelpazesi içinde biotinylated olabilir. Bunlar işaretlenmiş proksimal proteinler sonra streptavidin açılan tarafından izole ve MS tarafından tanımlanan. AP-MS karşı BioID bir füzyon protein ifadesi gerektirir. Bu böylece sadece fonksiyonu etiketleyerek engel değil proteinler için uygulanabilir. Ayrıca, etiketleme hızı genellikle yavaş, 6-24 h2,6kısa ömürlü proteinlerin algılama zorlu yapma,. Henüz, AP-MS için karşılaştırıldığında, BioID-MS birkaç önemli avantajlar sunuyor: ilk, onun yakalar etkileşimleri kendi yerel hücresel ortamında; birleştirilmiş kompleksleri yerine ikinci, etiketli proteinler hücre lizis izole edilmiştir; Üçüncü olarak, streptavidin pulldowns denaturing arabellekleri ve sert çamaşır koşulları kullanarak izin veriyoruz. Bu nedenle, daha hassas geçici veya zayıf etkileşimler7 veya belirli bir ortaya etkileşimleri algılamaya ve hücre altı yapısı8yalıtmak zor yöntemidir.
Ancak, çoğu proteinler genellikle hücresel cues göre ya da yapılması gereken işlevine yeni model daha büyük kompleksler bir parçasıdır. Bu nedenle, tek bir protein genellikle birkaç kompleksleri, farklı işlevsel birimler için karşılık gelen, farklı içeren ve/veya ÜFE örtüşen bir parçasıdır. Her iki yaklaşımın tüm ilişkilendirmeleri verilen bir protein olabilir genel bir bakış vermek, ama onlar bireysel PPI bağlamında adrese başarısız. İkinci çözünürlüğü artırmak için biz bir protein parçaları uluslara tahlil (PCA) hangi iki etkin olmayan parçaları BirA * (NBirA * katalitik etki alanı içeren ve CBirA * yeniden etkinleştirme etki alanı olarak görüntülenebilir) olabilir tasarladık tekrar yakın iki tarafından getirdiğinde etkin bir enzim içine proteinler9etkileşim. Elde edilen Böl-BioID tahlil yakınlık bağımlı biotinylation etkileşen proteinler bir çift bir araya ve böylece bağlam kimliği bağımlı protein derlemeler sağlayan proteinler üzerinde odaklanır. Son zamanlarda iki ayrı protein kompleksleri miRNA-aracılı gen susturmak yolu9' dahil çözülerek Böl-BioID en iyi çözünürlük gücünü gösterdi.
Özet olarak, bir tek ve basit yöntemi, keşfetmek ve özellikle PPI içinde belirli bir protein dahil, karşılık gelen protein kompleksi ek bir etkileşen protein bilinen sağlanan tanımlanmış işlevsel birimleri için atama Böl-BioID sağlar.

