This work was financed by the German Research council (DFG) through the German excellence initiative (CellNetworks DFG-EXC 81) and a partial financing by the collaborative research centre SFB638.

<ol>
	<li>Scott, D. E., Bayly, A. R., Abell, C., Skidmore, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+molecules,+big+targets:+drug+discovery+faces+the+protein-protein+interaction+challenge.">Small molecules, big targets: drug discovery faces the protein-protein interaction challenge.</a> Nat Rev Drug Discov. 15 (8), 533-550 (2016).</li><li>Roux, K. J., Kim, D. I., Raida, M., Burke, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+promiscuous+biotin+ligase+fusion+protein+identifies+proximal+and+interacting+proteins+in+mammalian+cells.">A promiscuous biotin ligase fusion protein identifies proximal and interacting proteins in mammalian cells.</a> J Cell Biol. 196 (6), 801-810 (2012).</li><li>Lam, S. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+APEX2+for+electron+microscopy+and+proximity+labeling.">Directed evolution of APEX2 for electron microscopy and proximity labeling.</a> Nat Methods. 12 (1), 51-54 (2015).</li><li>Rhee, H. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteomic+mapping+of+mitochondria+in+living+cells+via+spatially+restricted+enzymatic+tagging.">Proteomic mapping of mitochondria in living cells via spatially restricted enzymatic tagging.</a> Science. 339 (6125), 1328-1331 (2013).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+nuclear+pore+complex+architecture+with+proximity-dependent+biotinylation.">Probing nuclear pore complex architecture with proximity-dependent biotinylation.</a> P Natl Acad Sci USA. 111 (24), E2453-E2461 (2014).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+smaller+biotin+ligase+for+BioID+proximity+labeling.">An improved smaller biotin ligase for BioID proximity labeling.</a> Mol Biol Cell. 27 (8), 1188-1196 (2016).</li><li>Lambert, J. P., Tucholska, M., Go, C., Knight, J. D., Gingras, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proximity+biotinylation+and+affinity+purification+are+complementary+approaches+for+the+interactome+mapping+of+chromatin-associated+protein+complexes.">Proximity biotinylation and affinity purification are complementary approaches for the interactome mapping of chromatin-associated protein complexes.</a> J Proteomics. 118, 81-94 (2015).</li><li>Morriswood, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+bilobe+components+in+Trypanosoma+brucei+identified+using+proximity-dependent+biotinylation.">Novel bilobe components in Trypanosoma brucei identified using proximity-dependent biotinylation.</a> Eukaryot Cell. 12 (2), 356-367 (2013).</li><li>Schopp, I. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID+a+conditional+proteomics+approach+to+monitor+the+composition+of+spatiotemporally+defined+protein+complexes.">Split-BioID a conditional proteomics approach to monitor the composition of spatiotemporally defined protein complexes.</a> Nat Commun. 8, (2017).</li><li>B&#233;thune, J., Artus-Revel, C. G., Filipowicz, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetic+analysis+reveals+successive+steps+leading+to+miRNA-mediated+silencing+in+mammalian+cells.">Kinetic analysis reveals successive steps leading to miRNA-mediated silencing in mammalian cells.</a> EMBO Rep. 13 (8), 716-723 (2012).</li><li>Inoue, H., Nojima, H., Okayama, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+efficiency+transformation+of+Escherichia+coli+with+plasmids.">High efficiency transformation of Escherichia coli with plasmids.</a> Gene. 96 (1), 23-28 (1990).</li><li>Weidenfeld, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+expression+of+coding+and+inhibitory+RNAs+from+retargetable+genomic+loci.">Inducible expression of coding and inhibitory RNAs from retargetable genomic loci.</a> Nucleic Acids Res. 37 (7), e50 (2009).</li><li>Dyballa, N., Metzger, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+and+sensitive+colloidal+coomassie+G-250+staining+for+proteins+in+polyacrylamide+gels.">Fast and sensitive colloidal coomassie G-250 staining for proteins in polyacrylamide gels.</a> J Vis Exp. (30), (2009).</li><li>Jonas, S., Izaurralde, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+a+molecular+understanding+of+microRNA-mediated+gene+silencing.">Towards a molecular understanding of microRNA-mediated gene silencing.</a> Nat Rev Genet. 16 (7), 421-433 (2015).</li><li>MacRae, I. J., Ma, E., Zhou, M., Robinson, C. V., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reconstitution+of+the+human+RISC-loading+complex.">In vitro reconstitution of the human RISC-loading complex.</a> P Natl Acad Sci USA. 105 (2), 512-517 (2008).</li><li>Cox, J., Mann, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MaxQuant+enables+high+peptide+identification+rates,+individualized+p.p.b.-range+mass+accuracies+and+proteome-wide+protein+quantification.">MaxQuant enables high peptide identification rates, individualized p.p.b.-range mass accuracies and proteome-wide protein quantification.</a> Nat Biotechnol. 26 (12), 1367-1372 (2008).</li><li>Tyanova, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Perseus+computational+platform+for+comprehensive+analysis+of+(prote)omics+data.">The Perseus computational platform for comprehensive analysis of (prote)omics data.</a> Nat Methods. 13 (9), 731-740 (2016).</li><li>Opitz, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+the+Asc1p/Receptor+for+Activated+C+Kinase+1+(RACK1)+Microenvironment+at+the+Head+Region+of+the+40S+Ribosome+with+Quantitative+BioID+in+Yeast.">Capturing the Asc1p/Receptor for Activated C Kinase 1 (RACK1) Microenvironment at the Head Region of the 40S Ribosome with Quantitative BioID in Yeast.</a> Mol Cell Proteomics. 16 (12), 2199-2218 (2017).</li><li>Mackmull, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+of+nuclear+transport+receptor+cargo+specificity.">Landscape of nuclear transport receptor cargo specificity.</a> Mol Syst Biol. 13 (12), 962 (2017).</li><li>Kim, D. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BioSITe:+A+Method+for+Direct+Detection+and+Quantitation+of+Site-Specific+Biotinylation.">BioSITe: A Method for Direct Detection and Quantitation of Site-Specific Biotinylation.</a> J Proteome Res. , (2017).</li><li>Udeshi, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibodies+to+biotin+enable+large-scale+detection+of+biotinylation+sites+on+proteins.">Antibodies to biotin enable large-scale detection of biotinylation sites on proteins.</a> Nat Methods. 14 (12), 1167-1170 (2017).</li><li>Chapat, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cap-binding+protein+4EHP+effects+translation+silencing+by+microRNAs.">Cap-binding protein 4EHP effects translation silencing by microRNAs.</a> P Natl Acad Sci USA. 114 (21), 5425-5430 (2017).</li><li>Luker, K. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kinetics+of+regulated+protein-protein+interactions+revealed+with+firefly+luciferase+complementation+imaging+in+cells+and+living+animals.">Kinetics of regulated protein-protein interactions revealed with firefly luciferase complementation imaging in cells and living animals.</a> P Natl Acad Sci USA. 101 (33), 12288-12293 (2004).</li><li>De Munter, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Split-BioID:+a+proximity+biotinylation+assay+for+dimerization-dependent+protein+interactions.">Split-BioID: a proximity biotinylation assay for dimerization-dependent protein interactions.</a> FEBS Lett. 591 (2), 415-424 (2017).</li><li>Xue, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimizing+the+fragment+complementation+of+APEX2+for+detection+of+specific+protein-protein+interactions+in+live+cells.">Optimizing the fragment complementation of APEX2 for detection of specific protein-protein interactions in live cells.</a> Sci Rep. 7 (1), 12039 (2017).</li><li>Branon, T. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+TurboID+for+efficient+proximity+labeling+in+living+cells+and+organisms.">Directed evolution of TurboID for efficient proximity labeling in living cells and organisms.</a> bioRxiv. , (2017).</li></ol>

