This work was supported by an Alfred P. Sloan Research Fellowship (to C.-F.C.) and an NIH R01 grant (5R01GM098026-05 to C.-F.C.). We thank David Crowe for access to the advanced infrared imaging system.

NOTE: EMSAs using fluorescently labeled DNA probes or other forms of labeled DNA share the same protocols for protein or cell extract preparation, protein-DNA binding reaction, and PAGE gel preparation and running (Figure 1A). The key differences are DNA labeling procedures, post-run gel processing steps, and detection methods.
1. Gel Preparation
<ol>
	<li>Prepare 5% native polyacrylamide gel containing 0.5x&#160;TBE (45 mM Tris-Borate, 1 mM EDTA) and 2.5% glycerol, using a mini protein gel system (8.3 cm width x 7.3 cm length x 0.75 mm thickness).
	<ol>
		<li>To prepare 30 mL&#160;of gel solution for 4 gels, mix 5 mL of 30% Acrylamide/Bis (37.5:1), 3 mL&#160;of 5x TBE (0.45 M Tris-Borate, 10 mM EDTA), 1.5 mL of 50% Glycerol, 300 &#181;L of 10% Ammonium Persulfate, 15 &#181;L&#160;of TEMED, and 20.2 mL of ddH2O thoroughly. 
		NOTE: Acrylamide is harmful and toxic, handle with appropriate personal protective equipment.</li>
	</ol>
	</li>
	<li>Cast the gel solution immediately. After polymerization, wrap the gels in clear plastic wrap pre-wetted with 0.5x TBE and store them at 4 &#176;C.</li>
</ol>
2. Preparation of Infrared Fluorescent Dye-labeled Probes
NOTE: Keep the infrared fluorescent dye-labeled oligonucleotides away from light as much as possible during preparation, storage, and experiments.
<ol>
	<li>Design and order oligonucleotides.
	<ol>
		<li>Design long oligonucleotide for ~51-mers. 
		NOTE: The long oligonucleotide sequence of the LIM-4/SOX-2 probe is TATCATATCTATTCTATGATTAAATACCTATTCATTTCAAAATCTTCTCCC. Long oligonucleotides do not require PAGE or HPLC purification.</li>
		<li>Design complementary short oligonucleotides for ~14-mers with infrared fluorescent dye modification at the 5&#39; terminus (5&#39;Dye) and a melting temperature above 37 &#176;C. 
		NOTE: The short oligonucleotide sequence of the LIM-4/SOX-2 probe is 5&#39;Dye-GGGAGAAGATTTTG. The minimum synthesis scale of 5&#39;Dye-labeled short oligonucleotides is 100 nM. Therefore, the oligonucleotides require HPLC purification.</li>
	</ol>
	</li>
	<li>Resuspend oligonucleotides in 1x Tris-EDTA buffer (TE: 10 mM Tris-HCl, pH 8.0; 1 mM EDTA) to final concentration of 100 &#181;M.</li>
	<li>Anneal Short (5&#39;Dye) and Long oligonucleotides.
	<ol>
		<li>Mix 0.6 &#181;L&#160;of 5&#39;Dye-Short oligo (100 &#181;M), 1.2 &#181;L&#160;of Long oligo (100 &#181;M), and 28.2 &#181;L&#160;of sodium chloride-Tris-EDTA buffer (STE: 100 mM NaCl;&#160;10 mM Tris-HCl, pH 8.0;&#160;1 mM EDTA) in a 1.5 mL&#160;tube.</li>
		<li>Place the tube in boiling water for 5 min. Turn off the heat source and let the water with the annealed oligos cool O/N in the dark.</li>
	</ol>
	</li>
	<li>Fill in the 5&#39; overhangs of annealed 5&#39;Dye-Short/Long oligos with Klenow DNA polymerase to make double stranded DNA probes.
	<ol>
		<li>Prepare the reaction by mixing 30 &#181;L&#160;of annealed short/long oligos with 5&#39;Dye tag, 8.5 &#181;L&#160;of 10x Klenow buffer, 1.7 &#181;L&#160;of 10 mM dNTPs, 1.7 &#181;L&#160;of Klenow (3&#39;-&#62;5&#39; exo-) (5 u/&#181;L), and 43.1 &#181;L&#160;of ddH2O in a 0.2 mL&#160;PCR tube.</li>
		<li>Incubate 60 min at 37 &#176;C in a PCR machine.</li>
		<li>Add 3.4 &#181;L&#160;0.5 M EDTA to stop the reaction and heat inactivate at 75 &#176;C for 20 min in a PCR machine.</li>
	</ol>
	</li>
	<li>Dilute filled-in probes (0.7 &#181;M) in STE for final concentration of 0.1 &#181;M.</li>
	<li>Store oligos at -20 &#176;C in the dark until ready to use. Oligos may be stored for up to a year in this condition. 