<table><tbody><tr><td>Acetic acid (glacial)</td><td>VWR</td><td>20104.298</td><td>To make TAE buffer</td></tr><tr><td>Agarose</td><td>Sigma</td><td>A9539</td><td>Take TAE-agarose gels for DNA analysis and extraction</td></tr><tr><td>Ammonia solution 25% NH&lt;sub&gt;3&lt;/sub&gt;</td><td>Bernd Kraft</td><td>6012</td><td>To dissolve biotin</td></tr><tr><td>Ampicillin</td><td>Sigma</td><td>A9518</td><td>To select transformed bacteria</td></tr><tr><td>Bioruptor plus sonification device</td><td>Diagenode</td><td>B01020001</td><td>Other sonification devices are also ok</td></tr><tr><td>Biotin</td><td>Sigma</td><td>B4639</td><td>To be added to the growth medium to stimulate efficient biotinylation</td></tr><tr><td>Bovine serum albumin fraction V</td><td>Carl Roth</td><td>8076</td><td>Used in Western blot buffers and a protein standard in Bradford assays</td></tr><tr><td>Bradford Ultra reagent</td><td>Expedeon</td><td>BFU05L</td><td>Any other method/kit for protein determination is fine, this particular reagent is more tolerant to detergent than other Bradford reagents</td></tr><tr><td>Cell scrappers</td><td>TPP</td><td>99002</td><td>Any other model is also fine</td></tr><tr><td>ClaI</td><td>New England Biolabs</td><td>R0197</td><td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td></tr><tr><td>DMEM medium</td><td>Sigma</td><td>D6046</td><td>If using another cell line, use the corresponding optimal growth medium</td></tr><tr><td>DNA miniprep kit</td><td>Sigma</td><td>PLN350</td><td>Any other kit is also fine</td></tr><tr><td>Doxycycline</td><td>Applichem</td><td>A2951</td><td>Dox is light sensitive</td></tr><tr><td>DTT</td><td>Applichem</td><td>A2948</td><td>Make 1M stock solution, store at -20 &amp;deg;C and always use fresh</td></tr><tr><td>DyLight 680-conjugated streptavidin</td><td>Thermo scientific</td><td>21848</td><td>to use with a LiCor Western blot scanning device</td></tr><tr><td>Dynabeads MyOne Streptavidin C1</td><td>Invitrogen</td><td>65002</td><td>The C1 beads are not BSA coated which is preferable for downstream MS applications (no leakthrough of BSA in the final elution)</td></tr><tr><td>EDTA</td><td>Applichem</td><td>A5097</td><td>Make a 500 mM stock, adjust pH to 8 while dissolving the EDTA powder</td></tr><tr><td>Ethanol</td><td>Sigma</td><td>32205</td><td>Make a 70% stock solution in which Doxycycline can be dissolved at 10 mg.mL&lt;sup&gt;-1&lt;/sup&gt;</td></tr><tr><td>Fastgene Gel/PCR DNA Extraction Kit</td><td>Nippon Genetics</td><td>FG-91302</td><td>Any other kit is also fine</td></tr><tr><td>HCl 37%</td><td>Merck</td><td>1.00317.1000</td><td>To adjust pH of biotin stock solution</td></tr><tr><td>HEPES</td><td>Carl Roth</td><td>6763</td><td>Make a 500 mM stock solution, adjust the pH to 7.4</td></tr><tr><td>Immobilon-FL PVDF membrane, 0.45&amp;nbsp;&amp;micro;m</td><td>Millipore</td><td>IPFL00010</td><td>This membrane shows minimal autofluorescence when used with a LiCor Western blot scanning device</td></tr><tr><td>LiCl</td><td>Gr&amp;uuml;ssing GmbH</td><td>12083</td><td>Make a 5M stock solution</td></tr><tr><td>Odyssey CLx imaging system</td><td>LI-COR</td><td>N/A</td><td>To scan Western blot membrane decorated with fluorophore-labeled antibody</td></tr><tr><td>Linear polyethylenimine (PEI)</td><td>Polysciences</td><td>23966-2</td><td>Any other transfection reagent is also fine</td></tr><tr><td>Milk powder</td><td>Carl Roth</td><td>T145</td><td>To block Western blot membranes</td></tr><tr><td>MluI-HF</td><td>New England Biolabs</td><td>R3198</td><td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td></tr><tr><td>Na-deoxycholate</td><td>Sigma</td><td>30970</td><td>Make a 10% (w/v) stock solution</td></tr><tr><td>NaCl</td><td>Sigma</td><td>31434</td><td>Make a 5M stock solution</td></tr><tr><td>NP-40 (Nonidet P40 substitute)</td><td>Sigma</td><td>74385</td><td>Make a 20% (v/v) stock solution</td></tr><tr><td>PacI</td><td>New England Biolabs</td><td>R0547</td><td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td></tr><tr><td>Phosphate buffer saline (PBS)</td><td>Sigma</td><td>806552</td><td>To wash cells before scrapping</td></tr><tr><td>PmeI</td><td>New England Biolabs</td><td>R0560</td><td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td></tr><tr><td>Protease inhibitor cocktail</td><td>Roche</td><td>4693132001</td><td>Added to the lysis buffer to prevent protein degradation</td></tr><tr><td>pSF3-Flag-CBir-FRB_Myc-NBir-FKBP</td><td>Addgene</td><td>90003</td><td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td></tr><tr><td>pSF3-Flag-CBir-FRB_FKBP-Myc-Nbir</td><td>Addgene</td><td>90004</td><td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td></tr><tr><td>pSF3-Flag-FRB-Cbir_Myc-NBir-FKBP</td><td>Addgene</td><td>90008</td><td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td></tr><tr><td>pSF3-Flag-FRB-Cbir_FKBP-Myc-Nbir</td><td>Addgene</td><td>90009</td><td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td></tr><tr><td>Q5 High-Fidelity PCR kit</td><td>New England Biolabs</td><td>E0555S</td><td>To amplify the ORF coding for the proteins to be tested. Any other thermostable DNA polymerase is fine.</td></tr><tr><td>Quick ligation kit</td><td>New England Biolabs</td><td>M2200S</td><td>To ligate DNA fragments into the split-BioID plasmids, any other DNA ligation system is fine.</td></tr><tr><td>RunBlue 4-20% SDS precast gels</td><td>Expedeon</td><td>BCG42012</td><td>To use when running samples for MS analysis</td></tr><tr><td>RunBlue LDS Sample Buffer</td><td>Expedeon</td><td>NXB31010</td><td>Running buffer for the RunBlue precast gels</td></tr><tr><td>SDS</td><td>Sigma</td><td>5030</td><td>Comes as a 20% stock solution</td></tr><tr><td>tet-free serum</td><td>Biowest</td><td>S181T</td><td>we use tet-free serum to minimize basal expression of the fusion proteins</td></tr><tr><td>Trans-Blot Turbo Transfer system</td><td>Bio-Rad</td><td>1704150</td><td>High speed Western blotting transfer system, any other transfer system is also fine</td></tr><tr><td>Tris</td><td>Carl Roth</td><td>4855</td><td>Make 1M stock solutions with adequate pH (7.4 and 8)</td></tr><tr><td>Triton X-100</td><td>Applichem</td><td>A4975</td><td>Make a 20% (v/v) stock solution</td></tr><tr><td>Tween-20</td><td>Carl Roth</td><td>9127</td><td>Used in Western blot buffers, Tween 20 leads to high background fluorescence and should be omitted in the blocking and last wash step</td></tr></tbody></table>

split-bioid &#8212; proteomic analysis of context-specific protein complexes in their native cellular environment