The authors have nothing to disclose.

The outlined procedure describes how to clone genes of interest into the split-BioID plasmids, how to test for interaction-induced biotinylation and how to isolate biotinylated proteins for mass spectrometry analysis. We describe here a procedure based on transient transfection. While the expression of the fusion proteins can be tuned by the amount of dox added to the medium, transient transfection may lead to non-homogenous protein expression with some cells that grossly overexpress the fusion proteins when compared to the endogenous counterparts. This may lead to distortions of the corresponding interactomes and to PPI that do not faithfully reflect the interactions that involve the endogenous proteins. It is thus generally advisable to construct stable cell lines once split-BioID has been established with the transient system. The plasmids are compatible with the Flp-mediated recombination system and place both genes of interest under the regulation of the same tet-responsive element. If needed, and when used with compatible mammalian cells, they allow the easy creation of stable inducible cell lines. For example, we use the HeLa-EM2-11 line that expresses the rtTA tetracycline-activated transcription activator and a unique targetable genomic locus from which tetracycline-mediated gene expression can be tightly regulated12. Using this cell line and Flp-mediated recombination, stable cell lines that contain only one copy of the transgene can be obtained within two-three weeks. Alternatively, one could also use current genome editing techniques to introduce the BirA* fragments in the native genomic loci of the genes of interest.
As in any assay that relies on tagging a protein, one needs to consider if the resulting fusion proteins are functional. Available data in which the proteins of interest were tagged (for example with GFP for imaging studies) and functionally tested are useful to decide if the BirA* fragments should be cloned upstream or downstream the genes of interest. If no such data are available, one should test N-terminally or C-terminally tagged proteins in a functional assay. For example, the activity of the fusion proteins can be tested in a cell line in which the endogenous protein has been knocked-out and compared to the wild type situation. If the proteins of interest tolerate both N- and C-terminal tags, both should be tested. Indeed, in BioID experiments, the orientation of the fusion protein can influence the efficiency of labeling22. In addition, we have observed that when applying split-BioID to a pair of proteins, which of the two proteins is appended to either the NBirA* or CBirA* fragment also influence the efficiency of labeling9. In the split-BioID plasmids, the 16 amino acid long glycine/serine rich linkers coupling the proteins of interest to the BirA* fragments were taken from another PCA23 and worked for us for all interacting proteins we have tested so far. However, one should consider that some protein pairs might work better with shorter or longer linkers. Of final note, another assay was described by the Bollen group24. In this assay, BirA* is split at another site (E140/Q141) than ours (E256/G257). We have tested both split-BioID flavors side-by-side and found that E256/G257, described in this protocol, leads to stronger re-activation when coupled to two interacting proteins9.
One general drawback of this method is the slow speed of labeling. Typically, 6 to 24 h incubation time with biotin is necessary to obtain appreciable biotinylation6, precluding the use of this technique for studying dynamic remodeling of protein complexes. While this assay partially addresses this caveat as it is only activated when two proteins interact, the slow speed of labeling preclude its use for studying response to very dynamic processes or to analyze short-lived proteins. The engineered peroxidase APEX2 is known to promote efficient labeling of proximal proteins within 1 min3. A PCA based on APEX2 might thus address the limitations of the slow labeling speed of BioID-derived assays. A proof-of-principle study described such a split-APEX2 assay25. However, although a homodimerizing protein was successfully biotinylated, whether the assay can also be used to label and identify proteins that assemble around a pair of interacting proteins remains to be demonstrated. Very recently, directed evolution was used to create TurboID and miniTurbo, two variants of BirA* with enhanced activity that allow much shorter labeling time windows, down to 10 min26. Adapting split-BioID to these new variants will further extend the use of this technique to a broader field of applications.

As most cellular functions are performed by proteins that dynamically assemble macromolecular complexes, the identification of protein-protein interactions (PPI) is a major endeavor in biomedical research. Indeed, PPI are often deregulated in disease and represent potential targets for therapeutics1. The most widely used method for the identification of PPI is the affinity purification (AP) approach in which, following cell lysis, a protein of interest is specifically purified on a matrix and associated proteins are subsequently identified by mass spectrometry (MS). While AP-MS is a powerful approach, it typically does not perform well on poorly soluble protein complexes, very transient interactions or PPI that require an intact subcellular structure. Moreover, the interpretation of the data can be complicated by the dynamic nature of PPI networks, as a single protein is often part of several distinct protein complexes.
Proximity-labeling techniques such as BioID2 or APEX23,4 were recently developed to address some of the limitations of the AP-MS approaches. In BioID, the enzyme BirA* (corresponding to a G115R variant of the wild type E. coli enzyme) catalyzes the formation of labile biotinyl-AMP (bio-AMP) that can react with primary amines. As opposed to the wild type enzyme, that retains bio-AMP in its active center, BirA* releases bio-AMP allowing its diffusion to its neighboring environment. Hence, when fused to a protein of interest and expressed in cells, proximal proteins can be biotinylated within an estimated range of 10 nm5. These marked proximal proteins are then isolated by streptavidin pulldown and identified by MS. As opposed to AP-MS, BioID requires the expression of a fusion protein. It can thus only be applied to proteins whose function is not hampered by tagging. Moreover, the speed of labeling is slow, typically 6&#8211;24 h2,6, making the detection of short-lived proteins challenging. Yet, compared to AP-MS, BioID-MS offers several key advantages: first, its captures the interactions in their native cellular environment; second, labeled proteins rather than assembled complexes are isolated following cell lysis; third, streptavidin pulldowns allow using denaturing buffers and harsh washing conditions. Hence, the method is more sensitive to detect transient or weak interactions7 or interactions that occur on a specific and hard to isolate subcellular structure8.
However, most proteins are usually part of larger complexes that can remodel according to cellular cues or to the function that needs to be performed. Hence, a single protein is typically part of several complexes, corresponding to distinct functional units, involving distinct and/or overlapping PPI. Both approaches give an overview of all associations a given protein may have, but they fail to address the context of individual PPI. To increase the resolution of the latter, we have designed a protein-fragments complementation assay (PCA) in which two inactive fragments of BirA* (NBirA*, that contains the catalytic domain, and CBirA* that can be viewed as the re-activation domain) can reassemble into an active enzyme when brought in close proximity by two interacting proteins9. The resulting split-BioID assay focuses the proximity-dependent biotinylation on proteins that assemble around a pair of interacting proteins and thus allows the identification of context dependent protein assemblies. We recently demonstrated the outstanding resolution power of split-BioID by resolving two distinct protein complexes involved in the miRNA-mediated gene-silencing pathway9.
Altogether, in a single and simple assay, split-BioID allows discovering and specifically assigning PPI to defined functional units in which a given protein is involved, provided an additional interacting protein of the corresponding protein complex is known.