	NOTE: To generate DNA probes with mutant binding sites, mutant versions of long oligonucleotides are annealed with 5&#39;Dye-labeled short oligonucleotides, followed by fill-in of 5&#39; overhangs with Klenow. It has been shown that the probe with one strand labeled with an infrared fluorescent dye has only 30% intensity of the probe with both strands labeled with the dye. If signal intensity needs to be strengthened, long oligos of both strands are labeled with infrared fluorescent dyes at 5&#39; termini and annealed to make infrared fluorescent dye-labeled probes.</li>
</ol>
3. Preparation of Unlabeled/Cold Probes (Competitors)
Note: Long oligonucleotides of complementary sequences (Long and LongR) were annealed to make unlabeled probes for competition analysis with infrared fluorescent dye-labeled probes.
<ol>
	<li>Mix 20 &#181;L&#160;of 100 &#181;M Long, 20 &#181;L&#160;of 100 &#181;M LongR oligonucleotides, and 60 &#181;L&#160;of STE in a 1.5 mL&#160;tube.</li>
	<li>Place the tube in boiling water for 5 min, turn off the heat source and let the water with the annealed oligos cool overnight.</li>
</ol>
4. Binding Reaction and Electrophoresis
<ol>
	<li>Prepare 1 mL&#160;of 5x binding buffer by mixing 50 &#181;L&#160;of 1 M Tris-HCl, pH 7.5;&#160;10 &#181;L&#160;of 5 M NaCl;&#160;200 &#181;L&#160;of 1 M KCl, 5 &#181;L&#160;of 1 M MgCl2, 10 &#181;L&#160;of 0.5 M EDTA, pH 8.0;&#160;5 &#181;L&#160;of 1 M DTT;&#160;25 &#181;L&#160;of 10 mg/mL&#160;BSA, and 695 &#181;L&#160;of ddH2O. 
	NOTE: The 5x Binding Buffer can be aliquoted and stored at -20 &#176;C. Another point to consider is that different transcription factors will have different modifications to the binding buffer.</li>
	<li>Right before setting up binding reactions, pre-run the 5% native polyacrylamide gel in 0.5x TBE + 2.5% glycerol to remove all traces of ammonium persulfate at 80 V for 30&#160;- 60 min,&#160;or until the current no longer varies with time.</li>
	<li>Set up the binding reaction in final volume of 20 &#181;L.
	<ol>
		<li>Mix 4 &#181;L&#160;of 5x binding buffer, 80 - 200 ng purified protein A (in 50% glycerol, i.e., SOX-2), 1 &#181;L&#160;of 0.1 &#181;M Dye-conjugated probe (final concentration: 5 nM), and ddH2O.</li>
		<li>Optional: When cold probe competitors are required, add various concentrations (2x, 10x, 25x, 50x, 100x, etc.) of cold probes.</li>
		<li>Optional: When the interaction between proteins A and B (i.e., SOX-2 and LIM-4) is tested, add 80 - 200 ng purified protein B (in 50% glycerol,&#160;i.e., LIM-4).</li>
		<li>Optional: When nuclear extract preparation is used and specific binding of protein A is to be validated, add antibody specific to protein A (i.e., anti-6xHis, anti-FLAG, etc.).</li>
		<li>Incubate at R/T in dark for 15 min.</li>
	</ol>
	</li>
	<li>Load all of the binding reaction onto the gel and run the gel at 10 V/cm to desired distance.</li>
</ol>
5. Imaging
NOTE: The gel was scanned directly in the glass plates with an advanced infrared imaging system. Therefore, the gel can be resolved further and scanned repeatedly (Figures 1C and 2). A near-infrared fluorescent imaging system primarily for Western blots was also tested to scan the gel, but only the advanced infrared imaging system was able to scan the gel with good resolution. The methodology described is specific to a particular infrared imaging software, although other software packages may be used.
<ol>
	<li>Clean the bed of the scanner with ddH2O and dry well before scanning. Wipe dry the glass plates of the gel and place the plates containing the gel on the scanner bed.</li>
	<li>Open the infrared imaging software and go to the &#39;Acquire&#39; tab. When the thinner plate (1 mm) is placed on the scanner bed, use the settings of Channel: 700, Intensity: Auto, Resolution: 169 &#181;m, Quality: medium, and Focus offset: 1.5 mm. When the thicker plate (3 mm) is placed on the scanner bed, use the settings of Channel: 700, Intensity: Auto, Resolution: 84 &#181;m, Quality: medium, and Focus offset: 3.5 mm. Focus offset depends on the thickness of the glass plate.</li>
	<li>Select the area that the gel occupies on the scanner. Click &#39;Start&#39; to begin the scan.</li>
	<li>Repeat electrophoresis and scan additionally as necessary.</li>
</ol>