Varolan benzeşme arıtma (AP) tamamlayacak protein-protein etkileşimleri (PPI) tanımlanması için yaklaşımlar, enzimler yakınlık bağımlı yaşayan hücrelerde proteinlerin etiketleme izin tanıttı. Bir tür enzim, BirA * (BioID yaklaşımda kullanılır), aracılık eder yaklaşık 10 tonluk bir içindeki proteinlerin biotinylation nm. Bu nedenle, faiz bir protein için erimiş ve hücrelerde ifade zaman, kendi doğal ortamlarında proksimal proteinler etiketlerine göre sağlar. Birleştirilmiş protein kompleksleri arıtma üzerinde dayanır AP aksine, BioID olursa olsun izole olduklarında olup olmadığı hala faiz protein ile etkileşim vardır hücrelerin içindeki işaretlenmiş proteinler algılar. Çünkü biotinylates proksimal proteinler, bir Ayrıca yararlanmak için çok verimli bir şekilde onları ayırmak biotin streptavidin olağanüstü benzeşme hakkında. BioID AP daha iyi tanımlayıcı geçici veya zayıf etkileşimler için yapar iken, her iki AP ve BioID kütle spektrometresi yaklaşım tüm olası etkileşim belirli bir protein olabilir genel bir bakış sağlar. Ancak, onlar her tanımlanan PPI içeriğine bilgi vermeyin. Gerçekten de, çoğu proteinler genellikle birkaç kompleksleri, farklı olgunlaşma adımları veya farklı işlevsel birimler için karşılık gelen bir parçasıdır. Her iki yöntem de bu ortak sınırlama adrese, BirA * enzim üzerinde dayalı bir protein parçaları uluslara tahlil mühendislik. Bu tahlil, iki etkin olmayan parçaları BirA * yakın hangi onlar erimiş iki etkileşen proteinler tarafından getirdiğinde etkin bir enzim içine yeniden monte. Elde edilen Böl-BioID tahlil böylece etkileşen proteinler bir çift bir araya proteinler etiketlerine göre sağlar. Bu iki yalnızca belirli bir bağlamda etkileşim sağlanan bölme-BioID onların yerel hücresel ortamlarında belirli içerik bağımlı işlevsel birimler analiz sonra sağlar. Burada, test etmek ve split-BioID etkileşen proteinler çiftine uygulanan adım adım bir protokol sağlar.