<table>
	<tbody>
		<tr>
			<td>Acetic acid (glacial)</td>
			<td>VWR</td>
			<td>20104.298</td>
			<td>To make TAE buffer</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Sigma</td>
			<td>A9539</td>
			<td>Take TAE-agarose gels for DNA analysis and extraction</td>
		</tr>
		<tr>
			<td>Ammonia solution 25% NH3</td>
			<td>Bernd Kraft</td>
			<td>6012</td>
			<td>To dissolve biotin</td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Sigma</td>
			<td>A9518</td>
			<td>To select transformed bacteria</td>
		</tr>
		<tr>
			<td>Bioruptor plus sonification device</td>
			<td>Diagenode</td>
			<td>B01020001</td>
			<td>Other sonification devices are also ok</td>
		</tr>
		<tr>
			<td>Biotin</td>
			<td>Sigma</td>
			<td>B4639</td>
			<td>To be added to the growth medium to stimulate efficient biotinylation</td>
		</tr>
		<tr>
			<td>Bovine serum albumin fraction V</td>
			<td>Carl Roth</td>
			<td>8076</td>
			<td>Used in Western blot buffers and a protein standard in Bradford assays</td>
		</tr>
		<tr>
			<td>Bradford Ultra reagent</td>
			<td>Expedeon</td>
			<td>BFU05L</td>
			<td>Any other method/kit for protein determination is fine, this particular reagent is more tolerant to detergent than other Bradford reagents</td>
		</tr>
		<tr>
			<td>Cell scrappers</td>
			<td>TPP</td>
			<td>99002</td>
			<td>Any other model is also fine</td>
		</tr>
		<tr>
			<td>ClaI</td>
			<td>New England Biolabs</td>
			<td>R0197</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td>
		</tr>
		<tr>
			<td>DMEM medium</td>
			<td>Sigma</td>
			<td>D6046</td>
			<td>If using another cell line, use the corresponding optimal growth medium</td>
		</tr>
		<tr>
			<td>DNA miniprep kit</td>
			<td>Sigma</td>
			<td>PLN350</td>
			<td>Any other kit is also fine</td>
		</tr>
		<tr>
			<td>Doxycycline</td>
			<td>Applichem</td>
			<td>A2951</td>
			<td>Dox is light sensitive</td>
		</tr>
		<tr>
			<td>DTT</td>
			<td>Applichem</td>
			<td>A2948</td>
			<td>Make 1M stock solution, store at -20 &#176;C and always use fresh</td>
		</tr>
		<tr>
			<td>DyLight 680-conjugated streptavidin</td>
			<td>Thermo scientific</td>
			<td>21848</td>
			<td>to use with a LiCor Western blot scanning device</td>
		</tr>
		<tr>
			<td>Dynabeads MyOne Streptavidin C1</td>
			<td>Invitrogen</td>
			<td>65002</td>
			<td>The C1 beads are not BSA coated which is preferable for downstream MS applications (no leakthrough of BSA in the final elution)</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Applichem</td>
			<td>A5097</td>
			<td>Make a 500 mM stock, adjust pH to 8 while dissolving the EDTA powder</td>
		</tr>
		<tr>
			<td>Ethanol</td>
			<td>Sigma</td>
			<td>32205</td>
			<td>Make a 70% stock solution in which Doxycycline can be dissolved at 10 mg.mL-1</td>
		</tr>
		<tr>
			<td>Fastgene Gel/PCR DNA Extraction Kit</td>
			<td>Nippon Genetics</td>
			<td>FG-91302</td>
			<td>Any other kit is also fine</td>
		</tr>
		<tr>
			<td>HCl 37%</td>
			<td>Merck</td>
			<td>1.00317.1000</td>
			<td>To adjust pH of biotin stock solution</td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Carl Roth</td>
			<td>6763</td>
			<td>Make a 500 mM stock solution, adjust the pH to 7.4</td>
		</tr>
		<tr>
			<td>Immobilon-FL PVDF membrane, 0.45&#160;&#181;m</td>
			<td>Millipore</td>
			<td>IPFL00010</td>
			<td>This membrane shows minimal autofluorescence when used with a LiCor Western blot scanning device</td>
		</tr>
		<tr>
			<td>LiCl</td>
			<td>Gr&#252;ssing GmbH</td>
			<td>12083</td>
			<td>Make a 5M stock solution</td>
		</tr>
		<tr>
			<td>Odyssey CLx imaging system</td>
			<td>LI-COR</td>
			<td>N/A</td>
			<td>To scan Western blot membrane decorated with fluorophore-labeled antibody</td>
		</tr>
		<tr>
			<td>Linear polyethylenimine (PEI)</td>
			<td>Polysciences</td>
			<td>23966-2</td>
