Name: chondrogenic pellet formation from cord blood-derived induced pluripotent stem cells
Uploaded: 2017-06-19T15:00:00.000+00:00
Duration: 12 min 10 s
Description: Watch this Scientific Journal Video about Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells at JoVE.com

This work was supported by a grant from the Korea Healthcare Technology R&#38;D project, Ministry for Health, Welfare &#38; Family Affairs, Republic of Korea (HI16C2177).

This protocol was approved by the institutional review board of the Catholic University of Korea (KC12TISI0861). CBMCs used for reprogramming were directly obtained from the Cord Blood Bank of the Seoul St. Mary&#39;s Hospital.
1. Chondrogenic Differentiation from iPSCs
<ol>
	<li>CBMC-iPSC generation
	<ol>
		<li>Generate CBMC-hiPSCs using the protocol shown in our previous work23.</li>
		<li>Collect the blood cells in a 15 mL conical tube and count them using a hemocytometer.</li>
		<li>Prepare 3 x 105 cells and centrifuge them for 5 min at 515 x g and RT. Discard the supernatant by suction and resuspend the cells in 0.5 mL of blood cell medium.</li>
		<li>Transfer the cells to a well of a non-coated 24-well plate and add the Sendai virus mixture, following the manufacturer&#39;s recommendations.</li>
		<li>Centrifuge the plate for 30 min at 1,150 x g and 30 &#176;C.</li>
		<li>After centrifugation, incubate the cells overnight (O/N) at 37 &#176;C in 5% CO2.</li>
		<li>The next day, transfer the transduced cells to a matrix-coated well. Centrifuge the plate at 1,150 x g for 30 min at 30 &#176;C.</li>
		<li>After centrifugation, remove the supernatant, add 1 mL of iPSC medium, and maintain the cells O/N at 37 &#176;C in 5% CO2.</li>
		<li>Maintain the attached cells at 37 &#176;C and 5% CO2. Change the medium daily, replacing it with fresh iPSC medium. 
		NOTE: Colonies will appear on day 14-21 after transduction.</li>
	</ol>
	</li>
	<li>EB generation
	<ol>
		<li>Maintain the hiPSCs at 37 &#176;C and 5% CO2. Change the medium daily, replacing it with fresh Essential 8 (E8) medium.</li>
		<li>Prepare 2 x 106 hiPSCs in a vitronectin-coated, 100-mm dish in E8 medium.</li>
		<li>Remove the E8 medium from the culture dish and wash with sterile phosphate-buffered saline (PBS).</li>
		<li>Add 1 mL of 1 mM ethylenediaminetetraacetic acid (EDTA) and incubate at 37 &#176;C and 5% CO2 for 2 min.</li>
		<li>Harvest the cells with 3 mL of E8 medium and transfer them to a new 15-mL conical tube. Centrifuge the cells at 250 x g at room temperature (RT) for 2 min.</li>
		<li>Aspirate the supernatant without disturbing the cell pellet and resuspend the cells in 5 mL of E8 medium.</li>
		<li>Count the cells using a hemocytometer and prepare 2 x 106 cells for each 100 mm Petri dish. Resuspend the prepared cells in a 10-mL mixture of E8 and EB medium (1:1) with 10 &#181;M rho-associated kinase (ROCK) inhibitor.</li>
		<li>Incubate the cells O/N for aggregation at 37 &#176;C and 5% CO2.</li>
		<li>On the following day, harvest the aggregated EBs by pipetting. Centrifuge the cells at 250 x g for 1 min. Remove the supernatant and resuspend the EBs in 10 mL of fresh E8 medium.</li>
		<li>Enlarge the generated EBs for 5 days, performing daily changes with fresh E8 medium. For further maturation, change the culture medium to E7 medium. Maintain the EBs at 37 &#176;C and 5% CO2 for another 5 days, performing daily medium changes with fresh E7 medium. 
		NOTE: E7 medium is E8 medium without FGF2.</li>
	</ol>
	</li>
	<li>Outgrowth cell induction from EBs
	<ol>
		<li>Add 6 mL of 1% gelatin to a 100-mm dish and incubate at 37 &#176;C and 5% CO2 for 30 min.</li>
		<li>Remove the gelatin and dry the dish completely for 2-3 h before use.</li>
		<li>Transfer the EBs to a 50-mL conical tube. Allow the EBs to settle to the bottom of the conical tube. Remove the supernatant without disturbing the EBs.</li>
		<li>Resuspend the EBs in 10 mL of Dulbecco&#39;s Modified Eagle&#39;s Medium (DMEM) with 20% fetal bovine serum (FBS). Transfer the EBs to the gelatin-coated, 100-mm dish. Add 10 &#181;M ROCK inhibitor.</li>
		<li>Incubate and maintain the cells at 37 &#176;C and 5% CO2 for 7 days. Change the medium every other day without adding ROCK inhibitor.</li>
	</ol>
	</li>
	<li>Chondrogenic pellet formation
	<ol>
		<li>Aspirate the culture medium from the dish and wash the cells three times with PBS.</li>
		<li>Apply 1 mL of 1 mM EDTA and incubate at 37 &#176;C and 5% CO2 for 2 min.</li>
		<li>Harvest the cells using 5 mL of DMEM with 20% FBS and transfer them to a new 15-mL conical tube.</li>
		<li>Centrifuge the cells for 2 min at 250 x g and RT. Discard the supernatant and resuspend the pellet in 10 mL of DMEM with 20% FBS.</li>
		<li>Filter and discard the cell clumps using a 40 &#181;m cell strainer and harvest the single cells. Count the single cells using a hemocytometer.</li>
		<li>Centrifuge the cells for 2 min at 250 x g and RT. Remove the supernatant and seed 3 x 105 cells per pellet in a 15 mL conical tube with 300 &#181;L of chondrogenic differentiation medium (CDM).</li>
		<li>For pellet formation, centrifuge the cells for 5 min at 680 x g and RT. 
		NOTE: Pellets are maintained in 15 mL conical tubes during the differentiation of the chondrogenic pellets.</li>
		<li>Incubate the cells overnight at 37 &#176;C and 5% CO2.</li>
		<li>Change the CDM every 2-3 days. Within 3 days, pellets will exhibit flattened, spheroidal morphologies. Maintain the pellets for 21 days at 37&#176;C and 5% CO2.</li>
	</ol>
	</li>
</ol>
2. Chondrogenic Pellet Characterization by Staining
<ol>
	<li>Chondrogenic embedding
	<ol>
		<li>Before embedding, prepare and melt paraffin at 58 &#176;C.</li>
		<li>Fix the pellets in 1 mL of 4% paraformaldehyde for 2 h at RT in a 1.5 mL tube. 
		Caution: Paraformaldehyde is highly toxic. Avoid contact with eyes, skin, or mucous membranes. Minimize exposure and avoid inhalation while preparing it.</li>
		<li>Place one layer of gauze onto the cassette and transfer the fixed pellets using a pipette. Cover the pellet by folding the gauze and close the cassette lid.</li>
		<li>Initiate dehydration in 100 mL of 70% ethanol (EtOH) twice, 10 min each. Dehydrate the pellets through sequential 10-min washes in 80% and 95% EtOH.</li>
		<li>Transfer the pellets to 100% EtOH for 10 min. Repeat three times with fresh EtOH.</li>
		<li>For &#34;clearing,&#34; exchange the solution for a 100 mL, 1:1 mixture of EtOH and xylene, followed by a 1:2 mixture of EtOH and xylene for 10 min each. Clear the remaining EtOH by incubating the pellets twice in 100% xylene, 10 min each.</li>
		<li>For paraffin infiltration, incubate the pellets in sequential xylene and paraffin mixtures. Perform the whole paraffin infiltration process at 58 &#176;C. Incubate the pellets in 100 mL of a 2:1 mixture of xylene and paraffin for 30 min.</li>
		<li>Exchange the solution for 100 mL of a 1:1 mixture of xylene and paraffin and incubate for 30 min.</li>
		<li>Exchange the solution for 100 mL of a 1:2 mixture of xylene and paraffin and incubate for 30 min.</li>
		<li>For the final infiltration, transfer the pellets to the first bath of 100% paraffin and incubate for 2 h.</li>
		<li>Transfer the pellets to the second bath of 100% paraffin and incubate O/N at 58 &#176;C.</li>
		<li>The next day, gently transfer the pellets to a mold using a tweezer. Add paraffin to the mold from the paraffin dispenser. Solidify the paraffin for 30 min at 4 &#176;C.</li>
		<li>Slice the sections at 7 &#181;m and transfer the sections onto the slide. Allow the slides to dry overnight and store the slides at RT until they are ready for use.</li>
	</ol>
	</li>
	<li>Slide preparation
	<ol>
		<li>Deparaffinize the slides by moving them through 100 mL of 100%, 90%, 80%, and 70% EtOH sequentially for 5 min each.</li>
		<li>Place the slides in a glass jar and rinse with tap water for 5 min.</li>
	</ol>
	</li>
	<li>Alcian blue staining
	<ol>
		<li>Incubate the slides in 50 mL of 1% alcian blue solution for 30 min. 
		NOTE: Alcian blue is diluted in 3% acetic acid solution. Adjust the pH to 2.5 using acetic acid.</li>
		<li>Place the slides in a glass jar and rinse with tap water for 2 min.</li>
		<li>Rinse the slides in deionized water (DW) and counterstain with nuclear fast red solution for 2 min.</li>
		<li>Place the slides in a glass jar and rinse with tap water for 1 min.</li>
		<li>2.3.5)Proceed to dehydrate and mount the slides in step 2.6.</li>
	</ol>
	</li>
	<li>Toluidine blue staining
	<ol>
		<li>Incubate slides in 50 mL of toluidine blue solution for 4 min.</li>
		<li>Place the slides in a glass jar and rinse with tap water for 5 min.</li>
		<li>Proceed to dehydrate and mount the slides in step 2.6.</li>
	</ol>
	</li>
	<li>Immunohistochemical staining
	<ol>
		<li>Incubate the slides in 3% H2O2for 15 min for endogenous peroxidase blocking.</li>
		<li>Apply 200 &#181;L of primary antibody (anti-COL1A1 and -COL2A1) diluted 1:100 in tris-buffered saline (TBS) containing 1% bovine serum albumin (BSA) and 5% normal goat serum (NGS) to the slides and incubate O/N at 4 &#176;C.</li>
		<li>The next day, place the slides in a glass jar and wash them with 50 mL of TBS containing 0.1% polysorbate 20 (TBST) three times for 5 min each.</li>
		<li>Apply 200 &#181;L of secondary antibody (goat anti-rabbit IgG antibody, diluted 1:200 in TBS containing 1% BSA and 5% NGS) to the slides and incubate at RT for 40 min.</li>
		<li>Place the slides in a glass jar and wash them three times with 50 mL, 5 min each.</li>
		<li>For signal amplification, apply HRP-conjugate streptavidin solution to the slides and incubate for 10 min.</li>
		<li>Place the slides in a glass jar and wash them three times with 50 mL, 5 min each.</li>
		<li>Mix the DAB-peroxidase substrate solution, apply 200 &#181;L of solution to each slide, and incubate for 1 min.</li>
		<li>Place the slides in a glass jar and rinse with tap water for 5 min.</li>
		<li>Counterstain with Mayer&#39;s hematoxylin for 1 min.</li>
		<li>Wash the slides with DW.</li>
		<li>Proceed to dehydrate and mount the slides in step 2.6.</li>
	</ol>
	</li>
	<li>Dehydration and mounting
	<ol>
		<li>Dehydrate the slides by moving them sequentially through 100 mL of 70%, 80%, 90%, and 100% EtOH, 30 s each.</li>
		<li>Dip the slides into two changes of xylene for 1 min each.</li>
		<li>Add 50 &#181;L of mounting solution to the coverslips and place the slides on top.</li>
	</ol>
	</li>
</ol>

The authors have nothing to disclose.

This protocol successfully generated hiPSCs from CBMCs. We reprogrammed CBMCs to hiPSCs using a Sendai viral vector containing Yamanaka factors24. Three cases were used in differentiation, and all experiments successfully generated chondrogenic pellets using this protocol. Numerous studies have reported protocols for the differentiation of hiPSCs into chondrocytes25,26,27,28. However, additional research is required to confirm the use of CBMC-hiPSCs a candidate for cartilage regeneration and recovery.
Chondrogenesis was confirmed using hiPSCs generated from various somatic cell types11,25,26,27,29. Many reports demonstrate that the origin of the somatic cell used in reprogramming can affect the differentiation outcome of the hiPSCs30,31,32,33. Cord blood is a source enriched with HSCs and MSCs. There is no report on the difference between cord blood-derived cells, such as blood cells or MSCs. However, previous studies have shown that articular chondrocyte-derived hiPSCs are more likely to go through chondrogenesis than hiPSCs generated from cord blood or skin fibroblasts29. Results from endothelial differentiation using hiPSCs generated from fibroblasts, cardiac progenitor cells, and endothelial cells demonstrated that the tissue-of-origin can reflect the tissue-specific somatic memory in terminally differentiated iPSC derivation, especially at early passages, between 10 and 2034. In early passages of hiPSCs, endothelial cell-derived hiPSCs differentiated more efficiently into the endothelial lineage. However, the significant difference between these cell lines disappeared in hiPSCs over 20 passages. Therefore, it is important to carefully consider the somatic memory carried by the hiPSCs in early passages when they are used in clinical research.
Recently, various procedures have been developed to repair defected articular cartilage. Microfracture is done by drilling multiple holes in the bone to induce the influx of bone marrow for natural repair35. Knee replacement, also known as knee arthroplasty, is used to replace the damaged cartilage. However, microfracture is not useful for severe articular cartilage damage, and the instrument used for knee replacements must be changed every 10-15 years.
These days, cell-based therapies are a promising alternative method for cartilage repair. Autologous chondrocyte implantation (ACI) is widely used for cell-based cartilage recovery. ACI is done by directly injecting autologous chondrocytes into the defect. However, autologous chondrocytes turn into fibroblast-like cells under in vitro cultivation conditions. Additional damage is also inevitable during the harvesting process of autologous chondrocytes. MSCs have been suggested as a cell source for cartilage recovery. Cord blood is a useful and accessible cell source of MSCs for engineering cartilage36. The success rate for isolating cord-blood MSCs, however, is controversial37,38. Numerous studies report the successful isolation of cord-blood MSCs. Several studies have shown that cord blood volume is a critical parameter that can affect the yield rate of MSC isolation36,39. To acquire high-quality MSCs, the passage of the cells is also critical. Previous studies indicate that MSCs have a restricted life span after a certain cell division number. By entering senescence, MSCs are characterized by decreased proliferation, as with any normal somatic cell40. Therefore, cord blood-derived MSCs must be used before the sixth passage to avoid cell senescence and chromosomal abnormalities41.
To avoid these limitations, human iPSCs opened a new possibility for personalized, cell-based therapy with high productivity11. Established hiPSCs can theoretically proliferate limitlessly. Also, with the same immune identity as the donor, they can avoid rejection and lower side effects when implanted in vivo. The transition of cord blood banks into hiPSC banks for allogeneic medical treatment has tremendous possibility and potential42. The screening of homozygous HLA-typed CBMCs before reprogramming can widely utilize the allogeneic iPSC lines for clinical treatment. Homozygous iPSC lines can avoid immunological reactions after allograft transplantation. This concept can also be applied to cartilage regeneration by generating HLA-homozygous cartilage11.
Usually, chondrogenic differentiation is performed through two critical steps: the induction of EB-derived outgrowth cells and pellet formation. The initial differentiation of hiPSCs into EB-derived outgrowth cells is critical to increase their chondrogenic differentiation potential. Outgrowth cells differentiated from hiPSCs are functionally and molecularly similar to native BMSCs7,43. Previous studies used monolayer culture or EB culture as a pre-differentiation step to induce mesenchymal-like cells10,43. However, direct differentiation by monolayer culture is time-consuming compared to the use of EBs, and chondrogenic pellets tend to differentiate into fibrocartilage with hypertrophic characteristics. It was reported that cell morphology and the chondrogenic differentiation potential of generated mesenchymal-like progenitor cells differ greatly according to the cell density of the cell monolayer9.
We used EBs to induce outgrowth cells, which is a relatively fast and simple method compared to the monolayer culture. Using this protocol, we were able to generate many pellets using a relatively small number of hiPSCs (Table 1). The size and number of EBs were critical for successful chondrogenic pellet mass production. For that reason, we enlarged the aggregated EBs in E8 medium, until more than half of the generated EBs were larger than 100 &#181;m. After EB enlargement, we maintained the EBs in E8 medium without FGF2. Previously, researchers maintained generated EBs without FGF2 for mesodermal lineage induction9.
Even though we attempted to maintain the generated outgrowth cells at a high density for better quality, several limitations still remain. While we have confirmed that the generated outgrowth cells share a similar morphology, the cells may be still heterogenous. Previous studies have attempted to sort for a specific cell type; however, this procedure has resulted in the collection of a low number of cells. A new attempt to isolate homogenous outgrowth cells on a larger scale will be required to generate a large quantity of chondrogenic pellets with enhanced characteristics.
Various groups are inducing progenitor cells from hiPSCs by using monolayer or EB culture. The induction of progenitor cells with a high similarity to MSCs can be the key to obtaining chondrogenic pellets of higher quality. These progenitor cells derived from EBs have characteristics similar to those of MSCs. However, this might be because of their fibroblastic nature. Therefore, a detailed validation study on the outgrowth cells is required.
In this study, we suggest a protocol that can generate a relatively large quantity of chondrogenic pellets. We confirmed that the cartilage regenerated using CBMC-hiPSCs showed a healthy phenotype and can be used as material for tissue regeneration. However, an improved method with a shorter differentiation timeline is required for further application. The further development of quality-control standards to validate cartilage with a higher level of hyaline is also required for future applications of CBMC-hiPSCs as cell material for cartilage regeneration. The protocol is simple yet effective and does not require any additional sorting processes before pellet formation. In conclusion, using this protocol, high-quality chondrogenic pellets can be generated for studies on disease modeling, drug screening, and regenerative medicine to further our understanding of the nature of cartilage.

The use of hiPSCs represents a new strategy for drug screening and mechanistic studies of various diseases. From a regenerative perspective, hiPSCs are also a potential source for the replacement of damaged tissues that have limited healing ability, such as articular cartilage1,2.
The regeneration of native articular cartilage has been a challenge for several decades. Articular cartilage is a soft, white tissue that coats the end of bones, protecting them from friction. However, it has limited regenerative ability when damaged, which makes self-repair almost impossible. Therefore, research focused on cartilage regeneration has been ongoing for several decades.
Previously, in vitro differentiation into the chondrogenic lineage was usually performed with BMSCs or native chondrocytes isolated from the knee joint3. Due to their chondrogenic potential, BMSCs and native chondrocytes have numerous merits supporting their use in chondrogenesis. However, because of their limited expansion and unstable phenotype, these cells face several limitations in the reconstruction of articular cartilage defects. Under in vitro culture conditions, these cells tend to lose their own characteristics after 3-4 passages, which eventually affects their differentiation abilities4. Also, in the case of native chondrocytes, additional damage to the knee joint is inevitable when obtaining these cells.
Unlike BMSCs or native chondrocytes, hiPSCs can indefinitely expand in vitro. With the proper culture conditions, hiPSCs have great potential as a replacement source for chondrogenic differentiation. However, it is challenging to change the intrinsic characteristics of hiPSCs5. Moreover, it takes several complicated in vitro steps to direct the fate of hiPSCs to a specific cell type. Despite these complications, the use of hiPSCs is still recommended due to their high self-renewal abilities and their capacity to differentiate into targeted cells, including chondrocytes6.
Chondrogenic differentiation is usually done with three-dimensional culture systems, such as the pellet culture or micromass culture, using MSC-like progenitor cells. If using hiPSCs, the protocol to generate MSC-like progenitor cells differs from the existing protocols. Some groups use monolayer culture of hiPSCs to directly convert the phenotype into MSC-like cells7. However, most studies use EBs to generate outgrowth cells that resemble MSCs8,9,10,11.
Various types of growth factors are used to induce chondrogenesis. Usually, BMP and TGF&#946; family proteins are used, alone or in combination. Differentiation has also been induced with other factors, such as GDF5, FGF2, and IGF112,13,14,15. TGF&#946;1 has been shown to stimulate chondrogenesis in a dose-dependent manner in MSCs16. Compared to the other isotype, TGF&#946;3, TGF&#946;1 induces chondrogenesis by increasing the pre-cartilage mesenchymal cell condensation.TGF&#946;3 induces chondrogenesis by significantly increasing the mesenchymal cell proliferation17. However, TGF&#946;3 is used more frequently by researchers than TGF&#946;17,10,18,19. BMP2 enhances the expression of genes related to the chondrogenic matrix components in human articular chondrocytes under in vitro conditions20. BMP2 increases the expression of genes critical to cartilage formation in MSCs in combination with TGF&#946; proteins21. It has also been shown that BMP2 synergistically enhances the effect of TGF&#946;3 through the Smad and MAPK pathways22.
In this study, CBMC-hiPSCs were aggregated into EBs using EB medium in a low-attachment Petri dish. Outgrowth cells were induced by attaching the EBs to a gelatin-coated dish. Chondrogenic differentiation using outgrowth cells was performed by pellet culture. Treatment with both BMP2 and TGF&#946;3 successfully condensed the cells and induced extracellular matrix (ECM) protein accumulation for chondrogenic pellet formation. This study suggests a simple yet efficient chondrogenic differentiation protocol using CBMC-hiPSCs.

<table><tbody><tr><td>&lt;strong&gt;Plasticware&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>100 mm Dish</td><td>TPP</td><td>93100</td><td></td></tr><tr><td>6-well Plate</td><td>TPP</td><td>92006</td><td></td></tr><tr><td>50 mL Cornical Tube</td><td>SPL</td><td>50050</td><td></td></tr><tr><td>15 mL Cornical Tube</td><td>SPL</td><td>50015</td><td></td></tr><tr><td>10 mL Disposable Pipette</td><td>Falcon</td><td>7551</td><td></td></tr><tr><td>5 mL Disposable Pipette</td><td>Falcon</td><td>7543</td><td></td></tr><tr><td>12-well Plate</td><td>TPP</td><td>92012</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Description&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;E8 Medium Materials&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DMEM/F12, HEPES</td><td>Life Technologies</td><td>11330-057</td><td>E8 Medium (500 mL)</td></tr><tr><td>Sodium Bicarbonate</td><td>Life Technologies</td><td>25080-094</td><td>E8 Medium (Conc.: 543 &amp;mu;g/mL)</td></tr><tr><td>Sodium Selenite</td><td>Sigma Aldrich</td><td>S5261</td><td>E8 Medium&amp;nbsp; (Conc.: 14 ng/mL)</td></tr><tr><td>Human Transfferin</td><td>Sigma Aldrich</td><td>T3705</td><td>E8 Medium (Conc.: 10.7 &amp;mu;g/mL)</td></tr><tr><td>Basic FGF2</td><td>Peprotech</td><td>100-18B</td><td>E8 Medium&amp;nbsp; (Conc.: 100 ng/mL)</td></tr><tr><td>Human Insulin</td><td>Life Technologies</td><td>12585-014</td><td>E8 Medium (Conc.: 20 &amp;mu;g/mL)</td></tr><tr><td>Human TGF&amp;beta;1</td><td>Peprotech</td><td>100-21</td><td>E8 Medium (Conc.: 2 ng/mL)</td></tr><tr><td>Ascorbic Acid</td><td>Sigma Aldrich</td><td>A8960</td><td>E8 Medium&amp;nbsp; (Conc.: 64 &amp;mu;g/mL)</td></tr><tr><td>DPBS</td><td>Life Technologies</td><td>14190-144</td><td></td></tr><tr><td>Vitronectin</td><td>Life Technologies</td><td>A14700</td><td></td></tr><tr><td>ROCK Inhibitor</td><td>Sigma Aldrich</td><td>Y0503</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Description&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Quality Control Materials&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>18 mm Cover Glass</td><td>Superior</td><td>HSU-0111580</td><td></td></tr><tr><td>4% Paraformaldyhyde</td><td>Tech &amp;amp; Innovation</td><td>BPP-9004</td><td></td></tr><tr><td>Triton X-100</td><td>BIOSESANG</td><td>9002-93-1</td><td></td></tr><tr><td>Bovine Serum Albumin</td><td>Vector Lab</td><td>SP-5050</td><td></td></tr><tr><td>Anti-SSEA4 Antibody</td><td>Millipore</td><td>MAB4304</td><td></td></tr><tr><td>Anti-Oct4 Antibody</td><td>Santa Cruz</td><td>SC9081</td><td></td></tr><tr><td>Anti-TRA-1-60 Antibody</td><td>Millipore</td><td>MAB4360</td><td></td></tr><tr><td>Anti-Sox2 Antibody</td><td>Biolegend</td><td>630801</td><td></td></tr><tr><td>Anti-TRA-1-81 Antibody</td><td>Millipore</td><td>MAB4381</td><td></td></tr><tr><td>Anti-Klf4 Antibody</td><td>Abcam</td><td>ab151733</td><td></td></tr><tr><td>Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody</td><td>Molecular Probe</td><td>A11029</td><td></td></tr><tr><td>Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody</td><td>Molecular Probe</td><td>A11037</td><td></td></tr><tr><td>DAPI</td><td>Molecular Probe</td><td>D1306</td><td></td></tr><tr><td>Prolong gold antifade reagent</td><td>Invitrogen</td><td>P36934</td><td></td></tr><tr><td>4% Paraformaldyhyde</td><td>Tech &amp;amp; Innovation</td><td>BPP-9004</td><td></td></tr><tr><td>Tween 20</td><td>BIOSESANG</td><td>T1027</td><td></td></tr><tr><td>Bovine Serum Albumin</td><td>Vector Lab</td><td>SP-5050</td><td></td></tr><tr><td>Anti-Collagen II antibody</td><td>abcam&amp;nbsp;</td><td>ab34712</td><td>1:100</td></tr><tr><td>Alcian blue</td><td>Sigma Aldrich</td><td>A3157-10G</td><td></td></tr><tr><td>Fast Green FCF</td><td>Sigma Aldrich</td><td>F7252-25G</td><td></td></tr><tr><td>Safranin O</td><td>Sigma Aldrich</td><td>090m0039v</td><td></td></tr><tr><td>Nuclear fast red</td><td>Americanmastertech</td><td>STNFR100&amp;nbsp;</td><td></td></tr><tr><td>xylene</td><td>Duksan</td><td>115&amp;nbsp;</td><td></td></tr><tr><td>Ethanol</td><td>Duksan</td><td>64-17-5</td><td></td></tr><tr><td>Mayer&#039;s hematoxylin solution</td><td>wako pure chemical industries</td><td>LAK7534</td><td></td></tr><tr><td>DAP</td><td>VECTOR LABORATORIES</td><td>SK-4100</td><td></td></tr><tr><td>Slide Glass, Coated</td><td>Hyun Il Lab-Mate</td><td>HMA-S9914</td><td></td></tr><tr><td>Trizol</td><td>Invitrogen</td><td>15596-018</td><td></td></tr><tr><td>Chloroform</td><td>Sigma Aldrich</td><td>366919</td><td></td></tr><tr><td>Isoprypylalcohol</td><td>Millipore</td><td>109634</td><td></td></tr><tr><td>Ethanol</td><td>Duksan</td><td>64-17-5</td><td></td></tr><tr><td>RevertAid First Strand cDNA Synthesis kit</td><td>Thermo Scientfic</td><td>K1622</td><td></td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Description&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Chondrogenic Differentiation Materials&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DMEM</td><td>Life Technologies</td><td>11885</td><td>Chondrogenic media component (500 mL)</td></tr><tr><td>Penicilin Streptomycin</td><td>Life Technologies</td><td>P4333</td><td>Chondrogenic media component (Conc.: 1%)</td></tr><tr><td>Ascorbic Acid</td><td>Sigma Aldrich</td><td>A8960</td><td>Chondrogenic media component (Conc.: 64 &amp;mu;g/mL)&amp;nbsp;</td></tr><tr><td>MEM Non-Essential Amino Acids Solution (100x)</td><td>Life Technologies</td><td>11140-050</td><td>Chondrogenic media component (Conc.: 100 mM)</td></tr><tr><td>rhBMP-2</td><td>R&amp;amp;D</td><td>355-BM-050</td><td>Chondrogenic media component (Conc.:100 ng/ml)</td></tr><tr><td>Recombinant Hman TGF-beta3</td><td>R&amp;amp;D</td><td>243-B3-002</td><td>Chondrogenic media component (Conc.:10 ng/ml)</td></tr><tr><td>KnockOut Serum Replacement</td><td>Life Technologies</td><td>10828-028</td><td>Chondrogenic media component (Conc.: 1%)</td></tr><tr><td>ITS+ Premix</td><td>BD</td><td>354352</td><td>Chondrogenic media component (Conc.: 1%)</td></tr><tr><td>Dexamethasone-Water Soluble&amp;nbsp;</td><td>Sigma Aldrich</td><td>D2915-100MG</td><td>Chondrogenic media component (Conc.:10&lt;sup&gt;-7&lt;/sup&gt; M)</td></tr><tr><td>GlutaMAX Supplement</td><td>Life Technologies</td><td>35050-061</td><td>Chondrogenic media component (Conc.: 1%)</td></tr><tr><td>Sodium pyruvate solution</td><td>Sigma Aldrich</td><td>S8636</td><td>Chondrogenic media component (Conc.: 1%)</td></tr><tr><td>L-Proline</td><td>Sigma Aldrich</td><td>P5607-25G</td><td>Chondrogenic media component (40 &amp;mu;g/ml)</td></tr></tbody></table>

chondrogenic pellet formation from cord blood-derived induced pluripotent stem cells

Human articular cartilage lacks the ability to repair itself. Cartilage degeneration is thus treated not by curative but by conservative treatments. Currently, efforts are being made to regenerate damaged cartilage with ex vivo expanded chondrocytes or bone marrow-derived mesenchymal stem cells (BMSCs). However, the restricted viability and instability of these cells limit their application in cartilage reconstruction. Human induced pluripotent stem cells (hiPSCs) have received scientific attention as a new alternative for regenerative applications. With unlimited self-renewal ability and multipotency, hiPSCs have been highlighted as a new replacement cell source for cartilage repair. However, obtaining a high quantity of high-quality chondrogenic pellets is a major challenge to their clinical application. In this study, we used embryoid body (EB)-derived outgrowth cells for chondrogenic differentiation. Successful chondrogenesis was confirmed by PCR and staining with alcian blue, toluidine blue, and antibodies against collagen types I and II (COL1A1 and COL2A1, respectively). We provide a detailed method for the differentiation of cord blood mononuclear cell-derived iPSCs (CBMC-hiPSCs) into chondrogenic pellets.

In this study, we generated chondrogenic pellets from CBMC-hiPSCs by inducing outgrowth cells from EBs. Chondrogenic differentiation was induced using CBMC-hiPSCs with confirmed high pluripotency11. A simple scheme of our protocol is shown in Figure 1A. Before differentiation, iPSC colonies were expanded (Figure 1B). The expanded iPSCs were assembled as EBs to initiate differentiation (Figure 1C). The generated EBs were attached to gelatin-coated dishes to induce outgrowth cells (Figure 1D). Then, the outgrowth cells were harvested and used to generate chondrogenic pellets. After 21 days of differentiation, small, bead-like chondrogenic pellets were obtained and used for further characterization (Figure 1E). The quality of the in vitro-generated chondrogenic pellets was confirmed through various assays.
We histologically evaluated the quality of the chondrogenic pellets on day 21. BMSC chondrogenic pellets were used as the positive control. The accumulation of ECM proteins secreted by the differentiated chondrocytes was confirmed by alcian blue and toluidine blue staining in Figure 2A. The major characteristics of healthy cartilage, such as lacuna and proteoglycan production, increased as the differentiation process continued over 21 days. Chondrogenic pellets generated from CBMC-hiPSCs expressed COL2A1, which is the major ECM component in healthy cartilage (Figure 2B). The COL2A1 expression of CBMC-hiPSC-derived pellets was higher than that of BMSC-derived pellets. The expression of collagen type I, a marker for fibrotic cartilage, was lower in CBMC-hiPSC-derived pellets compared to the expression of COL2A1.
The gene expression of cartilage ECM proteins in day-21 chondrogenic pellets was confirmed by real-time PCR. The aggrecan (ACAN) expression of CBMC-hiPSC-derived pellets was similar to that of BMSC-derived pellets (Figure 3A). The expression of COL2A1 was significantly higher in CBMC-hiPSC-derived pellets (Figure 3B). The expression of sex-determining region Y-box 9 (Sox9), a chondrogenic progenitor marker, was also evaluated. Pellets generated from CBMC-hiPSCs expressed high levels of Sox9 (Figure 3C). We confirmed that these genes were significantly upregulated in CBMC-hiPSC chondrogenic pellets compared to BMSC control pellets on day 21. The expression of a hypertrophic marker, COL1A1, was evaluated (Figure 3D). The expression of COL1A1 in CBMC-hiPSC-derived pellets was reduced compared to that in BMSC-derived pellets. The differentiation efficiency was analyzed by the ratio of COL2A1 to COL1A1 (Figure 3E). The increment of the ratio in CBMC-hiPSC-derived pellets demonstrated the relatively high expression of COL2A1 compared to COL1A1. In conclusion, we have confirmed the chondrogenic differentiation capacity of CBMC-hiPSCs. The quality of the generated CBMC-hiPSC-derived chondrogenic pellets had a quality compatible with that of BMSCs.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/55988/55988fig1.jpg" /> 
Figure 1: Chondrogenic differentiation of hiPSCs. (A) Scheme of chondrogenic pellet generation from hiPSCs. (B) Morphology of the generated CBMC-hiPSC. (C) Morphology of generated EBs. (D) Outgrowth cells derived from EBs attached to a gelatin-coated culture dish. (E) Image of the chondrogenic pellet after 21 days of differentiation. The units of the intervals are shown in millimeters. Scale bars = 200 &#181;m. <a href="http://cloudflare.jove.com/files/ftp_upload/55988/55988fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/55988/55988fig2.jpg" /> 
Figure 2: Histological analysis of the chondrogenic pellet. (A) Histological evaluation of chondrogenic pellets on day 21 using alcian blue and toluidine blue staining. (B) Immunohistochemistry image of chondrogenic pellets stained with COL1A1 and COL2A1 antibodies. Scale bars = 100 &#181;m. <a href="http://cloudflare.jove.com/files/ftp_upload/55988/55988fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/55988/55988fig3.jpg" /> 
Figure 3: Gene expression of the chondrogenic pellet. (A) Relative gene expression of ACAN. (B) Relative gene expression of COL2A1. (C) Relative gene expression of SOX9. (D) Relative gene expression of COL1A1. (E) Gene expression of COL1A1. (F) Gene expression of COL10A1. (G) The ratio of COL2A1:COL1A1 gene expression. Pellets were harvested and analyzed after 21 days of differentiation. Data were obtained using real-time PCR and displayed as the mean standard error of triplicate experiments per sample (n = 3). The gene expression was normalized to GAPDH as an internal control. (*p &#60;0.05, **p &#60;0.01, ***p &#60;0.001). <a href="http://cloudflare.jove.com/files/ftp_upload/55988/55988fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td></td>
			<td>Cell number</td>
			<td>Outgrowth cell yield</td>
			<td>Pellet yield</td>
		</tr>
		<tr>
			<td>hiPSCs</td>
			<td>2 x 106</td>
			<td>2-5 x 107</td>
			<td>70-150</td>
		</tr>
		<tr>
			<td>MSC</td>
			<td>2 x 106</td>
			<td>-</td>
			<td>6</td>
		</tr>
	</tbody>
</table>
Table 1: Yield comparison of MSC and hiPSCs.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Target Name</td>
			<td>Direction</td>
			<td>Primer Sequence</td>
			<td>Size</td>
		</tr>
		<tr>
			<td rowspan="2">SOX9</td>
			<td>Forward</td>
			<td>TTCCGCGACGTGGACAT</td>
			<td rowspan="2">77 bp</td>
		</tr>
		<tr>
			<td>Reverse</td>
			<td>TCAAACTCGTTGACATCGAAGGT</td>
		</tr>
		<tr>
			<td rowspan="2">ACAN</td>
			<td>Forward</td>
			<td>AGCCTGCGCTCCAATGACT</td>
			<td rowspan="2">107 bp</td>
		</tr>
		<tr>
			<td>Reverse</td>
			<td>TAATGGAACACGATGCCTTTCA</td>
		</tr>
		<tr>
			<td rowspan="2">COL2A1</td>
			<td>Forward</td>
			<td>GGCAATAGCAGGTTCACGTACA</td>
			<td rowspan="2">79 bp</td>
		</tr>
		<tr>
			<td>Reverse</td>
			<td>CGATAACAGTCTTGCCCCACTTA</td>
		</tr>
		<tr>
			<td rowspan="2">COL1A1</td>
			<td>Forward</td>
			<td>CCCCTGGAAAGAATGGAGATG</td>
			<td rowspan="2">148 bp</td>
		</tr>
		<tr>
			<td>Reverse</td>
			<td>TCCAAACCACTGAAACCTCTG</td>
		</tr>
	</tbody>
</table>
Table 2: Sequences of primers against chondrogenic markers in real-time PCR.

Watch this Scientific Journal Video about Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells at JoVE.com

Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells

Here, we propose a protocol for chondrogenic differentiation from cord blood mononuclear cell-derived human induced pluripotent stem cells.

Human articular cartilage lacks the ability to repair itself. Cartilage degeneration is thus treated not by curative but by conservative treatments. ...

chondrogenic-pellet-formation-from-cord-blood-derived-induced

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

10.9K Views.  The Catholic University of Korea. Here, we propose a protocol for chondrogenic differentiation from cord blood mononuclear cell-derived human induced pluripotent stem cells.

Video: Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells

Three-dimensional Quantification of Dendritic Spines from Pyramidal Neurons Derived from Human Induced Pluripotent Stem Cells

Dendritic spines are small protrusions that correspond to the post-synaptic compartments of excitatory synapses in the central nervous system. They are distributed along the dendrites. Their morphology is largely dependent on neuronal activity, and they are dynamic. Dendritic spines express glutamatergic receptors (AMPA and NMDA receptors) on their surface and at the levels of postsynaptic densities. Each spine allows the neuron to control its state and local activity independently. Spine morphologies have been extensively studied in glutamatergic pyramidal cells of the brain cortex, using both in vivo approaches and neuronal cultures obtained from rodent tissues. Neuropathological conditions can be associated to altered spine induction and maturation, as shown in rodent cultured neurons and one-dimensional quantitative analysis 1. The present study describes a protocol for the 3D quantitative analysis of spine morphologies using human cortical neurons derived from neural stem cells (late cortical progenitors). These cells were initially obtained from induced&#160;pluripotent stem cells. This protocol allows the analysis of spine morphologies at different culture periods, and with possible comparison between induced&#160;pluripotent stem cells obtained from control individuals with those obtained from patients with psychiatric diseases.

Dendritic spines of pyramidal neurons are the sites of most excitatory synapses in mammalian brain cortex. This method describes a 3D quantitative analysis of spine morphologies in human cortical pyramidal glutamatergic neurons derived from induced&#160;pluripotent stem cells.

Dendritic spines are small protrusions that correspond to the post-synaptic compartments of excitatory synapses in the central nervous system. They are ...

Chondrogenic Differentiation Induction of Adipose-derived Stem Cells by Centrifugal Gravity

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes differentiated from stem cells using cytokines. Unfortunately, cytokine-induced chondrogenic differentiation is costly, time-consuming, and associated with a high risk of contamination during in vitro differentiation. However, biomechanical stimuli also serve as crucial regulatory factors for chondrogenesis. For example, mechanical stress can induce chondrogenic differentiation of stem cells, suggesting a potential therapeutic approach for the repair of impaired cartilage. In this study, we demonstrated that centrifugal gravity (CG, 2,400 &#215; g), a mechanical stress easily applied by centrifugation, induced the upregulation of sex determining region Y (SRY)-box 9 (SOX9) in adipose-derived stem cells (ASCs), causing them to express chondrogenic phenotypes. The centrifuged ASCs expressed higher levels of chondrogenic differentiation markers, such as aggrecan (ACAN), collagen type 2 alpha 1 (COL2A1), and collagen type 1 (COL1), but lower levels of collagen type 10 (COL10), a marker of hypertrophic chondrocytes. In addition, chondrogenic aggregate formation, a prerequisite for chondrogenesis, was observed in centrifuged ASCs.

Mechanical stress can induce the chondrogenic differentiation of stem cells, providing a potential therapeutic approach for the repair of impaired cartilage. We present a protocol to induce the chondrogenic differentiation of adipose-derived stem cells (ASCs) using centrifugal gravity (CG). CG-induced upregulation of SOX9 results in the development of chondrogenic phenotypes.

Impaired cartilage cannot heal naturally. Currently, the most advanced therapy for defects in cartilage is the transplantation of chondrocytes ...

Isolation and Characterization of Mesenchymal Stromal Cells from Human Umbilical Cord and Fetal Placenta

The human umbilical cord (UC) and placenta are non-invasive, primitive and abundant sources of mesenchymal stromal cells (MSCs) that have increasingly gained attention because they do not pose any ethical or moral concerns. Current methods to isolate MSCs from UC yield low amounts of cells with variable proliferation potentials. Since UC is an anatomically-complex organ, differences in MSC properties may be due to the differences in the anatomical regions of their isolation. In this study, we first dissected the cord/placenta samples into three discrete anatomical regions: UC, cord-placenta junction (CPJ), and fetal placenta (FP). Second, two distinct zones, cord lining (CL) and Wharton&#39;s jelly (WJ), were separated. The explant culture technique was then used to isolate cells from the four sources. The time required for the primary culture of cells from the explants varied depending on the source of the tissue. Outgrowth of the cells occurred within 3 - 4 days of the CPJ explants, whereas growth was observed after 7 - 10 days and 11 - 14 days from CL/WJ and FP explants, respectively. The isolated cells were adherent to plastic and displayed fibroblastoid morphology and surface markers, such as CD29, CD44, CD73, CD90, and CD105, similarly to bone marrow (BM)-derived MSCs. However, the colony-forming efficiency of the cells varied, with CPJ-MSCs and WJ-MSCs showing higher efficiency than BM-MSCs. MSCs from all four sources differentiated into adipogenic, chondrogenic, and osteogenic lineages, indicating that they were multipotent. CPJ-MSCs differentiated more efficiently in comparison to other MSC sources. These results suggest that the CPJ is the most potent anatomical region and yields a higher number of cells, with greater proliferation and self-renewal capacities in vitro. In conclusion, the comparative analysis of the MSCs from the four sources indicated that CPJ is a more promising source of MSCs for cell therapy, regenerative medicine, and tissue engineering.

Here, we present a protocol for the dissection of human umbilical cord (UC) and fetal placenta sample into cord lining (CL), Wharton&#39;s jelly (WJ), cord-placenta junction (CPJ), and fetal placenta (FP) for the isolation and characterization of mesenchymal stromal cells (MSCs) using the explant culture technique.

The human umbilical cord (UC) and placenta are non-invasive, primitive and abundant sources of mesenchymal stromal cells (MSCs) that have increasingly ...

Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells

In this study, we used peripheral blood cells (PBCs) as seed cells to produce chondrocytes via induced pluripotent stem cells (iPSCs) in an integration-free method. Following embryoid body (EB) formation and fibroblastic cell expansion, the iPSCs are induced for chondrogenic differentiation for 21 days under serum-free and xeno-free conditions. After chondrocyte induction, the phenotypes of the cells are evaluated by morphological, immunohistochemical, and biochemical analyses, as well as by the quantitative real-time PCR examination of chondrogenic differentiation markers. The chondrogenic pellets show positive alcian blue and toluidine blue staining. The immunohistochemistry of collagen II and X staining is also positive. The sulfated glycosaminoglycan (sGAG) content and the chondrogenic differentiation markers COLLAGEN 2 (COL2), COLLAGEN 10 (COL10), SOX9, and AGGRECAN are significantly upregulated in chondrogenic pellets compared to hiPSCs and fibroblastic cells. These results suggest that PBCs can be used as seed cells to generate iPSCs for cartilage repair, which is patient-specific and cost-effective.

We present a protocol to generate a chondrogenic lineage from human peripheral blood (PB) via induced pluripotent stem cells (iPSCs) using an integration-free method, which includes embryoid body (EB) formation, fibroblastic cells expansion, and chondrogenic induction.

In this study, we used peripheral blood cells (PBCs) as seed cells to produce chondrocytes via induced pluripotent stem cells (iPSCs) in an ...

Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells

The skin is the body&#8217;s largest organ and has many functions. The skin acts as a physical barrier and protector of the body and regulates bodily functions. Biomimetics is the imitation of the models, systems, and elements of nature for the purpose of solving complex human problems1. Skin biomimetics is a useful tool for in vitro disease research and in vivo regenerative medicine. Human induced pluripotent stem cells (iPSCs) have the characteristic of unlimited proliferation and the ability of differentiation to three germ layers. Human iPSCs are generated from various primary cells, such as blood cells, keratinocytes, fibroblasts, and more. Among them, cord blood mononuclear cells (CBMCs) have emerged as an alternative cell source from the perspective of allogeneic regenerative medicine. CBMCs are useful in regenerative medicine because human leukocyte antigen (HLA) typing is essential to the cell banking system. We provide a method for the differentiation of CBMC-iPSCs into keratinocytes and fibroblasts and for generation of a 3D skin organoid. CBMC-iPSC-derived keratinocytes and fibroblasts have characteristics similar to a primary cell line. The 3D skin organoids are generated by overlaying an epidermal layer onto a dermal layer. By transplanting this 3D skin organoid, a humanized mice model is generated. This study shows that a 3D human iPSC-derived skin organoid may be a novel, alternative tool for dermatologic research in vitro and in vivo.

We propose a protocol that shows how to differentiate induced pluripotent stem cell-derived keratinocytes and fibroblasts and generate a 3D skin organoid, using these keratinocytes and fibroblasts. This protocol contains an additional step of generating a humanized mice model. The technique presented here will improve dermatologic research.

The skin is the body&#8217;s largest organ and has many functions. The skin acts as a physical barrier and protector of the body and regulates bodily ...

3D Magnetic Stem Cell Aggregation and Bioreactor Maturation for Cartilage Regeneration

Cartilage engineering remains a challenge due to the difficulties in creating an in vitro functional implant similar to the native tissue. An approach recently explored for the development of autologous replacements involves the differentiation of stem cells into chondrocytes. To initiate this chondrogenesis, a degree of compaction of the stem cells is required; hence, we demonstrated the feasibility of magnetically condensing cells, both within thick scaffolds and scaffold-free, using miniaturized magnetic field sources as cell attractors. This magnetic approach was also used to guide aggregate fusion and to build scaffold-free, organized, three-dimensional (3D) tissues several millimeters in size. In addition to having an enhanced size, the tissue formed by magnetic-driven fusion presented a significant increase in the expression of collagen II, and a similar trend was observed for aggrecan expression. As the native cartilage was subjected to forces that influenced its 3D structure, dynamic maturation was also performed. A bioreactor that provides mechanical stimuli was used to culture the magnetically seeded scaffolds over a 21-day period. Bioreactor maturation largely improved chondrogenesis into the cellularized scaffolds; the extracellular matrix obtained under these conditions was rich in collagen II and aggrecan. This work outlines the innovative potential of magnetic condensation of labeled stem cells and dynamic maturation in a bioreactor for improved chondrogenic differentiation, both scaffold-free and within polysaccharide scaffolds.

Chondrogenesis from stem cells requires fine tuning the culture conditions. Here, we present a magnetic approach for condensing cells, an essential step to initiate chondrogenesis. In addition, we show that dynamic maturation in a bioreactor applies mechanical stimulation to the cellular constructs and enhances cartilaginous extracellular matrix production.

Cartilage engineering remains a challenge due to the difficulties in creating an in vitro functional implant similar to the native tissue. An approach ...

Bioengineering

Generating Spheroids from Various Chondrocytes using Low-Adhesive Conditions under Gravity and Homemade Mini-Bioreactors

Cartilage repair in chronic joint diseases demands advanced cell-based therapies to regenerate damaged tissues effectively. This protocol provides a step-by-step method for differentiating induced pluripotent stem cells (iPSCs) into chondrocyte-based spheroids, supporting tissue engineering and cell therapy applications. The differentiation process is carefully structured to promote chondrogenic lineage commitment, beginning with iPSCs cultured in specific media that sequentially guide cells through critical stages of differentiation. Initially, iPSCs are expanded to reach optimal confluency before induction toward chondrogenic lineage using a series of defined media changes. By day 10, cells are transitioned to a chondrogenesis-promoting medium that enhances the formation of chondrocyte-like cells expressing key markers of mature chondrocytes. Further aggregation in 96-well agarose-coated plates leads to the formation of three-dimensional spheroids, which are then cultured in custom mini-bioreactors designed to simulate a microenvironment that encourages extracellular matrix (ECM) deposition. By enabling scalable production of chondrocyte spheroids that mimic native cartilage characteristics, this approach offers a promising, reproducible solution for developing cell-based treatments for cartilage defects, providing broad utility for clinical and research applications in musculoskeletal regenerative medicine.

This study describes a method for producing chondrocytic spheroids by aggregating cells into spheroids under low-adhesion conditions using gravity, followed by culturing the resulting spheroids in mini-bioreactors.

Cartilage repair in chronic joint diseases demands advanced cell-based therapies to regenerate damaged tissues effectively. This protocol provides a ...

Artificial Cartilage Implants for Bone Regeneration via Endochondral Ossification

Integrated Bone Formation Through In Vivo Endochondral Ossification Using Mesenchymal Stem Cells

Conventional bone regeneration therapy using mesenchymal stem cells (MSCs) is difficult to apply to bone defects larger than the critical size because it does not have a mechanism to induce angiogenesis. Implanting artificial cartilage tissue fabricated from MSCs induces angiogenesis and bone formation in vivo via endochondral ossification (ECO). Therefore, this ECO-mediated approach may be a promising bone regeneration therapy in the future. An important aspect of the clinical application of this ECO-mediated approach is establishing a protocol for preparing enough cartilage to be implanted to repair the bone defect. It is especially not practical to design a single mass of grafted cartilage of a size that conforms to the shape of the actual bone defect. Therefore, the cartilage to be transplanted must have the property of forming bone integrally when multiple pieces are implanted. Hydrogels may be an attractive tool for scaling up tissue-engineered grafts for endochondral ossification to meet clinical requirements. Although many naturally derived hydrogels support MSC cartilage formation in vitro and ECO in vivo, the optimal scaffold material to meet the needs of clinical applications has yet to be determined. Hyaluronic acid (HA) is a crucial component of the cartilage extracellular matrix and is a biodegradable and biocompatible polysaccharide. Here, we show that HA hydrogels have excellent properties to support in vitro differentiation of MSC-based cartilage tissue and promote endochondral bone formation in vivo.

Author Spotlight: Enhancing Bone Regeneration with Vascularized Artificial Cartilage Integration 

Bone therapy via endochondral ossification by implanting artificial cartilage tissue produced from mesenchymal stem cells has the potential to circumvent the drawbacks of conventional therapies. Hyaluronic acid hydrogels are effective in scaling up uniformly differentiated cartilage grafts as well as creating integrated bone with vascularization between fused grafts in vivo.

Conventional bone regeneration therapy using mesenchymal stem cells (MSCs) is difficult to apply to bone defects larger than the critical size because it ...

Biology

Characterizing Surface Antigens and Proliferation Ability in hiPSC-Driving MSCs

Comparison of Two Representative Methods for Differentiation of Human Induced Pluripotent Stem Cells into Mesenchymal Stromal Cells

Mesenchymal stromal cells (MSCs) are adult pluripotent stem cells which have been widely used in regenerative medicine. As somatic tissue-derived MSCs are restricted by limited donation, quality variations, and biosafety, the past 10 years have seen a great rise in efforts to generate MSCs from human induced pluripotent stem cells (hiPSCs). Past and recent efforts in the differentiation of hiPSCs into MSCs have been centered around two culture methodologies: (1) the formation of embryoid bodies (EBs) and (2) the use of monolayer culture. This protocol describes these two representative methods in deriving MSC from hiPSCs. Each method presents its advantages and disadvantages, including time, cost, cell proliferation ability, the expression of MSC markers, and their capability of differentiation in vitro. This protocol demonstrates that both methods can derive mature and functional MSCs from hiPSCs. The monolayer method is characterized by lower cost, simpler operation, and easier osteogenic differentiation, while the EB method is characterized by lower time consumption.

Author Spotlight: Advancements in iPSCs and Genetic Disease Research 

This protocol describes and compares two representative methods for differentiating hiPSCs into mesenchymal stromal cells (MSCs). The monolayer method is characterized by lower cost, simpler operation, and easier osteogenic differentiation. The embryoid bodies (EBs) method is characterized by lower time consumption.

Mesenchymal stromal cells (MSCs) are adult pluripotent stem cells which have been widely used in regenerative medicine. As somatic tissue-derived MSCs are ...

Chondroprogenitor and Chondrocyte Isolation from Human Articular Cartilage

Isolation of Chondrocytes and Chondroprogenitors Using Fibronectin Adhesion and Migratory Assay

Chondroprogenitor cells (CPCs), recently identified as a distinct subpopulation, exhibit promise due to their mesenchymal properties, heightened chondrogenesis, and limited hypertrophic traits. The enrichment of progenitors is achieved through differential fibronectin adhesion and migration-based explant assays, with Fibronectin Adhesion Assay-derived Chondroprogenitors (FAA-CPs) and Migratory Chondroprogenitors (MCPs) demonstrating superior potential compared to chondrocytes. This article delves into the details of isolating resident cartilage-derived cells, namely chondrocytes and chondroprogenitors. While valuable insights from chondrocyte research contribute to our understanding of cartilage repair, ongoing efforts are directed toward the use of chondroprogenitors and exploring their potential as an alternative therapeutic approach. Additionally, this methodology article provides a detailed step-by-step protocol for isolating three specific cell types from cartilage: chondrocytes, FAA-CPs, and MCPs. By following standardized procedures, this protocol facilitates the successful extraction of these cell subtypes. Grounded in extensive research, the article focuses on the intricate techniques utilized in isolating the different subsets and the optimized culture conditions required to expand and maintain their cultures. The methodology encompasses enzymatic isolation of human articular cartilage-derived chondrocytes, differential fibronectin adhesion following sequential enzymatic digestion, and migration-based explant assays to obtain cartilage-resident cells.

This protocol details the isolation of chondrocytes, Fibronectin Adhesion Assay-derived Chondroprogenitors (FAA-CPs), and Migratory Chondroprogenitors (MCPs) from human articular cartilage. It covers enzymatic digestion, fibronectin adhesion, and migration-based assays for isolating and characterizing these cells.