Nasıl bu yöntem inşaat Ago2, proteinlerin açık okuma çerçevesi (ORFs) göstermek için TNRC6C ve Dicer (tüm yolu susturmak miRNA-aracılı gen içinde karıştırmak) Böl-BioID plazmid klonlanmış. Ago2 çeviri represses bir miRNA-induced silencing kompleksi içinde (miRISC) TNRC6C ile etkileşim ve hedef mRNA'ların14çürüme teşvik olduğu bilinmektedir. MiRISC, Ago2 birleştirmek için baş rahip Dicer, içinde miRNA15ile dolu bir kompleksi içinde olgun miRNAs üreten enzim ile etkileşim. Bu nedenle Böl-BioID Ago2/Dicer çifti veya Ago2/TNRC6C çift uygulandı. İçin her çifti test edilmiş proteinlerin Ago2 ya NBirA * veya CBirA * bizim split-BioID plazmid (Şekil 2) kullanarak için erimiş ve Dicer ve TNRC6C için karşılık gelen soydaş BirA * parçası oldu. Buna ek olarak, her protein CBirA * erimiş ve bir NBirA * ile eşleştirilmiş-GFP füzyon olarak bir negatif kontrol. Bu test protein (Tablo 1) birbirine çiftinin dört yinelemenin test sonuçlar.
Böl-BioID test edilmiş proteinlerin çifti etkileşim aktif olup olmadığını sınamak için şekil 1' de tasvir düzeni takip ettik. Plazmid geçici bir tet-sistem uyumlu HeLa hücre kültürünü transfected. Ifade füzyon proteinlerin Doksisiklin (dox) ile indüklenen ve biotinylation aşırı biotin büyüme ortamına ekleyerek teşvik. 20 h kuluçka ile bir süre dox ve biotin, hücreleri lysed ve biotinylated proteinler algılamaya konjuge streptavidin kullanarak Western Blot tarafından analiz edilebilir. Memeli hücrelerinde iki büyük grup genellikle konjuge streptavidin untransfected örnek (şekil 3, yıldız) tarafından algılanır ve endogenously biotinylated proteinler (en büyük olasılıkla mitokondrial karboksilaz) karşılık gelir. Bu iki grup tüm örneklerinde bulunması ve uygun iç yükleme denetimi olarak kullanılabilir, bu nedenle eşit protein miktarları yüklenmesini denetlemek için bir temizlik protein tespiti yersiz olur. Tipik bir BioID/Böl-BioID deney, gözlenen ek büyük gruplar kendi biotinylated var füzyon proteinlerdir. Diğer bir biotinylated protein görüldüğünde bile biotinylation füzyon proteinlerin zaten bu aşamada tespit iki test protein hücrelerde etkileşim gösterir. Şekil 3üzerinde tasvir deneyde, bu bir NBirA * olan belli ki-CBirA * TNRC6C veya Dicer füzyon ile eşleştirilmiş Ago2 füzyon proteinidir hangi CBirA ters kombinasyonları daha verimli-Ago2 diğer iki NBirA * füzyon için eşleştirilmiş proteinler (şekil 3, üst paneli, Kulvar 6-7 için 2-3 hatlarının yoğunluklarda karşılaştırın). Ayrıca, belgili tanımlık harekete geçirmek CBirA * füzyon hiçbiri NBirA * etkinleştirmek gibi belirli-GFP denetim füzyon protein kayda değer düzeyde (şekil 3, Karşılaştır şeritli 1, 4-5 untransfected hücrelere karşılık gelen lane 8). Bizim plazmid içinde NBirA * myc etiket ve CBirA * bir bayrak etiket (Şekil 2) vardır beri her füzyon protein ifade seviyede bu iki etiket (şekil 3, alt paneli) karşı antikor ile analiz edilebilir.
Etkileşim kaynaklı biotinylation gözlenen deney ölçeklendirilebilir ve biotinylated proteinler streptavidin birleştiğinde boncuk Protokolü (şekil 4) 4 paragrafta belirtildiği şekilde izole. Yalıtım ilk kez gerçekleştirilirken, tüm belgili tanımlık merdiven arıtma Western Blot (şekil 5tarafından) analiz. Genellikle, boncuk bağlama-meli var olmak neredeyse nicel ve hemen hemen hiçbir sızıntı yoluyla yıkar dikkat edilmelidir. Önce işleme örnekleri için kütle spektrometresi, indüklenen biotinylation beklendiği gibi çalıştı ve füzyon protein ifade edildi emin olmak için bir Western blot çalışan öneririz. Ya zavallı transfection verimlilik veya hatalı dox indüksiyon nedeniyle ifade füzyon proteinlerin eksikliğidir. Füzyon protein ifade edildi ancak hiçbir biotinylation gözlenen, aşırı biotin (50 mikron) aslında Orta olarak eklendi ve hisse senedi biotin hala etkin olduğunu denetleyin. Eluted malzeme üzerinde bir protein Coomassie lekeli jel (şekil 6), tipik olarak analiz edilir zaman, uyması gereken en güçlü grup yaklaşık 17 kDa çalışır ve monomeric streptavidin karşılık gelir. Endojen biotinylated proteinler ve füzyon protein karşılık gelen bantları da gözlenen. Biz genellikle streptavidin grup yükleme iyi (şekil 6) kadar yukarıda örnek lane alan tüketim. Eksize grubun bir 1,5 mL tüp içinde saklanır ve bir kütle spektrometresi tesisine gönderilir. Alternatif olarak, ilişkili proteinler de streptavidin birleştiğinde boncuk tripsin sindirmek olabilir ve eluted sindirilmiş peptidler sütun oluşturur. Biz düzenli olarak kullanın (çoğunlukla varsayılan parametrelerini kullanarak başvuru 9 tipik MS sonuçları ve daha fazla bilgi için bkz: lizin biotinylation mümkün translasyonel modifikasyon ekleme,) MaxQuant yazılım ve16 MS ham veri analiz etmek ve Perseus suite17 sonraki istatistiksel analiz için her ikisi de özgür yazılım olan. Örnekler genellikle üç biyolojik çoğaltır çalıştırılır. Etiket içermeyen miktar kullanarak, özel olarak zenginleştirilmiş proteinler denetim koşulları üzerinde tespit edilebilir. Endogenously biotinylated proteinleri ve özellikle sigara BirA * enzim tarafından etiketlenir proteinler için filtre uygulamak için yalnızca önemli ölçüde üzerinde sayısı altı ilgisiz proteinler ile oluşturulan altı veri kümesinden gelen zenginleştirilmiş proteinler düşünün. Buna ek olarak, biz sadece üzerinde bir split-BioID veri kümesi içinde NBirA * füzyon protein yerini almış NBirA * tarafından zenginleştirilmiş sayısı düşünün-GFP. Diğer veri analizi stratejileri özellikle hücre kültürü (SILAC) kantitatif proteomik18amino asitleri ile kararlı izotop etiketleme kullanarak önerilmiştir. Ayrıca, çeşitli stratejileri biotinylated peptidler organik çözücüler19 veya biotin özgü kullanarak özel elüsyon koşullar biotin18, zayıflamış benzeşimli bir streptavidin değişken kullanarak doğrudan yalıtımı için tarif var antikorlar20,21. Mutlaka daha fazla protein keşfi için önde gelen, biotinylation siteleri tanımlaması Ekle sayısı belirgin olarak daha fazla güven ve yararlı ne zaman bir etkileşim topolojisinin ele alıyor.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57479/57479fig1.jpg"> Şekil 1: split-BioID yordam bakış. Protein 1 protein 2 karmaşık bir parçası olarak ya da protein 3 karmaşık B. parçası olarak etkileşim kurar Özellikle karmaşık a kompozisyon soruşturma için protein 1 ve 2 Böl-BioID uygulanabilir. Kütle Spektrometre fotoğrafı bir Creative Commons Attribution-Share Alike 3,0 dağıtıma açıktır lisansı altında ve https://commons.wikimedia.org ThermoScientificOrbitrapElite.JPG dosya adı ile indirilen. <a href="/files/ftp_upload/57479/57479fig1large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57479/57479fig2.jpg"> Şekil 2: split-BioID plazmid ifade kasetleri. Biz NBirA * ve CBirA * füzyon protein tüm kombinasyonları test izin vermek için dört plazmid sağlar. Plazmid ve tam haritalar addgene.org belirtilen numaraları altında bulabilirsiniz. Plazmid tet-yanıt veren öğe (7 x tetO) ve tet ifade sistemi ile uyumlu bir hücre satır kullanılmak üzere gerekir. Ayrıca tüm plazmid FRB ve FKBP ORFs NBirA * erimiş ve parçaları CBirA * sırasıyla dikkat edin. Sadece rapamycin varlığında bu iki protein etkileşim ve bu nedenle plazmid sistemi bu kimyasal9içinde hızlı bir şekilde test için kullanılabilir. Belirtilen kısıtlama benzersiz sitelerdir. <a href="/files/ftp_upload/57479/57479fig2large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57479/57479fig3.jpg"> Resim 3: bir split-BioID deneme için tipik Western blot. Üst paneli: biotinylated proteinler fluorescently etiketli streptavidin ile tespiti. Alt paneli: Anti-Myc ve anti-bayrak antikorları ile füzyon proteinlerin algılama. İki çift proteinlerin test edildi: Ago2/TNRC6C ve Ago2/Dicer. Yolları 2 & 3, Ago2 CBirA * parçası için eklenen. Yolları 6 & 7, Ago2 NBirA * parçası için eklenen. Önemli sinyal yok ne zaman herhangi üç proteinlerin NBirA * ile kombine edilmiştir gözlendi-GFP (şerit 1, 4-5). Yıldızlar endogenously iç yükleme denetimi olarak hizmet verebilir biotinylated proteinler karşılık gelen grupları gösterir. Bu rakam Schopp vd. şekil 5B adapte 9 bir Creative Commons Attribution 4.0 uluslararası lisansı altında. <a href="/files/ftp_upload/57479/57479fig3large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57479/57479fig4.jpg"> Şekil 4: streptavidin açılan yordama genel bakış. Kütle spektrometresi analiz için biotinylated proteinlerin yalıtım için önemli adımlar tasvir edilmektedir. <a href="/files/ftp_upload/57479/57479fig4large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57479/57479fig5.jpg"> Şekil 5: tipik Western blot streptavidin açılan deneme için. Eşit hacimli belirtilen her örnek üzerinde bir SDS-polyacrylamide jel dolu. Western Blot takiben biotinylated proteinler HRP birleştiğinde streptavidin ile tespit edildi. NBirA * karşılık gelen bantları-TNRC6C ve CBirA *-Ago2 belirtilir. <a href="/files/ftp_upload/57479/57479fig5large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57479/57479fig6.jpg"> Şekil 6: kütle spektrometresi analiz için tipik Coomassie lekeli protein jel. Streptavidin birleştiğinde boncuk eluted örnekten prekast protein jel üzerinde yüklü ve örnek göç kadar 2-3 cm çalıştırın. 17 kDa görülen büyük grubudur streptavidin. Hemen üstüne o grup alanı eksize ve kütle spektrometresi tesisine gönderdi. NBirA * karşılık gelen bantları-TNRC6C ve CBirA *-Ago2 belirtilir. <a href="/files/ftp_upload/57479/57479fig6large.jpg" target="_blank">Bu rakam daha büyük bir versiyonunu görüntülemek için buraya tıklayınız.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Transfection örnek</td>
			<td colspan="3">Test durumu</td>
		</tr>
<tr>
<td>1</td>
			<td colspan="3">NBirA *-protein1 / CBirA *-protein2</td>
		</tr>
<tr>
<td>2</td>
			<td colspan="3">CBirA *-protein1 / NBirA *-protein2</td>
		</tr>
<tr>
<td>3</td>
			<td colspan="3">NBirA *-GFP / CBirA *-protein1</td>
		</tr>
<tr>
<td>4</td>
			<td colspan="3">NBirA *-GFP / CBirA *-protein2</td>
		</tr>
<tr>
<td>5</td>
			<td colspan="3">yok transfection</td>
		</tr>
</tbody></table>Tablo 1: Split-BioID için iki protein uygularken koşullar genellikle test edilmiştir.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody>
<tr>
<td>Sıralama astar</td>
			<td>sıra</td>
		</tr>
<tr>
<td>Kaset 1 ters astar (CBirA füzyon)</td>
			<td>TATACTTTCTAGAGAATAGGAAC</td>
		</tr>
<tr>
<td>Kaset 2 ters astar (NBirA füzyon)</td>
			<td>GTGGTTTGTCCAAACTCATC</td>
		</tr>
</tbody></table>Tablo 2: astar için split-BioID plazmid sıralanıyor.