<ol>
	<li>Hellman, L. M., Fried, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+mobility+shift+assay+(EMSA)+for+detecting+protein-nucleic+acid+interactions.">Electrophoretic mobility shift assay (EMSA) for detecting protein-nucleic acid interactions.</a> Nat Protoc. 2, 1849-1861 (2007).</li><li>Ludwig, L. B., Hughes, B. J., Schwartz, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotinylated+probes+in+the+electrophoretic+mobility+shift+assay+to+examine+specific+dsDNA,+ssDNA+or+RNA-protein+interactions.">Biotinylated probes in the electrophoretic mobility shift assay to examine specific dsDNA, ssDNA or RNA-protein interactions.</a> Nucleic Acids Res. 23, 3792-3793 (1995).</li><li>Engler-Blum, G., Meier, M., Frank, J., Muller, G. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reduction+of+background+problems+in+nonradioactive+northern+and+Southern+blot+analyses+enables+higher+sensitivity+than+32P-based+hybridizations.">Reduction of background problems in nonradioactive northern and Southern blot analyses enables higher sensitivity than 32P-based hybridizations.</a> Anal Biochem. 210, 235-244 (1993).</li><li>Jing, D., Agnew, J., Patton, W. F., Hendrickson, J., Beechem, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+sensitive+two-color+electrophoretic+mobility+shift+assay+for+detecting+both+nucleic+acids+and+protein+in+gels.">A sensitive two-color electrophoretic mobility shift assay for detecting both nucleic acids and protein in gels.</a> Proteomics. 3, 1172-1180 (2003).</li><li>Alqadah, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Postmitotic+diversification+of+olfactory+neuron+types+is+mediated+by+differential+activities+of+the+HMG-box+transcription+factor+SOX-2.">Postmitotic diversification of olfactory neuron types is mediated by differential activities of the HMG-box transcription factor SOX-2.</a> EMBO J. 34, 2574-2589 (2015).</li><li>Jullien, N., Herman, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LUEGO:+a+cost+and+time+saving+gel+shift+procedure.">LUEGO: a cost and time saving gel shift procedure.</a> Biotechniques. 51, 267-269 (2011).</li><li>Poulin-Laprade, D., Burrus, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electrophoretic+Mobility+Shift+Assay+Using+Radiolabeled+DNA+Probes.">Electrophoretic Mobility Shift Assay Using Radiolabeled DNA Probes.</a> Methods Mol Biol. 1334, 1-15 (2015).</li><li>Ruscher, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence+based+non-radioactive+electrophoretic+mobility+shift+assay.">A fluorescence based non-radioactive electrophoretic mobility shift assay.</a> J Biotechnol. 78, 163-170 (2000).</li><li>Pagano, J. M., Clingman, C. C., Ryder, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+approaches+to+monitor+protein-nucleic+acid+interactions+using+fluorescent+probes.">Quantitative approaches to monitor protein-nucleic acid interactions using fluorescent probes.</a> RNA. 17, 14-20 (2011).</li><li>Alqadah, A., Hsieh, Y. W., Chuang, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sox2+goes+beyond+stem+cell+biology.">Sox2 goes beyond stem cell biology.</a> Cell cycle. , (2016).</li><li>Larouche, K., Bergeron, M. J., Leclerc, S., Guerin, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+competitor+poly(dI-dC).poly(dI-dC)+levels+is+advised+in+DNA-protein+interaction+studies+involving+enriched+nuclear+proteins.">Optimization of competitor poly(dI-dC).poly(dI-dC) levels is advised in DNA-protein interaction studies involving enriched nuclear proteins.</a> Biotechniques. 20, 439-444 (1996).</li><li>Sorenson, A. E., Schaeffer, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In-gel+detection+of+biotin-protein+conjugates+with+a+green+fluorescent+streptavidin+probe.">In-gel detection of biotin-protein conjugates with a green fluorescent streptavidin probe.</a> Anal. Methods. 7, 2087-2092 (2015).</li><li>Onizuka, T., Endo, S., Hirano, M., Kanai, S., Akiyama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+of+a+fluorescent+electrophoretic+mobility+shift+assay+improved+for+the+quantitative+and+multiple+analysis+of+protein-DNA+complexes.">Design of a fluorescent electrophoretic mobility shift assay improved for the quantitative and multiple analysis of protein-DNA complexes.</a> Biosci Biotechnol Biochem. 66, 2732-2734 (2002).</li><li>Steiner, S., Pfannschmidt, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence-based+electrophoretic+mobility+shift+assay+in+the+analysis+of+DNA-binding+proteins.">Fluorescence-based electrophoretic mobility shift assay in the analysis of DNA-binding proteins.</a> Methods Mol Biol. 479, 273-289 (2009).</li></ol>