			<td>Any other transfection reagent is also fine</td>
		</tr>
		<tr>
			<td>Milk powder</td>
			<td>Carl Roth</td>
			<td>T145</td>
			<td>To block Western blot membranes</td>
		</tr>
		<tr>
			<td>MluI-HF</td>
			<td>New England Biolabs</td>
			<td>R3198</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (NBirA* fusion)</td>
		</tr>
		<tr>
			<td>Na-deoxycholate</td>
			<td>Sigma</td>
			<td>30970</td>
			<td>Make a 10% (w/v) stock solution</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma</td>
			<td>31434</td>
			<td>Make a 5M stock solution</td>
		</tr>
		<tr>
			<td>NP-40 (Nonidet P40 substitute)</td>
			<td>Sigma</td>
			<td>74385</td>
			<td>Make a 20% (v/v) stock solution</td>
		</tr>
		<tr>
			<td>PacI</td>
			<td>New England Biolabs</td>
			<td>R0547</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td>
		</tr>
		<tr>
			<td>Phosphate buffer saline (PBS)</td>
			<td>Sigma</td>
			<td>806552</td>
			<td>To wash cells before scrapping</td>
		</tr>
		<tr>
			<td>PmeI</td>
			<td>New England Biolabs</td>
			<td>R0560</td>
			<td>Restriction enzyme for cloning into the split-BioID plasmids (CBirA* fusion)</td>
		</tr>
		<tr>
			<td>Protease inhibitor cocktail</td>
			<td>Roche</td>
			<td>4693132001</td>
			<td>Added to the lysis buffer to prevent protein degradation</td>
		</tr>
		<tr>
			<td>pSF3-Flag-CBir-FRB_Myc-NBir-FKBP</td>
			<td>Addgene</td>
			<td>90003</td>
			<td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>pSF3-Flag-CBir-FRB_FKBP-Myc-Nbir</td>
			<td>Addgene</td>
			<td>90004</td>
			<td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and CBirA*-FRB, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>pSF3-Flag-FRB-Cbir_Myc-NBir-FKBP</td>
			<td>Addgene</td>
			<td>90008</td>
			<td>Split-BioID plasmid, mediates the co-expression of NBirA*-FKBP and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>pSF3-Flag-FRB-Cbir_FKBP-Myc-Nbir</td>
			<td>Addgene</td>
			<td>90009</td>
			<td>Split-BioID plasmid, mediates the co-expression of FKBP-NBirA* and FRB-CBirA*, FKBP and FRB can be replaced by two other ORFs</td>
		</tr>
		<tr>
			<td>Q5 High-Fidelity PCR kit</td>
			<td>New England Biolabs</td>
			<td>E0555S</td>
			<td>To amplify the ORF coding for the proteins to be tested. Any other thermostable DNA polymerase is fine.</td>
		</tr>
		<tr>
			<td>Quick ligation kit</td>
			<td>New England Biolabs</td>
			<td>M2200S</td>
			<td>To ligate DNA fragments into the split-BioID plasmids, any other DNA ligation system is fine.</td>
		</tr>
		<tr>
			<td>RunBlue 4-20% SDS precast gels</td>
			<td>Expedeon</td>
			<td>BCG42012</td>
			<td>To use when running samples for MS analysis</td>
		</tr>
		<tr>
			<td>RunBlue LDS Sample Buffer</td>
			<td>Expedeon</td>
			<td>NXB31010</td>
			<td>Running buffer for the RunBlue precast gels</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Sigma</td>
			<td>5030</td>
			<td>Comes as a 20% stock solution</td>
		</tr>
		<tr>
			<td>tet-free serum</td>
			<td>Biowest</td>
			<td>S181T</td>
			<td>we use tet-free serum to minimize basal expression of the fusion proteins</td>
		</tr>
		<tr>
			<td>Trans-Blot Turbo Transfer system</td>
			<td>Bio-Rad</td>
			<td>1704150</td>
			<td>High speed Western blotting transfer system, any other transfer system is also fine</td>
		</tr>
		<tr>
			<td>Tris</td>
			<td>Carl Roth</td>
			<td>4855</td>
			<td>Make 1M stock solutions with adequate pH (7.4 and 8)</td>
		</tr>
		<tr>
			<td>Triton X-100</td>
			<td>Applichem</td>
			<td>A4975</td>
			<td>Make a 20% (v/v) stock solution</td>
		</tr>
		<tr>
			<td>Tween-20</td>
			<td>Carl Roth</td>
			<td>9127</td>
			<td>Used in Western blot buffers, Tween 20 leads to high background fluorescence and should be omitted in the blocking and last wash step</td>
		</tr>
	</tbody>
</table>