Watch this Scientific Journal Video about Split-BioID â€” Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment at JoVE.com

Split-BioID &#8212; Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

Böl-BioID, BioID yakınlık etiketleme tekniğine dayalı bir protein parçaları-uluslara tahlil için adım adım bir protokol sağlar. İki verilen protein etkileşimi harekete geçirmek, o kendi yerel hücresel ortamlarında içerik bağımlı protein kompleksleri proteomik analiz sağlar. Yöntemi basit, uygun maliyetli ve yalnızca standart Laboratuar donanımları gerektirir.

Split-BioID — Proteomik analiz onların yerel hücresel ortamında içeriğe özel Protein kompleksleri

To complement existing affinity purification (AP) approaches for the identification of protein-protein interactions (PPI), enzymes have been introduced ...

split-bioid-proteomic-analysis-context-specific-protein-complexes

Research

JoVE Journal

Biochemistry

19.7K Görüntüleme.  Heidelberg University. Böl-BioID, BioID yakınlık etiketleme tekniğine dayalı bir protein parçaları-uluslara tahlil için adım adım bir protokol sağlar. İki verilen protein etkileşimi harekete geçirmek, o kendi yerel hücresel ortamlarında içerik bağımlı protein kompleksleri proteomik analiz sağlar. Yöntemi basit, uygun maliyetli ve yalnızca standart Laboratuar donanımları gerektirir.

Video: Split-BioID — Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

Protein Complex Affinity Capture from Cryomilled Mammalian Cells

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this technique is also frequently referred to as immunoprecipitation. Affinity capture can be applied in a bench-scale and in a high-throughput context. When coupled with protein mass spectrometry, affinity capture has proven to be a workhorse of interactome analysis. Although there are potentially many ways to execute the numerous steps involved, the following protocols implement our favored methods. Two features are distinctive: the use of cryomilled cell powder to produce cell extracts, and antibody-coupled paramagnetic beads as the affinity medium. In many cases, we have obtained superior results to those obtained with more conventional affinity capture practices. Cryomilling avoids numerous problems associated with other forms of cell breakage. It provides efficient breakage of the material, while avoiding denaturation issues associated with heating or foaming. It retains the native protein concentration up to the point of extraction, mitigating macromolecular dissociation. It reduces the time extracted proteins spend in solution, limiting deleterious enzymatic activities, and it may reduce the non-specific adsorption of proteins by the affinity medium. Micron-scale magnetic affinity media have become more commonplace over the last several years, increasingly replacing the traditional agarose- and Sepharose-based media. Primary benefits of magnetic media include typically lower non-specific protein adsorption; no size exclusion limit because protein complex binding occurs on the bead surface rather than within pores; and ease of manipulation and handling using magnets.

Here we describe protocols to disrupt mammalian cells by solid-state milling at a cryogenic temperature, produce a cell extract from the resulting cell powder, and isolate protein complexes of interest by affinity capture upon antibody-coupled micron-scale paramagnetic beads.

Cryomilled memeli hücrelerinden protein kompleksi olan ele geçirme kapasitesini

Affinity capture is an effective technique for isolating endogenous protein complexes for further study. When used in conjunction with an antibody, this ...