The authors have nothing to disclose.

fEMSAs are an efficient tool to investigate protein-DNA interactions, and are an alternative to radioactive labeling of DNA. Fluorescent dyes such as infrared dyes are commercially available, and provide a safer and more environmentally friendly method compared to radioactive DNA labeling. EMSAs using infrared fluorescent dye-labeled oligonucleotides do not require postrun gel processing steps, and therefore save time and cost compared to other DNA labeling techniques. The time to detect bands using radioactive EMSAs can...

EMSAs are used to analyze interactions between DNA and proteins by using native PolyAcrylamide Gel Electrophoresis (PAGE) to resolve a mixture of a protein of interest and a labeled DNA probe containing potential target sites of the protein1. A DNA probe bound with protein will migrate slower compared with a free DNA probe, and is therefore retarded in its migration through a polyacrylamide matrix. Radiolabeling of DNA by 32P has been the predominant method for detection in EMSAs. Although the application of radiolabeling in biochemical research has been beneficial, methods of alternative DNA labeling with comparable sensitivity are being employed due to the health and safety risks associated with handling radioactivity. These alternative methods include conjugation of DNA with biotin2 or digoxigenin (DIG)3 (both of which are then detected by chemiluminescent systems), SYBR green staining of the PAGE gels4, or direct detection of DNA-fluorescent dye conjugates by scanning the gel5,6.
The resolved gels of EMSAs using radioactively labeled DNA probes require postrun processing through autoradiography films or a phosphorimager system to detect radioactive signals1,7. Gels of EMSAs using biotin-2 or DIG-conjugated3 DNA probes must also be processed and transferred onto a suitable membrane and then detected by chemiluminescence6. SYBR green staining of the gel requires postrun gel staining and a fluorescent scanner4. Since postrun gel processing steps are required for EMSAs using these DNA labeling techniques, the resolved gel can be assayed only once. In contrast, DNA probes labeled with fluorophores can be directly detected in the gel inside the glass plates by a scanner. Therefore, the DNA-protein interactions can be monitored and assayed several times at different time points during the run, which significantly reduces time and cost. The DNA-fluorescent dye conjugates that have been used for EMSAs include Cy36,8, Cy56,8, fluorescein9, and infrared fluorescent dyes4-6.
Transcriptional regulation requires protein-DNA interactions of transcription factors and their target genes. Coordination of these interactions generates diverse cell types from a common progenitor during animal development. An unbiased forward genetic screen identified a missense mutation, G73E, in the highly conserved HMG DNA-binding domain of the Caenorhabditis elegans transcription factor SOX-2. The mutation results in a cell identity transformation of AWB olfactory neurons into AWC olfactory neurons at molecular, morphological, and functional levels5,10. SOX-2 differentially regulates the terminal differentiation of AWB and AWC neurons by interacting with context-dependent partner transcription factors and respective DNA target sites5,10. SOX-2 partners with LIM-4 (LHX) in terminal AWB neuronal differentiation, while SOX-2 partners with CEH-36 (OTX/OTD) in terminal AWC neuronal differentiation. Luciferase reporter assays show that SOX-2 and mutant SOX-2G73E proteins have cooperative interactions with transcriptional cofactors LIM-4 and CEH-36 to activate a promoter expressed in AWB and AWC neurons. However, SOX-2 and mutant SOX-2G73E displayed differential activation properties of the promoter. To investigate the molecular basis of differential DNA binding activities of SOX-2 and SOX-2G73E, fEMSAs were performed with these proteins and their potential target sites.
First, a bioinformatics approach was taken to identify the biologically relevant DNA binding sequences within the 1 kb promoter region used in the luciferase assay. Since multiple potential SOX-2 binding sites were present throughout the promoter, we focused on predicted SOX-2 binding sites adjacent to putative CEH-36 or LIM-4 binding sites and evolutionarily conserved between various nematode species. These sequences were deleted or mutated, and subsequently tested in vivo for their activity to express GFP reporter transgenes in AWB or AWC neurons. Through this approach, we identified potential LIM-4/SOX-2 and CEH-36/SOX-2 adjacent target sites that are specifically required for the expression of GFP in AWB and AWC neurons, respectively5. We investigated the potential differences in the DNA binding of SOX-2 and SOX-2G73E using fEMSA with the identified LIM-4/SOX-2 and CEH-36/SOX-2 adjacent target sites. Our EMSA analysis showed that SOX-2G73E did not bind the DNA probe containing the LIM-4/SOX-2 adjacent target sites (required for gene expression in AWB) as efficiently as WT SOX-2 did. However, SOX-2 and SOX-2G73E had no difference in binding the DNA probe containing the CEH-36/SOX-2 adjacent target site (required for gene expression in AWC)5,10. Our fEMSA analyses provide mechanistic insight into the nature of the SOX-2G73E mutation in affecting specific DNA binding activity for the AWB-to-AWC cell identity transformation phenotype. Here, we describe an optimized protocol of fEMSA using purified 6xHis-SOX-2 or 6xHis-SOX-2G73E together with infrared fluorescent dye-labeled DNA probes containing the LIM-4/SOX-2 adjacent target sites as a case study to tackle an important biological question.

<table border="0" cellpadding="0" cellspacing="0" width="1019">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:332px;">30% Acrylamide/Bis Solution, 37.5:1&#160;</td>
			<td style="width:199px;">Bio-Rad</td>
			<td style="width:207px;">1610158</td>
			<td style="width:281px;">Acrylamide is harmful and toxic.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:332px;">6x-His Epitope Tag Antibody (HIS.H8)</td>
			<td style="width:199px;">ThermoFisher</td>
			<td style="width:207px;">MA1-21315</td>
			<td style="width:281px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:332px;">Anti Flag M2 antibody&#160;</td>
			<td style="width:199px;">Sigma-Aldrich</td>
			<td style="width:207px;">F3165-.2MG</td>
			<td style="width:281px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:332px;">Bovine Serum Albumin molecular-biology-grade</td>
			<td style="width:199px;">New England Biolabs</td>
			<td style="width:207px;">B9000S</td>
			<td style="width:281px;"></td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:332px;">5&#39;IRDye700-labeled DNA Oligos</td>
			<td style="width:199px;">Integrated DNA Technologies</td>
			<td style="width:207px;">Custom DNA oligo</td>
			<td style="width:281px;">These are referred as 5&#39;Dye-labeled or infrared fluorescent dye-labeled DNA oligos in the manuscript. The company will custom synthesize 5&#39; IRDye labeled DNA oligonucleotides.&#160; Requires minimum 100&#956;M scale synthesis and HPLC purification.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:332px;">Klenow Fragment (3&#39;--&#62;5&#39; exo-)</td>
			<td style="width:199px;">New England Biolabs</td>
			<td style="width:207px;">M0212S</td>
			<td style="width:281px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:332px;">LightShif Poly (dI-dC)</td>
			<td style="width:199px;">ThermoFisher</td>
			<td style="width:207px;">20148E</td>
			<td style="width:281px;"></td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:332px;">Mini-PROTEAN&#160;Vertical Electrophoresis Cell&#160;</td>
			<td style="width:199px;">Bio-Rad</td>
			<td style="width:207px;">1658000FC&#160;</td>
			<td style="width:281px;">This is referred as a mini protein gel system in the manuscript. Any electrophoretic system can be used as long as they are clear glass plates of less than 25cm x 25cm in size.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:332px;">Odyssey CLx Infrared Imaging System</td>
			<td style="width:199px;">LI-COR Biotechnology</td>
			<td style="width:207px;">Odyssey CLx Infrared Imagng System</td>
			<td style="width:281px;">This is referred as an advanced infrared imaging system in the mansucript.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">Odyssey Fc Imaging System&#160;</td>
			<td style="width:199px;">LI-COR Biotechnology</td>
			<td style="width:207px;">Odyssey Fc Dual-Mode Imaging System</td>
			<td style="width:281px;">This is referred as a near-infrared fluorescent imaging system primarily for Western blots in the mansucript.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:332px;">Image Studio software (version 4.0)</td>
			<td style="width:199px;">LI-COR Biotechnology</td>
			<td style="width:207px;">Image Studio software&#160;</td>
			<td style="width:281px;">This is referred as a particular imaging software in the mansucript.&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:332px;">Orange G</td>
			<td style="width:199px;">Sigma-Aldrich</td>
			<td style="width:207px;">O3756-25G</td>
			<td style="width:281px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:332px;">6x Orange loading dye</td>
			<td style="width:199px;"></td>
			<td style="width:207px;"></td>
			<td>0.25% Orange G; 30% Glycerol</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">0.5x TBE</td>
			<td style="width:199px;"></td>
			<td style="width:207px;"></td>
			<td>45 mM Tris-Borate; 1 mM EDTA</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:332px;">1x TE</td>
			<td style="width:199px;"></td>
			<td style="width:207px;"></td>
			<td>10 mM Tris-HCl; 1 mM EDTA, pH8.0</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:332px;">1x STE</td>
			<td style="width:199px;"></td>
			<td style="width:207px;"></td>
			<td style="width:281px;">100 mM NaCl; 10 mM Tris-HCl, pH8.0; 1 mM EDTA</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;">5x Binding Buffer</td>
			<td style="width:199px;"></td>
			<td style="width:207px;"></td>
			<td style="width:281px;">50 mM Tris-HCl, pH7.5; 50 mM NaCl; 200 mM KCl; 5 mM MgCl2; 5 mM EDTA, pH8.0; 5 mM DTT; 250 ug/ml BSA</td>
		</tr>
	</tbody>
</table>

an optimized protocol for electrophoretic mobility shift assay using infrared fluorescent dye-labeled oligonucleotides

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. Radioactivity has been the predominant method of DNA labeling in EMSAs. However, recent advances in fluorescent dyes and scanning methods have prompted the use of fluorescent tagging of DNA as an alternative to radioactivity for the advantages of easy handling, saving time, reducing cost, and improving safety. We have recently used fluorescent EMSA (fEMSA) to successfully address an important biological question. Our fEMSA analysis provides mechanistic insight into the effect of a missense mutation, G73E, in the highly conserved HMG transcription factor SOX-2 on olfactory neuron type diversification. We found that mutant SOX-2G73E protein alters specific DNA binding activity, thereby causing olfactory neuron identity transformation. Here, we present an optimized and cost-effective step-by-step protocol for fEMSA using infrared fluorescent dye-labeled oligonucleotides containing the LIM-4/SOX-2 adjacent target sites and purified SOX-2 proteins (WT and mutant SOX-2G73E proteins) as a biological example.

Orange G loading dye (6x: 0.12 g Orange G in 100 mL&#160;30% Glycerol) can be added to the binding reaction prior to loading to visualize the progress of the electrophoresis. Other loading dyes including bromophenol blue will be detected during scanning and therefore interfere with image analysis (Figure 1B).
In some instances of EMSAs, especially if nuclear extract preparation is used, poly deoxyinosinic-deoxyc...

Watch this Scientific Journal Video about An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides at JoVE.com

An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides

We describe here an optimized protocol of fluorescent Electrophoretic Mobility Shift Assays (fEMSA) using purified SOX-2 proteins together with infrared fluorescent dye-labeled DNA probes as a case study to tackle an important biological question.

Electrophoretic Mobility Shift Assays (EMSA) are an instrumental tool to characterize the interactions between proteins and their target DNA sequences. ...

an-optimized-protocol-for-electrophoretic-mobility-shift-assay-using

Research

JoVE Journal

Biochemistry

15.5K Views.  University of Illinois at Chicago. We describe here an optimized protocol of fluorescent Electrophoretic Mobility Shift Assays (fEMSA) using purified SOX-2 proteins together with infrared fluorescent dye-labeled DNA probes as a case study to tackle an important biological question.