split-bioid &#8212; proteomic analysis of context-specific protein complexes in their native cellular environment

To complement existing affinity purification (AP) approaches for the identification of protein-protein interactions (PPI), enzymes have been introduced that allow the proximity-dependent labeling of proteins in living cells. One such enzyme, BirA* (used in the BioID approach), mediates the biotinylation of proteins within a range of approximately 10 nm. Hence, when fused to a protein of interest and expressed in cells, it allows the labeling of proximal proteins in their native environment. As opposed to AP that relies on the purification of assembled protein complexes, BioID detects proteins that have been marked within cells no matter whether they are still interacting with the protein of interest when they are isolated. Since it biotinylates proximal proteins, one can moreover capitalize on the exceptional affinity of streptavidin for biotin to very efficiently isolate them. While BioID performs better than AP for identifying transient or weak interactions, both AP- and BioID-mass spectrometry approaches provide an overview of all possible interactions a given protein may have. However, they do not provide information on the context of each identified PPI. Indeed, most proteins are typically part of several complexes, corresponding to distinct maturation steps or different functional units. To address this common limitation of both methods, we have engineered a protein-fragments complementation assay based on the BirA* enzyme. In this assay, two inactive fragments of BirA* can reassemble into an active enzyme when brought in close proximity by two interacting proteins to which they are fused. The resulting split-BioID assay thus allows the labeling of proteins that assemble around a pair of interacting proteins. Provided these two only interact in a given context, split-BioID then allows the analysis of specific context-dependent functional units in their native cellular environment. Here, we provide a step-by-step protocol to test and apply split-BioID to a pair of interacting proteins.

To illustrate how this method works, the open reading frames (ORFs) of the proteins Ago2, TNRC6C and Dicer (all involved in the miRNA-mediated gene silencing pathway) were cloned in split-BioID plasmids. Ago2 is known to interact with TNRC6C within a miRNA-induced silencing complex (miRISC) that represses translation and stimulate decay of target mRNAs14. Prior to assemble the miRISC, Ago2 interact with Dicer, the enzyme that produces mature miRNAs, within a complex in which it may get loaded with a miRNA15. Hence split-BioID was applied to either the Ago2/Dicer pair or the Ago2/TNRC6C pair. For each pair of tested proteins, Ago2 was either fused to NBirA* or CBirA* using our split-BioID plasmids (Figure 2), and Dicer and TNRC6C to the corresponding cognate BirA* fragment. In addition, each protein was fused to CBirA* and paired with an NBirA*-GFP fusion as a negative control. This results in testing four iterations for each pair of tested protein (Table 1).
To test whether split-BioID is activated upon the interaction of the pair of tested proteins, we followed the scheme depicted on Figure 1. The plasmids were transiently transfected in a tet-system compatible HeLa cell line. The expression of the fusion proteins was induced with doxycycline (dox) and biotinylation was stimulated by adding excess biotin to the growth medium. Following a 20 h incubation time with dox and biotin, cells were lysed and analyzed by Western blotting using conjugated streptavidin to detect biotinylated proteins. In mammalian cells, two major bands are typically detected by the conjugated streptavidin in the untransfected sample (Figure 3, stars) and correspond to endogenously biotinylated proteins (most probably mitochondrial carboxylases). These two bands are present in all samples and can be conveniently used as internal loading controls, thus, the detection of a housekeeping protein to control the loading of equal protein amounts is superfluous. Typical for a BioID/split-BioID experiment, the additional major bands that can be observed are the fusion proteins that got self-biotinylated. Even if no other biotinylated protein is seen, detecting biotinylation of the fusion proteins at this stage already indicates that the two tested proteins interacted in the cells. In the experiment depicted on Figure 3, it is clear that having an NBirA*-Ago2 fusion protein paired with CBirA* fusions to TNRC6C or Dicer is more efficient than the opposite combinations in which CBirA*-Ago2 is paired to NBirA* fusions of the other two proteins (Figure 3, upper panel, compare the intensities of lanes 2-3 to lanes 6-7). Moreover, the activation was specific as none of the CBirA* fusions could activate the NBirA*-GFP control fusion protein to appreciable levels (Figure 3, compare lanes 1, 4-5 to lane 8 that corresponds to untransfected cells). Since in our plasmids, NBirA* has a myc tag and CBirA* has a FLAG tag (Figure 2), the expression levels of each fusion protein can be analyzed with antibodies against these two tags (Figure 3, bottom panel).
When interaction-induced biotinylation is observed, the experiment can be scaled up, and the biotinylated proteins isolated on streptavidin-coupled beads as indicated in paragraph 4 of the protocol (Figure 4). When performing the isolation the first time, all the steps of the purification may be analyzed by Western blotting (Figure 5). Typically, binding to the beads should be almost quantitative and virtually no leak through should be observed in the washes. Prior processing the samples for mass spectrometry, we recommend running a Western blot to ensure induced-biotinylation worked as expected and that the fusion proteins were expressed. The lack of expression of the fusion proteins is either due to poor transfection efficiency or faulty dox induction. If the fusion proteins were expressed but no biotinylation is observed, check if excess biotin (50 &#956;M) was actually added to the medium and that the stock biotin is still active. When the eluted material is analyzed on a Coomassie-stained protein gel (Figure 6), typically, the strongest band to be observed runs at about 17 kDa and corresponds to monomeric streptavidin. Bands corresponding to the endogenous biotinylated proteins and the fusion proteins may also be observed. We typically excise the area of the sample lane above the streptavidin band up to the loading well (Figure 6). The excised band can be stored in a 1.5 mL tube and sent to a mass spectrometry facility. Alternatively, bound proteins may also be trypsin-digested on the streptavidin-coupled beads and the digested peptides eluted form the column. We routinely use the MaxQuant software16 (using mostly default parameters and adding lysine biotinylation as a possible post-translational modification, see reference 9 for more details and for typical MS results) to analyze the MS raw data and the Perseus suite17 for the subsequent statistical analysis, both are free software. Samples are typically run in three biological replicates. Using label-free quantification, specifically enriched proteins can be identified over control conditions. To filter for endogenously biotinylated proteins and for proteins that are non-specifically labeled by the BirA* enzyme, we only consider proteins that are significantly enriched over hits from six datasets generated with six unrelated proteins. In addition, we only consider hits that are enriched over a split-BioID dataset in which the NBirA* fusion proteins have been replaced by NBirA*-GFP. Other data analysis strategies have been proposed notably using stable isotope labeling with amino acids in cell culture (SILAC) for quantitative proteomics18. In addition, various strategies have been described for the direct isolation of biotinylated peptides using a streptavidin variant with weakened affinity to biotin18, special elution conditions using organic solvents19 or biotin-specific antibodies20,21. While not necessarily leading to the discovery of more proteins, the identification of biotinylation sites add more confidence as to the specificity of the hits and is useful when addressing the topology of an interaction.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57479/57479fig1.jpg" /> 
Figure 1: Overview of the split-BioID procedure. Protein 1 interacts with protein 2 as part of Complex A, or with protein 3 as part of Complex B. To specifically probe the composition of Complex A, split-BioID can be applied to proteins 1 and 2. The photograph of the mass spectrometer is under a Creative Commons Attribution-Share Alike 3.0 Unported license and was downloaded from https://commons.wikimedia.org with file name of ThermoScientificOrbitrapElite.JPG. <a href="/files/ftp_upload/57479/57479fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57479/57479fig2.jpg" /> 
Figure 2: Expression cassettes of the split-BioID plasmids. We provide four plasmids to allow testing all combinations of NBirA* and CBirA* fusion proteins. The plasmids and complete maps are available at addgene.org under the indicated numbers. The plasmids have a tet-responsive element (7x tetO) and need to be used in a cell line that is compatible with the tet expression system. Also note that in all plasmids the ORFs of FKBP and FRB are fused to the NBirA* and CBirA* fragments respectively. These two proteins interact only in the presence of rapamycin and hence the plasmids can be used to quickly test the system in the presence or absence of this chemical9. The indicated restriction sites are unique. <a href="/files/ftp_upload/57479/57479fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57479/57479fig3.jpg" /> 
Figure 3: Typical Western blot for a split-BioID experiment. Upper panel: detection of biotinylated proteins with fluorescently labeled streptavidin. Lower panel: detection of the fusion proteins with anti-Myc and anti-FLAG antibodies. Two pairs of proteins were tested: Ago2/TNRC6C and Ago2/Dicer. In lanes 2 &#38; 3, Ago2 was appended to the CBirA* fragment. In lanes 6 &#38; 7, Ago2 was appended to the NBirA* fragment. No significant signal was observed when any of the three proteins were combined with NBirA*-GFP (lanes 1, 4-5). The stars indicate the bands corresponding to endogenously biotinylated proteins that can serve as internal loading controls. This figure is adapted from Figure 5B of Schopp et al.9 under a Creative Commons Attribution 4.0 International license. <a href="/files/ftp_upload/57479/57479fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57479/57479fig4.jpg" /> 
Figure 4: Overview of the streptavidin pulldown procedure. Major steps for the isolation of biotinylated proteins for mass spectrometry analysis are depicted. <a href="/files/ftp_upload/57479/57479fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57479/57479fig5.jpg" /> 
Figure 5: Typical Western blot for a streptavidin pulldown experiment. Equal volumes of each indicated sample were loaded on an SDS-polyacrylamide gel. Following Western blotting, biotinylated proteins were detected with HRP-coupled streptavidin. Bands corresponding to NBirA*-TNRC6C and CBirA*-Ago2 are indicated. <a href="/files/ftp_upload/57479/57479fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57479/57479fig6.jpg" /> 
Figure 6: Typical Coomassie-stained protein gel for mass spectrometry analysis. The eluted sample from streptavidin-coupled beads was loaded on a precast protein gel and run until the sample migrate 2-3 cm. The major band seen at about 17 kDa is streptavidin. The area directly above that band is excised and sent to a mass spectrometry facility. Bands corresponding to NBirA*-TNRC6C and CBirA*-Ago2 are indicated. <a href="/files/ftp_upload/57479/57479fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Transfection sample</td>
			<td colspan="3">Condition tested</td>
		</tr>
		<tr>
			<td>1</td>
			<td colspan="3">NBirA*-protein1/CBirA*-protein2</td>
		</tr>
		<tr>
			<td>2</td>
			<td colspan="3">CBirA*-protein1/NBirA*-protein2</td>
		</tr>
		<tr>
			<td>3</td>
			<td colspan="3">NBirA*-GFP/CBirA*-protein1</td>
		</tr>
		<tr>
			<td>4</td>
			<td colspan="3">NBirA*-GFP/CBirA*-protein2</td>
		</tr>
		<tr>
			<td>5</td>
			<td colspan="3">no transfection</td>
		</tr>
	</tbody>
</table>
Table 1: Typically tested conditions when applying split-BioID to two proteins.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Sequencing primer</td>
			<td>sequence</td>
		</tr>
		<tr>
			<td>Cassette 1 reverse primer (CBirA* fusion)</td>
			<td>TATACTTTCTAGAGAATAGGAAC</td>
		</tr>
		<tr>
			<td>Cassette 2 reverse primer (NBirA* fusion)</td>
			<td>GTGGTTTGTCCAAACTCATC</td>
		</tr>
	</tbody>
</table>
Table 2: Sequencing primers for the split-BioID plasmids.

Watch this Scientific Journal Video about Split-BioID Ã¢â‚¬â€ Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment at JoVE.com

Split-BioID ÃƒÆ’Ã‚Â¢ÃƒÂ¢Ã¢â‚¬Å¡Ã‚Â¬ÃƒÂ¢Ã¢â€šÂ¬Ã‚Â Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

We provide a step-by-step protocol for split-BioID, a protein fragments-complementation assay based on the proximity-labeling technique BioID. Activated on the interaction of two given proteins, it allows the proteomics analysis of context-dependent protein complexes in their native cellular environment. The method is simple, cost-effective and only requires standard laboratory equipment.

Split-BioID &#8212; Proteomic Analysis of Context-specific Protein Complexes in Their Native Cellular Environment

To complement existing affinity purification (AP) approaches for the identification of protein-protein interactions (PPI), enzymes have been introduced ...

Research

JoVE Journal

Biochemistry

Identification of Small Molecule-binding Proteins in a Native Cellular Environment by Live-cell Photoaffinity Labeling

Identifying the molecular target(s) of small molecules is a challenging but necessary step towards understanding their mechanism of action. While several ...

Synthesis of 1,2-Azaborines and the Preparation of Their Protein Complexes with T4 Lysozyme Mutants

We describe a general synthesis of 1,2-azaborines using standard air-free techniques and protein complex preparation with T4 lysozyme mutants by vapor ...

Tandem Affinity Purification of Protein Complexes from Eukaryotic Cells

The purification of active protein-protein and protein-nucleic acid complexes is crucial for the characterization of enzymatic activities and de novo ...

Resolving Affinity Purified Protein Complexes by Blue Native PAGE and Protein Correlation Profiling

Most proteins act in association with others; hence, it is crucial to characterize these functional units in order to fully understand biological ...

Dissection of Human Retina and RPE-Choroid for Proteomic Analysis

The human retina is composed of the sensory neuroretina and the underlying retinal pigmented epithelium (RPE), which is firmly complexed to the vascular ...

2 in 1: One-step Affinity Purification for the Parallel Analysis of Protein-Protein and Protein-Metabolite Complexes

Cellular processes are regulated by interactions between biological molecules such as proteins, metabolites, and nucleic acids. While the investigation of ...

Analysis of Thylakoid Membrane Protein Complexes by Blue Native Gel Electrophoresis

Photosynthetic electron transfer chain (ETC) converts solar energy to chemical energy in the form of NADPH and ATP. Four large protein complexes embedded ...

Affinity Purification of Chloroplast Translocon Protein Complexes Using the TAP Tag

Chloroplast biogenesis requires the import of thousands of nucleus-encoded proteins into the plastid. The import of these proteins depends on the ...

Proteomic Analysis of Human Macrophage Polarization Under a Low Oxygen Environment

Macrophages are innate immune cells involved in a number of physiological functions ranging from responses to infectious pathogens to tissue homeostasis. ...

Analysis of Protein Folding, Transport, and Degradation in Living Cells by Radioactive Pulse Chase

Radioactive pulse-chase labeling is a powerful tool for studying the conformational maturation, the transport to their functional cellular location, and ...