Biyokimya

Resolving Affinity Purified Protein Complexes by Blue Native PAGE and Protein Correlation Profiling

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological processes. Affinity purification coupled to mass spectrometry (AP-MS) has become the method of choice for identifying protein-protein interactions. However, conventional AP-MS studies provide information on protein interactions, but the organizational information is lost. To address this issue, we developed a strategy to unravel the distinct functional assemblies a protein might be involved in, by resolving affinity-purified protein complexes prior to their characterization by mass spectrometry. Protein complexes isolated through affinity purification of a bait protein using an epitope tag and competitive elution are separated through blue native electrophoresis. Comparison of protein migration profiles through correlation profiling using quantitative mass spectrometry allows assignment of interacting proteins to distinct molecular entities. This method is able to resolve protein complexes of close molecular weights that might not be resolved by traditional chromatographic techniques such as gel filtration. With little more work than conventional AP-geLC-MS/MS, we demonstrate this strategy may in many cases be adequate for obtaining protein complex topological information concomitantly to identifying protein interactions.

Here we present protocols for affinity purification of protein complexes and their separation by blue native PAGE, followed by protein correlation profiling using label free quantitative mass spectrometry. This method is useful to resolve interactomes into distinct protein complexes.

Mavi Yerli PAGE ve Protein İlişkisi Profil Yöntemi ile Affinity Saf protein Kompleksler çözümleniyor

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological ...

Identification of protein complexes with quantitative proteomics in S. cerevisiae

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as important intracellular signalling molecules. However, unlike proteins, lipids are small hydrophobic molecules that traffic primarily by poorly described nonvesicular routes, which are hypothesized to occur at membrane contact sites (MCSs). MCSs are regions where the endoplasmic reticulum (ER) makes direct physical contact with a partnering organelle, e.g., plasma membrane (PM). The ER portion of ER-PM MCSs is enriched in lipid-synthesizing enzymes, suggesting that lipid synthesis is directed to these sites and implying that MCSs are important for lipid traffic. Yeast is an ideal model to study ER-PM MCSs because of their abundance, with over 1000 contacts per cell, and their conserved nature in all eukaryotes. Uncovering the proteins that constitute MCSs is critical to understanding how lipids traffic is accomplished in cells, and how they act as signaling molecules. We have found that an ER called Scs2p localize to ER-PM MCSs and is important for their formation. We are focused on uncovering the molecular partners of Scs2p. Identification of protein complexes traditionally relies on first resolving purified protein samples by gel electrophoresis, followed by in-gel digestion of protein bands and analysis of peptides by mass spectrometry. This often limits the study to a small subset of proteins. Also, protein complexes are exposed to denaturing or non-physiological conditions during the procedure. To circumvent these problems, we have implemented a large-scale quantitative proteomics technique to extract unbiased and quantified data. We use stable isotope labeling with amino acids in cell culture (SILAC) to incorporate staple isotope nuclei in proteins in an untagged control strain. Equal volumes of tagged culture and untagged, SILAC-labeled culture are mixed together and lysed by grinding in liquid nitrogen. We then carry out an affinity purification procedure to pull down protein complexes. Finally, we precipitate the protein sample, which is ready for analysis by high-performance liquid chromatography/ tandem mass spectrometry. Most importantly, proteins in the control strain are labeled by the heavy isotope and will produce a mass/ charge shift that can be quantified against the unlabeled proteins in the bait strain. Therefore, contaminants, or unspecific binding can be easily eliminated. By using this approach, we have identified several novel proteins that localize to ER-PM MCSs. Here we present a detailed description of our approach. 

Here we describe a new quantitative proteomics technique for identifying protein complexes in Saccharomyces cerevisiae. In this study, we have used the SILAC method together with affinity purification followed by tandem mass spectrometry to identify with high specificity the binding partners of an ER protein, Scs2p.

S. cerevisiae, kantitatif proteomik protein kompleksleri tanımlanması

Lipids are the building blocks of cellular membranes that function as barriers and in compartmentalization of cellular processes, and recently, as ...

Biyoloji

High-Resolution Complexome Profiling by Cryoslicing BN-MS Analysis

Proteins generally exert biological functions through interactions with other proteins, either in dynamic protein assemblies or as a part of stably formed complexes. The latter can be elegantly resolved according to molecular size using native polyacrylamide gel electrophoresis (BN-PAGE). Coupling of such separations to sensitive mass spectrometry (BN-MS) has been well-established and theoretically allows for exhaustive assessment of the extractable complexome in biological samples. However, this approach is rather laborious and provides limited complex size resolution and sensitivity. Also, its application has remained restricted to abundant mitochondrial and plastid proteins. Thus, for a majority of proteins, information regarding integration into stable protein complexes is still lacking. Presented here is an optimized approach for complexome profiling comprising preparative-scale BN-PAGE separation, sub-millimeter sampling of broad gel lanes by cryomicrotome slicing, and mass spectrometric analysis with label-free protein quantification. The procedures and tools for critical steps are described in detail. As an application, the report describes complexome analysis of a solubilized endosome-enriched membrane fraction from mouse kidneys, with 2,545 proteins profiled in total. The results demonstrate identification of uniform, low-abundance membrane proteins such as intracellular ion channels as well as high resolution, complex protein assembly patterns, including glycosylation isoforms. The results are in agreement with independent biochemical analyses. In summary, this methodology allows for comprehensive and unbiased identification of protein (super)complexes and their subunit composition, providing a basis for investigating stoichiometry, assembly, and interaction dynamics of protein complexes in any biological system.

A versatile cryoslicing BN-MS protocol using a microtome is presented for high-resolution complexome profiling.

BN-MS Analizi Cryoslicing tarafından Yüksek Çözünürlüklü Complexome Profilleme

Proteins generally exert biological functions through interactions with other proteins, either in dynamic protein assemblies or as a part of stably formed ...