Video: An Optimized Protocol for Electrophoretic Mobility Shift Assay Using Infrared Fluorescent Dye-labeled Oligonucleotides

Optimized Protocol for the Extraction of Proteins from the Human Mitral Valve

Analysis of the cellular proteome can help to elucidate the molecular mechanisms underlying diseases due to the development of technologies that permit the large-scale identification and quantification of the proteins present in complex biological systems.The knowledge gained from a proteomic approach can potentially lead to a better understanding of the pathogenic mechanisms underlying diseases, allowing for the identification of novel diagnostic and prognostic disease markers, and, hopefully, of therapeutic targets. However, the cardiac mitral valve represents a very challenging sample for proteomic analysis because of the low cellularity in proteoglycan and collagen-enriched extracellular matrix. This makes it challenging to extract proteins for a global proteomic analysis. This work describes a protocol that is compatible with subsequent protein analysis, such as quantitative proteomics and immunoblotting. This can allow for the correlation of data concerning protein expression with data on quantitative mRNA expression and non-quantitative immunohistochemical analysis. Indeed, these approaches, when performed together, will lead to a more comprehensive understanding of the molecular mechanisms underlying diseases, from mRNA to post-translational protein modification. Thus, this method can be relevant to researchers interested in the study of cardiac valve physiopathology.

The protein composition of the human mitral valve is still partially unknown, because its analysis is complicated by low cellularity and therefore by low protein biosynthesis. This work provides a protocol to efficiently extract protein for the analysis of the mitral valve proteome.

Analysis of the cellular proteome can help to elucidate the molecular mechanisms underlying diseases due to the development of technologies that permit ...

DNA Polymerase Activity Assay Using Near-infrared Fluorescent Labeled DNA Visualized by Acrylamide Gel Electrophoresis

For any enzyme, robust, quantitative methods are required for characterization of both native and engineered enzymes. For DNA polymerases, DNA synthesis can be characterized using an in vitro DNA synthesis assay followed by polyacrylamide gel electrophoresis. The goal of this assay is to quantify synthesis of both natural DNA and modified DNA (M-DNA). These approaches are particularly useful for resolving oligonucleotides with single nucleotide resolution, enabling observation of individual steps during enzymatic oligonucleotide synthesis. These methods have been applied to the evaluation of an array of biochemical and biophysical properties such as the measurement of steady-state rate constants of individual steps of DNA synthesis, the error rate of DNA synthesis, and DNA binding affinity. By using modified components including, but not limited to, modified nucleoside triphosphates (NTP), M-DNA, and/or mutant DNA polymerases, the relative utility of substrate-DNA polymerase pairs can be effectively evaluated. Here, we detail the assay itself, including the changes that must be made to accommodate nontraditional primer DNA labeling strategies such as near-infrared fluorescently labeled DNA. Additionally, we have detailed crucial technical steps for acrylamide gel pouring and running, which can often be technically challenging.

This protocol describes the characterization of DNA polymerase synthesis of modified DNA through observation of changes to near-infrared fluorescently labeled DNA using gel electrophoresis and gel imaging. Acrylamide gels are used for high resolution imaging of the separation of short nucleic acids, which migrate at different rates depending on size.

For any enzyme, robust, quantitative methods are required for characterization of both native and engineered enzymes. For DNA polymerases, DNA synthesis ...

Localization of SUMO-modified Proteins Using Fluorescent Sumo-trapping Proteins

Here we are presenting a novel method to study the sumoylation of proteins and their sub-cellular localization in mammalian cells and nematode oocytes. This method utilizes a recombinant modified SUMO-trapping protein fragment, kmUTAG, derived from the Ulp1 SUMO protease of the stress-tolerant budding yeast Kluyveromyces marxianus. We have adapted the properties of the kmUTAG for the purpose of studying sumoylation in a variety of model systems without the use of antibodies. For the study of SUMO, KmUTAG has several advantages when compared to antibody-based approaches. This stress-tolerant SUMO-trapping reagent is produced recombinantly, it recognizes native SUMO isoforms from many species, and unlike commercially available antibodies it shows reduced affinity for free, unconjugated SUMO. Representative results shown here include the localization of SUMO conjugates in mammalian tissue culture cells and nematode oocytes.

SUMO is an essential and highly conserved, small ubiquitin-like modifier protein. In this protocol we are describing the use of a stress-tolerant recombinant SUMO-trapping protein (kmUTAG) to visualize native, untagged SUMO conjugates and their localization in a variety of cell types.

Here we are presenting a novel method to study the sumoylation of proteins and their sub-cellular localization in mammalian cells and nematode oocytes. ...

Characterizing Individual Protein Aggregates by Infrared Nanospectroscopy and Atomic Force Microscopy

The phenomenon of protein misfolding and aggregation results in the formation of highly heterogeneous protein aggregates, which are associated with neurodegenerative conditions such as Alzheimer&#8217;s and Parkinson&#8217;s diseases. In particular low molecular weight aggregates, amyloid oligomers, have been shown to possess generic cytotoxic properties and are implicated as neurotoxins in many forms of dementia. We illustrate the use of methods based on atomic force microscopy (AFM) to address the challenging task of characterizing the morphological, structural and chemical properties of these aggregates, which are difficult to study using conventional structural methods or bulk biophysical methods because of their heterogeneity and transient nature. Scanning probe microscopy approaches are now capable of investigating the morphology of amyloid aggregates with sub-nanometer resolution. We show here that infrared (IR) nanospectroscopy (AFM-IR), which simultaneously exploits the high resolution of AFM and the chemical recognition power of IR spectroscopy, can go further and enable the characterization of the structural properties of individual protein aggregates, and thus offer insights into the aggregation mechanisms. Since the approach that we describe can be applied also to the investigations of the interactions of protein assemblies with small molecules and antibodies, it can deliver fundamental information to develop new therapeutic compounds to diagnose or treat neurodegenerative disorders.

We describe the application of infrared nanospectroscopy and high-resolution atomic force microscopy to visualize the process of protein self-assembly into oligomeric aggregates and amyloid fibrils, which is closely associated with the onset and development of a wide range of human neurodegenerative disorders.

The phenomenon of protein misfolding and aggregation results in the formation of highly heterogeneous protein aggregates, which are associated with ...

Acyl-PEGyl Exchange Gel Shift Assay for Quantitative Determination of Palmitoylation of Brain Membrane Proteins

Activity-dependent alterations in the levels of synaptic AMPA receptors (AMPARs) within the postsynaptic density (PSD) is thought to represent a cellular mechanism for learning and memory. Palmitoylation regulates localization and function of many synaptic proteins including AMPA-Rs, auxiliary factors and synaptic scaffolds in an activity-dependent manner. We identified the synapse differentiation induced gene (SynDIG) family of four genes (SynDIG1-4) encoding brain-specific transmembrane proteins that associate with AMPARs and regulate synapse strength. SynDIG1 is palmitoylated at two cysteine residues located at positions 191 and 192 in the juxta-transmembrane region important for activity-dependent excitatory synapse development. Here, we describe an innovative biochemical approach, the acyl-PEGyl exchange gel shift (APEGS) assay, to investigate the palmitoylation state of any protein of interest and demonstrate its utility with the SynDIG family of proteins in mouse brain lysates.

Palmitoylation entails the incorporation of a 16-carbon palmitate moiety to cysteine residues of target proteins in a reversible manner. Here, we describe a biochemical approach, the acyl-PEGyl exchange gel shift (APEGS) assay, to investigate the palmitoylation state of any protein of interest in mouse brain lysates.

Activity-dependent alterations in the levels of synaptic AMPA receptors (AMPARs) within the postsynaptic density (PSD) is thought to represent a cellular ...

An Electrochemiluminescence-Based Assay for MeCP2 Protein Variants

The ECLIA is a versatile method which is able to quantify endogenous and recombinant protein amounts in a 96-well format. To demonstrate ECLIA efficiency, this assay was used to analyze intrinsic levels of MeCP2 in mouse brain tissue and the uptake of TAT-MeCP2 in human dermal fibroblasts. The MeCP2-ECLIA produces highly accurate and reproducible measurements with low intra- and inter-assay error. In summary, we developed a quantitative method for the evaluation of MeCP2 protein variants that can be utilized in high-throughput screens.

The electrochemiluminescence immunoassay (ECLIA) is a novel approach for quantitative detection of endogenous and exogenously applied MeCP2 protein variants, which produces highly quantitative, accurate and reproducible measurements with low intra- and inter-assay error over a wide working range. Here, the protocol for the MeCP2-ECLIA in a 96-well format is described.

The ECLIA is a versatile method which is able to quantify endogenous and recombinant protein amounts in a 96-well format. To demonstrate ECLIA efficiency, ...

Assessment of Cellular Oxidation using a Subcellular Compartment-Specific Redox-Sensitive Green Fluorescent Protein

Measuring the intracellular oxidation/reduction balance provides an overview of the physiological and/or pathophysiological redox status of an organism. Thiols are especially important for illuminating the redox status of cells via their reduced dithiol and oxidized disulfide ratios. Engineered cysteine-containing fluorescent proteins open a new era for redox-sensitive biosensors. One of them, redox-sensitive green fluorescent protein (roGFP), can easily be introduced into cells with adenoviral transduction, allowing the redox status of subcellular compartments to be evaluated without disrupting cellular processes. Reduced cysteines and oxidized cystines of roGFP have excitation maxima at 488 nm and 405 nm, respectively, with emission at 525 nm. Assessing the ratios of these reduced and oxidized forms allows the convenient calculation of redox balance within the cell. In this method article, immortalized human triple-negative breast cancer cells (MDA-MB-231) were used to assess redox status within the living cell. The protocol steps include MDA-MB-231 cell line transduction with adenovirus to express cytosolic roGFP, treatment with H2O2, and assessment of cysteine and cystine ratio with both flow cytometry and fluorescence microscopy.

This protocol describes the assessment of subcellular compartment-specific redox status within the cell. A redox-sensitive fluorescent probe allows convenient ratiometric analysis in intact cells.

Measuring the intracellular oxidation/reduction balance provides an overview of the physiological and/or pathophysiological redox status of an organism. ...

Fluorescent Leakage Assay to Investigate Membrane Destabilization by Cell-Penetrating Peptide

Cell-penetrating peptides (CPPs) are defined as carriers that are able to cross the plasma membrane and to transfer a cargo into cells. One of the main common features required for this activity resulted from the interactions of CPPs with the plasma membrane (lipids) and more particularly with components of the extracellular matrix of the membrane itself (heparan sulphate). Indeed, independent of the direct translocation or the endocytosis-dependent internalization, lipid bilayers are involved in the internalization process both at the level of the plasma membrane and at the level of intracellular traffic (endosomal vesicles). In this article, we present a detailed protocol describing the different steps of a large unilamellar vesicles (LUVs) formulation, purification, characterization, and application in fluorescence leakage assay in order to detect possible CPP-membrane destabilization/interaction and to address their role in the internalization mechanism. LUVs with a lipid composition reflecting the plasma membrane content are generated in order to encapsulate both a fluorescent dye and a quencher. The addition of peptides in the extravesicular medium and the induction of peptide-membrane interactions on the LUVs might thus induce in a dose-dependent manner a significant increase in fluorescence revealing a leakage. Examples are provided here with the recently developed tryptophan (W)- and arginine (R)-rich Amphipathic Peptides (WRAPs), which showed a rapid and efficient siRNA delivery in various cell lines. Finally, the nature of these interactions and the affinity for lipids are discussed to understand and to improve the membrane translocation and/or the endosomal escape.

The fluorescence leakage assay is a simple method that enables the investigation of peptide/membrane interactions in order to understand their involvement in several biological processes and especially the ability of cell-penetrating peptides to disturb phospholipids bilayers during a direct cellular translocation process.

Cell-penetrating peptides (CPPs) are defined as carriers that are able to cross the plasma membrane and to transfer a cargo into cells. One of the main ...

Optimized Incorporation of Alkynyl Fatty Acid Analogs for the Detection of Fatty Acylated Proteins using Click Chemistry

Fatty acylation, the covalent addition of saturated fatty acids to protein substrates, is important in regulating a myriad of cellular functions in addition to its implications in cancer and neurodegenerative diseases. Recent developments in fatty acylation detection methods have enabled efficient and non-hazardous detection of fatty acylated proteins, particularly through the use of click chemistry with bio-orthogonal labeling. However, click chemistry detection can be limited by the poor solubility and potential toxic effects of adding long chain fatty acids to cell culture. Described here is a labeling approach with optimized delivery using saponified fatty acids in combination with fatty-acid free BSA, as well as delipidated media, which can improve detection of hard to detect fatty acylated proteins. This effect was most pronounced with the alkynyl-stearate analog, 17-ODYA, which has been the most commonly used fatty acid analog in click chemistry detection of acylated proteins. This modification will improve cellular incorporation and increase sensitivity to acylated protein detection. In addition, this approach can be applied in a variety of cell types and combined with other assays such as pulse-chase analysis, stable isotope labeling with amino acids in cell culture, and mass spectrometry for quantitative profiling of fatty acylated proteins.

The study of fatty acylation has important implications in cellular protein interactions and diseases. Presented here is a modified protocol to improve click chemistry detection of fatty acylated proteins, which can be applied in various cell types and combined with other assays, including pulse-chase and mass spectrometry.

Fatty acylation, the covalent addition of saturated fatty acids to protein substrates, is important in regulating a myriad of cellular functions in ...

Pure Shift Nuclear Magnetic Resonance: a New Tool for Plant Metabolomics

Nuclear Magnetic Resonance (NMR) is one of the most powerful tools used in metabolomics. It stands as a highly accurate and reproducible method that not only provides quantitative data but also permits structural identification of the metabolites present in complex mixtures.
Metabolic profiling by 1H NMR has proven useful in the study of various types of plant scenarios, which include the evaluation of crop&#160;conditions, harvest and post- harvest treatments, metabolic phenotyping, metabolic pathways, gene regulation, identification of biomarkers, chemotaxonomy, quality control, denomination of origin, among others. However, signal overlapping of the large number of resonances with expanded J-coupling multiplicities complicates the spectra analysis and its interpretation, and represents a limitation for classical 1H NMR profiling.
In the last decade, novel NMR broadband homonuclear decoupling techniques through which multiplet signals collapse into single resonance lines - commonly called Pure Shift methods - have been developed to overcome the spectra resolution problem inherent to 1H NMR classical spectra.
Here a step-by-step protocol of the plant extract preparation and the procedure to record optimal Pure Shift PSYCHE and SAPPHIRE-PSYCHE spectra in three different plant matrices - Vanilla plant&#160;leaves, potato tubers (S. tuberosum), and Cape gooseberries (P. peruviana) - is presented. The effect of the gain in resolution in metabolic identification, correlation analysis and multivariate analyses, as compared against classical spectra, is discussed.

This paper presents the use of PSYCHE and SAPPHIRE-PSYCHE in the metabolic profiling of plants and includes detailed procedures for sample preparation and optimal Pure Shift NMR spectra recording. Examples through which the gain in resolution achieved by homonuclear decoupling allows a more comprehensive understanding of the system are discussed.

Nuclear Magnetic Resonance (NMR) is one of the most powerful tools used in metabolomics. It stands as a highly accurate and reproducible method that not ...