Analyzing Protein Architectures and Protein-Ligand Complexes by Integrative Structural Mass Spectrometry

Proteins are an important class of biological macromolecules that play many key roles in cellular functions including gene expression, catalyzing metabolic reactions, DNA repair and replication. Therefore, a detailed understanding of these processes provides critical information on how cells function. Integrative structural MS methods offer structural and dynamical information on protein complex assembly, complex connectivity, subunit stoichiometry, protein oligomerization and ligand binding. Recent advances in integrative structural MS have allowed for the characterization of challenging biological systems including large DNA binding proteins and membrane proteins. This protocol describes how to integrate diverse MS data such as native MS and ion mobility-mass spectrometry (IM-MS) with molecular dynamics simulations to gain insights into a helicase-nuclease DNA repair protein complex. The resulting approach provides a framework for detailed studies of ligand binding to other protein complexes involved in important biological processes.

Mass spectrometry (MS) has emerged as an important tool for the investigation of structure and dynamics of macromolecular assemblies. Here, we integrate MS-based approaches to interrogate protein complex formation and ligand binding.

Protein mimarileri ve Protein-Ligand komplekslerinin bütünleştirici yapısal kütle spektrometresi tarafından analiz

Proteins are an important class of biological macromolecules that play many key roles in cellular functions including gene expression, catalyzing ...

Kimya

JUMPn: A Streamlined Application for Protein Co-Expression Clustering and Network Analysis in Proteomics

With recent advances in mass spectrometry-based proteomics technologies, deep profiling of hundreds of proteomes has become increasingly feasible. However, deriving biological insights from such valuable datasets is challenging. Here we introduce a systems biology-based software JUMPn, and its associated protocol to organize the proteome into protein co-expression clusters across samples and protein-protein interaction (PPI) networks connected by modules (e.g., protein complexes). Using the R/Shiny platform, the JUMPn software streamlines the analysis of co-expression clustering, pathway enrichment, and PPI module detection, with integrated data visualization and a user-friendly interface. The main steps of the protocol include installation of the JUMPn software, the definition of differentially expressed proteins or the (dys)regulated proteome, determination of meaningful co-expression clusters and PPI modules, and result visualization. While the protocol is demonstrated using an isobaric labeling-based proteome profile, JUMPn is generally applicable to a wide range of quantitative datasets (e.g., label-free proteomics). The JUMPn software and protocol thus provide a powerful tool to facilitate biological interpretation in quantitative proteomics.

We present a systems biology tool JUMPn to perform and visualize network analysis for quantitative proteomics data, with a detailed protocol including data pre-processing, co-expression clustering, pathway enrichment, and protein-protein interaction network analysis.

JUMPn: Proteomikte Protein Ko-İfade Kümelemesi ve Ağ Analizi için Kolaylaştırılmış Bir Uygulama

With recent advances in mass spectrometry-based proteomics technologies, deep profiling of hundreds of proteomes has become increasingly feasible. ...

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification (BiCAP)

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research is deciphering how these dynamic protein complexes act to integrate signals from multiple sources in order to direct a specific biological response, and how this becomes deregulated in many disease settings. Despite the importance of this key biochemical mechanism, there is a lack of experimental techniques that can facilitate the specific and sensitive deconvolution of these multi-molecular signaling complexes.
Here this shortcoming is addressed through the combination of a protein complementation assay with a conformation-specific nanobody, which we have termed Bimolecular Complementation Affinity Purification (BiCAP). This novel technique facilitates the specific isolation and downstream proteomic characterization of any pair of interacting proteins, to the exclusion of un-complexed individual proteins and complexes formed with competing binding partners. 
The BiCAP technique is adaptable to a wide array of downstream experimental assays, and the high degree of specificity afforded by this technique allows more nuanced investigations into the mechanics of protein complex assembly than is currently possible using standard affinity purification techniques.

Dissecting Multi-protein Signaling Complexes by Bimolecular Complementation Affinity Purification BiCAP

This manuscript describes the protocol for Bimolecular Complementation Affinity Purification (BiCAP). This novel method facilitates the specific isolation and downstream proteomic characterization of any two interacting proteins, while excluding un-complexed individual proteins as well as complexes formed with competing binding partners.

Bimolecular tamamlayıcı benzeşme arıtma (BiCAP) tarafından parçalanmış çok protein sinyal kompleksleri

The assembly of protein complexes is a central mechanism underlying the regulation of many cell signaling pathways. A major focus of biomedical research ...

İmmünoloji ve Enfeksiyon

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the identification of the subunit composition of multi-protein complexes can provide insight into gene function and enhance understanding of biological systems1, 2. Physical interactions can be mapped with high confidence vialarge-scale isolation and characterization of endogenous protein complexes under near-physiological conditions based on affinity purification of chromosomally-tagged proteins in combination with mass spectrometry (APMS). This approach has been successfully applied in evolutionarily diverse organisms, including yeast, flies, worms, mammalian cells, and bacteria1-6. In particular, we have generated a carboxy-terminal Sequential Peptide Affinity (SPA) dual tagging system for affinity-purifying native protein complexes from cultured gram-negative Escherichia coli, using genetically-tractable host laboratory strains that are well-suited for genome-wide investigations of the fundamental biology and conserved processes of prokaryotes1, 2, 7. Our SPA-tagging system is analogous to the tandem affinity purification method developed originally for yeast8, 9, and consists of a calmodulin binding peptide (CBP) followed by the cleavage site for the highly specific tobacco etch virus (TEV) protease and three copies of the FLAG epitope (3X FLAG), allowing for two consecutive rounds of affinity enrichment. After cassette amplification, sequence-specific linear PCR products encoding the SPA-tag and a selectable marker are integrated and expressed in frame as carboxy-terminal fusions in a DY330 background that is induced to transiently express a highly efficient heterologous bacteriophage lambda recombination system10. Subsequent dual-step purification using calmodulin and anti-FLAG affinity beads enables the highly selective and efficient recovery of even low abundance protein complexes from large-scale cultures. Tandem mass spectrometry is then used to identify the stably co-purifying proteins with high sensitivity (low nanogram detection limits).
Here, we describe detailed step-by-step procedures we commonly use for systematic protein tagging, purification and mass spectrometry-based analysis of soluble protein complexes from E. coli, which can be scaled up and potentially tailored to other bacterial species, including certain opportunistic pathogens that are amenable to recombineering. The resulting physical interactions can often reveal interesting unexpected components and connections suggesting novel mechanistic links. Integration of the PPI data with alternate molecular association data such as genetic (gene-gene) interactions and genomic-context (GC) predictions can facilitate elucidation of the global molecular organization of multi-protein complexes within biological pathways. The networks generated for E. coli can be used to gain insight into the functional architecture of orthologous gene products in other microbes for which functional annotations are currently lacking.

Identification of Protein Complexes in Escherichia coli using Sequential Peptide Affinity Purification in Combination with Tandem Mass Spectrometry

Affinity purification of tagged proteins in combination with mass spectrometry (APMS) is a powerful method for the systematic mapping of protein interaction networks and for investigating the mechanistic basis of biological processes. Here, we describe an optimized sequential peptide affinity (SPA) APMS procedure developed for the bacterium Escherichia coli that can be used to isolate and characterize stable multi-protein complexes to near homogeneity even starting from low copy numbers per cell.

Protein Kompleksi belirlenmesi<em&gt; Escherichia coli</em&gt; Tandem Kütle Spektrometresi ile Kombine Sıralı Peptid Affinity Arıtma kullanarak

Since most cellular processes are mediated by macromolecular assemblies, the systematic identification of protein-protein interactions (PPI) and the ...

A New Approach for the Comparative Analysis of Multiprotein Complexes Based on 15N Metabolic Labeling and Quantitative Mass Spectrometry

The introduced protocol provides a tool for the analysis of multiprotein complexes in the thylakoid membrane, by revealing insights into complex composition under different conditions. In this protocol the approach is demonstrated by comparing the composition of the protein complex responsible for cyclic electron flow (CEF) in Chlamydomonas reinhardtii, isolated from genetically different strains. The procedure comprises the isolation of thylakoid membranes, followed by their separation into multiprotein complexes by sucrose density gradient centrifugation, SDS-PAGE, immunodetection and comparative, quantitative mass spectrometry (MS) based on differential metabolic labeling (14N/15N) of the analyzed strains. Detergent solubilized thylakoid membranes are loaded on sucrose density gradients at equal chlorophyll concentration. After ultracentrifugation, the gradients are separated into fractions, which are analyzed by mass-spectrometry based on equal volume. This approach allows the investigation of the composition within the gradient fractions and moreover to analyze the migration behavior of different proteins, especially focusing on ANR1, CAS, and PGRL1. Furthermore, this method is demonstrated by confirming the results with immunoblotting and additionally by supporting the findings from previous studies (the identification and PSI-dependent migration of proteins that were previously described to be part of the CEF-supercomplex such as PGRL1, FNR, and cyt f). Notably, this approach is applicable to address a broad range of questions for which this protocol can be adopted and e.g. used for comparative analyses of multiprotein complex composition isolated from distinct environmental conditions.

A New Approach for the Comparative Analysis of Multiprotein Complexes Based on 15N Metabolic Labeling and Quantitative Mass Spectrometry

The described comparative, quantitative proteomic approach aims at obtaining insights into the composition of multiprotein complexes&#160;under different conditions and is demonstrated by comparing genetically different strains. For quantitative analysis equal volumes of different fractions from a sucrose density gradient are mixed and analyzed by mass spectrometry.

Multiprotein kompleksleri Karşılaştırmalı Analizi için Yeni Bir Yaklaşım dayanarak<sup&gt; 15</sup&gt; N Metabolik Etiketleme ve Kantitatif Kütle Spektrometre

The introduced protocol provides a tool for the analysis of multiprotein complexes in the thylakoid membrane, by revealing insights into complex ...

Combining Chemical Cross-linking and Mass Spectrometry of Intact Protein Complexes to Study the Architecture of Multi-subunit Protein Assemblies

Proteins interact with their ligands to form active and dynamic assemblies which carry out various cellular functions. Elucidating these interactions is therefore fundamental for the understanding of cellular processes. However, many protein complexes are dynamic assemblies and are not accessible by conventional structural techniques. Mass spectrometry contributes to the structural investigation of these assemblies, and particularly the combination of various mass spectrometric techniques delivers valuable insights into their structural arrangement.
In this article, we describe the application and combination of two complementary mass spectrometric techniques, namely chemical cross-linking coupled with mass spectrometry and native mass spectrometry. Chemical cross-linking involves the covalent linkage of amino acids in close proximity by using chemical reagents. After digestion with proteases, cross-linked di-peptides are identified by mass spectrometry and protein interactions sites are uncovered. Native mass spectrometry on the other hand is the analysis of intact protein assemblies in the gas phase of a mass spectrometer. It reveals protein stoichiometries as well as protein and ligand interactions. Both techniques therefore deliver complementary information on the structure of protein-ligand assemblies and their combination proved powerful in previous studies.

The architecture of protein complexes is essential for their function. Combining various mass spectrometric techniques proved powerful to study their assembly. We provide protocols for chemical cross-linking and native mass spectrometry and show how these complementary techniques help to elucidate the architecture of multi-subunit protein assemblies.

Kimyasal Cross-linking ve çoklu alt birim Protein derlemeler mimarlık okumak için olduğu gibi Protein kompleksleri kütle spektrometresi birleştirme

Proteins interact with their ligands to form active and dynamic assemblies which carry out various cellular functions. Elucidating these interactions is ...

Split-BioID — Proteomik analiz onların yerel hücresel ortamında içeriğe özel Protein kompleksleri

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler