The authors thank Dr. Qin Yu from AstraZeneca R&#38;D Boston, MA, USA, for providing the AZD4316 drug. The authors are grateful to the Cymages platform for access to the ScanR Olympus microscope, which was supported by grants from the region Ile-de-France (DIM ONE HEALTH). The authors acknowledge support from the INSERM and the Versailles Saint-Quentin University.

<ol>
	<li>Shi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global,+regional,+and+national+disease+burden+estimates+of+acute+lower+respiratory+infections+due+to+respiratory+syncytial+virus+in+young+children+in+2015:+a+systematic+review+and+modelling+study.">Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in young children in 2015: a systematic review and modelling study.</a> The Lancet. 390 (10098), 946-958 (2017).</li><li>Falsey, A. R., Hennessey, P. A., Formica, M. A., Cox, C., Walsh, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Respiratory+Syncytial+Virus+Infection+in+Elderly+and+High-Risk+Adults.">Respiratory Syncytial Virus Infection in Elderly and High-Risk Adults.</a> The New England Journal of Medicine. 352 (17), 1749-1759 (2005).</li><li>DeVincenzo, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activity+of+Oral+ALS-008176+in+a+Respiratory+Syncytial+Virus+Challenge+Study.">Activity of Oral ALS-008176 in a Respiratory Syncytial Virus Challenge Study.</a> The New England Journal of Medicine. 373 (21), 2048-2058 (2015).</li><li>DeVincenzo, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+GS-5806+Activity+in+a+Respiratory+Syncytial+Virus+Challenge+Study.">Oral GS-5806 Activity in a Respiratory Syncytial Virus Challenge Study.</a> The New England Journal of Medicine. 371 (8), 711-722 (2014).</li><li>Afonso, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Taxonomy+of+the+order+Mononegavirales:+update+2016.">Taxonomy of the order Mononegavirales: update 2016.</a> Archives of Virology. 161 (8), 2351-2360 (2016).</li><li>Collins, P. L., Hill, M. G., Cristina, J., Grosfeld, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+elongation+factor+of+respiratory+syncytial+virus,+a+nonsegmented+negative-strand+RNA+virus.">Transcription elongation factor of respiratory syncytial virus, a nonsegmented negative-strand RNA virus.</a> Proceedings of the National Academy of Sciences of the United States of America. 93 (1), 81-85 (1996).</li><li>Hoenen, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inclusion+bodies+are+a+site+of+ebolavirus+replication.">Inclusion bodies are a site of ebolavirus replication.</a> Journal of Virology. 86 (21), 11779-11788 (2012).</li><li>Heinrich, B. S., Cureton, D. K., Rahmeh, A. A., Whelan, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+expression+redirects+vesicular+stomatitis+virus+RNA+synthesis+to+cytoplasmic+inclusions.">Protein expression redirects vesicular stomatitis virus RNA synthesis to cytoplasmic inclusions.</a> PLoS Pathogens. 6 (6), e1000958 (2010).</li><li>Lahaye, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Characterization+of+Negri+Bodies+(NBs)+in+Rabies+Virus-Infected+Cells:+Evidence+that+NBs+Are+Sites+of+Viral+Transcription+and+Replication.">Functional Characterization of Negri Bodies (NBs) in Rabies Virus-Infected Cells: Evidence that NBs Are Sites of Viral Transcription and Replication.</a> Journal of Virology. 83 (16), 7948-7958 (2009).</li><li>Kolesnikova, L., M&#252;hlberger, E., Ryabchikova, E., Becker, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+organization+of+recombinant+Marburg+virus+nucleoprotein:+comparison+with+Marburg+virus+inclusions.">Ultrastructural organization of recombinant Marburg virus nucleoprotein: comparison with Marburg virus inclusions.</a> Journal of Virology. 74 (8), 3899-3904 (2000).</li><li>Dolnik, O., Stevermann, L., Kolesnikova, L., Becker, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marburg+virus+inclusions:+A+virus-induced+microcompartment+and+interface+to+multivesicular+bodies+and+the+late+endosomal+compartment.">Marburg virus inclusions: A virus-induced microcompartment and interface to multivesicular bodies and the late endosomal compartment.</a> European Journal of Cell Biology. 94 (7-9), 323-331 (2015).</li><li>Rincheval, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+organization+of+cytoplasmic+inclusion+bodies+in+cells+infected+by+respiratory+syncytial+virus.">Functional organization of cytoplasmic inclusion bodies in cells infected by respiratory syncytial virus.</a> Nature Communications. 8 (1), 563 (2017).</li><li>Santangelo, P. J., Bao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+filamentous+viral+RNPs+prior+to+egress.">Dynamics of filamentous viral RNPs prior to egress.</a> Nucleic Acids Research. 35 (11), 3602-3611 (2007).</li><li>Lifland, A. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Respiratory+Syncytial+Virus+Nucleoprotein+and+Inclusion+Bodies+Antagonize+the+Innate+Immune+Response+Mediated+by+MDA5+and+MAVS.">Human Respiratory Syncytial Virus Nucleoprotein and Inclusion Bodies Antagonize the Innate Immune Response Mediated by MDA5 and MAVS.</a> Journal of Virology. 86 (15), 8245-8258 (2012).</li><li>Garcia, J., Garcia-Barreno, B., Vivo, A., Melero, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+inclusions+of+respiratory+syncytial+virus-infected+cells:+formation+of+inclusion+bodies+in+transfected+cells+that+coexpress+the+nucleoprotein,+the+phosphoprotein,+and+the+22K+protein.">Cytoplasmic inclusions of respiratory syncytial virus-infected cells: formation of inclusion bodies in transfected cells that coexpress the nucleoprotein, the phosphoprotein, and the 22K protein.</a> Virology. 195 (1), 243-247 (1993).</li><li>Brown, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+an+association+between+heat+shock+protein+70+and+the+respiratory+syncytial+virus+polymerase+complex+within+lipid-raft+membranes+during+virus+infection.">Evidence for an association between heat shock protein 70 and the respiratory syncytial virus polymerase complex within lipid-raft membranes during virus infection.</a> Virology. 338 (1), 69-80 (2005).</li><li>Radhakrishnan, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+analysis+of+purified+respiratory+syncytial+virus+particles+reveals+an+important+role+for+heat+shock+protein+90+in+virus+particle+assembly.">Protein analysis of purified respiratory syncytial virus particles reveals an important role for heat shock protein 90 in virus particle assembly.</a> Molecular &amp; Cellular Proteomics. 9 (9), 1829-1848 (2010).</li><li>Racaniello, V. R., Baltimore, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloned+poliovirus+complementary+DNA+is+infectious+in+mammalian+cells.">Cloned poliovirus complementary DNA is infectious in mammalian cells.</a> Science. 214 (4523), 916-919 (1981).</li><li>Schnell, M. J., Mebatsion, T., Conzelmann, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infectious+rabies+viruses+from+cloned+cDNA.">Infectious rabies viruses from cloned cDNA.</a> The EMBO Journal. 13 (18), 4195-4203 (1994).</li><li>Collins, P. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+infectious+human+respiratory+syncytial+virus+from+cloned+cDNA+confirms+an+essential+role+for+the+transcription+elongation+factor+from+the+5'+proximal+open+reading+frame+of+the+M2+mRNA+in+gene+expression+and+provides+a+capability+for+vaccine.">Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5' proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine.</a> Proceedings of the National Academy of Sciences of the United States of America. 92 (25), 11563-11567 (1995).</li><li>Rameix-Welti, M. -. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+the+replication+of+respiratory+syncytial+virus+in+cells+and+in+living+mice.">Visualizing the replication of respiratory syncytial virus in cells and in living mice.</a> Nature Communications. 5, 5104 (2014).</li><li>Buchholz, U. J., Finke, S., Conzelmann, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+bovine+respiratory+syncytial+virus+(BRSV)+from+cDNA:+BRSV+NS2+is+not+essential+for+virus+replication+in+tissue+culture,+and+the+human+RSV+leader+region+acts+as+a+functional+BRSV+genome+promoter.">Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter.</a> Journal of Virology. 73 (1), 251-259 (1999).</li><li>Cianci, C., Meanwell, N., Krystal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antiviral+activity+and+molecular+mechanism+of+an+orally+active+respiratory+syncytial+virus+fusion+inhibitor.">Antiviral activity and molecular mechanism of an orally active respiratory syncytial virus fusion inhibitor.</a> Journal of Antimicrobial Chemotherapy. 55 (3), 289-292 (2005).</li><li>Derscheid, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+respiratory+syncytial+virus+memphis+37+grown+in+HEp-2+cells+causes+more+severe+disease+in+lambs+than+virus+grown+in+vero+cells.">Human respiratory syncytial virus memphis 37 grown in HEp-2 cells causes more severe disease in lambs than virus grown in vero cells.</a> Viruses. 5 (11), 2881-2897 (2013).</li><li>McKimm-Breschkin, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simplified+plaque+assay+for+respiratory+syncytial+virus+-+direct+visualization+of+plaques+without+immunostaining.">A simplified plaque assay for respiratory syncytial virus - direct visualization of plaques without immunostaining.</a> Journal of Virological Methods. 120, 113-117 (2004).</li><li>Matrosovich, M., Matrosovich, T., Garten, W., Klenk, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+low-viscosity+overlay+medium+for+viral+plaque+assays.">New low-viscosity overlay medium for viral plaque assays.</a> Virology Journal. 7, 1-7 (2006).</li><li>Novina, C. D., Sharp, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RNAi+revolution.">The RNAi revolution.</a> Nature. 430 (6996), 161-164 (2004).</li><li>Sintchak, M. D., Nimmesgern, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+structure+of+inosine+5'-monophosphate+dehydrogenase+and+the+design+of+novel+inhibitors.">The structure of inosine 5'-monophosphate dehydrogenase and the design of novel inhibitors.</a> Immunopharmacology. 47 (2-3), 163-184 (2000).</li><li>Beaucourt, S., Vignuzzi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribavirin:+A+drug+active+against+many+viruses+with+multiple+effects+on+virus+replication+and+propagation.+Molecular+basis+of+ribavirin+resistance.">Ribavirin: A drug active against many viruses with multiple effects on virus replication and propagation. Molecular basis of ribavirin resistance.</a> Current Opinion in Virology. 8, 10-15 (2014).</li><li>Hruska, J. F., Bernstein, J. M., Douglas, R. G., Hall, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+Ribavirin+on+Respiratory+Syncytial+Virus+in+vitro.">Effects of Ribavirin on Respiratory Syncytial Virus in vitro.</a> Antimicrobial Agents and Chemotherapy. 17 (5), 770-775 (1980).</li><li>Sim&#245;es, E. A. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Past,+Present+and+Future+Approaches+to+the+Prevention+and+Treatment+of+Respiratory+Syncytial+Virus+Infection+in+Children.">Past, Present and Future Approaches to the Prevention and Treatment of Respiratory Syncytial Virus Infection in Children.</a> Infectious Diseases and Therapy. 7 (1), 87-120 (2018).</li><li>Alvarez, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference-mediated+silencing+of+the+respiratory+syncytial+virus+nucleocapsid+defines+a+potent+antiviral+strategy.">RNA interference-mediated silencing of the respiratory syncytial virus nucleocapsid defines a potent antiviral strategy.</a> Antimicrobial Agents and Chemotherapy. 53 (9), 3952-3962 (2009).</li><li>DeVincenzo, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+randomized,+double-blind,+placebo-comtrolled+study+of+an+RNAi-based+therapy+directed+against+respiratory+syncytial+virus.">A randomized, double-blind, placebo-comtrolled study of an RNAi-based therapy directed against respiratory syncytial virus.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (19), 8800-8805 (2010).</li><li>Zhou, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (7501), 487-491 (2014).</li><li>Nikolic, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negri+bodies+are+viral+factories+with+properties+of+liquid+organelles.">Negri bodies are viral factories with properties of liquid organelles.</a> Nature Communications. 8 (1), 58 (2017).</li></ol>

The authors have nothing to disclose.

Here we present a method of rescue of recombinant RSVs from five plasmids, and their amplification. The ability to manipulate the genome of viruses has revolutionized virology research to test mutations and express an additional gene or a tagged viral protein. The RSV we have described and used as an example in this article is a virus expressing a reporter gene, the RSV-GFP (unpublished), and expresses an M2-1 protein fused to a GFP tag12. RSV rescue is challenging and requires practice. The trans...

Human RSV is the leading cause of hospitalization for acute respiratory tract infection in infants worldwide1. In addition, RSV is associated with a substantial disease burden in adults comparable to influenza, with most of the hospitalization and mortality burden in the elderly2. There are no vaccines or specific antivirals available yet against RSV, but promising new drugs are in development3,4. The complexity and the heaviness of the techniques of quantification of RSV multiplication impede the search for antivirals or vaccines despite current considerable efforts. The quantification of RSV multiplication in vitro is generally based on laborious, time-consuming, and expensive methods, which consist mostly in the analysis of the cytopathic effect by microscopy, immunostaining, plaque reduction assays, quantitative reverse transcriptase (qRT)-polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay tests. Viruses with modified genomes and expressing reporter genes, such as those coding for the GFP, are more suitable for such screenings. Coupled to the use of automated plate readers, reporter gene-carrying recombinant viruses can make these assays more suitable for standardization and high-throughput purposes.
RSV is an enveloped, nonsegmented negative-sense RNA virus that belongs to the Orthopneumovirus genus of the Pneumoviridae family, order Mononegavirales5. The RSV genome is a single-strand, negative-sense RNA of about 15 kb, which contains a noncoding region at the 3&#39; and 5&#39; extremities called Leader and Trailer and 10 transcriptional units encoding 11 proteins. The genes are ordered as follows: 3&#39;-NS1, NS2, N, P, M, SH, G, F, M2 (encoding for M2-1 and M2-2 proteins) and L-5&#39;. The genomic RNA is tightly packaged by the nucleoprotein N. Using the encapsidated genomic RNA as a template, viral RNA-dependent RNA polymerase (RdRp) will ensure transcription and replication of the viral RNA. Viral RdRp is composed of the large protein L which carries the nucleotide polymerase activity per se, its mandatory cofactor the phosphoprotein P and the M2-1 protein which functions as a viral transcription factor6. In infected cells, RSV induces the formation of cytoplasmic inclusions called inclusion bodies (IBs). Morphologically similar cytoplasmic inclusions have been observed for several Mononegavirales7,8,9,10. Recent studies on rabies virus, vesicular stomatitis virus (VSV), Ebola virus, and RSV showed that viral RNA synthesis occurs in IBs, which can thus be regarded as viral factories8,9,11,12. The virus factories concentrate the RNA and viral proteins required for viral RNA synthesis and also contain cellular proteins13,14,15,16,17. IBs exhibit a functional subcompartment called IB-associated granules (IBAGs), which concentrate the newly synthetized nascent viral mRNA together with the M2-1 protein. The genomic RNA and the L, P, and N are not detected in IBAGs. IBAGs are small dynamic spherical structures inside IBs that exhibit the properties of liquid organelles12. Despite the central role of IBs in viral multiplication, very little is known about the nature, internal structure, formation, and operation of these viral factories.
The expression of the genome of a poliovirus from a cDNA enabled the production of the first infectious viral clone in 198118. For single-stranded negative RNA viruses, it was not until 1994 that the production of a first rabies virus following transfection of plasmids into cells19 took place. The first plasmid-based reverse genetic system for RSV was published in 199520. Reverse genetics have led to major advances in the field of virology. The possibility of introducing specific modifications into the viral genome has provided critical insights into the replication and pathogenesis of RNA viruses. This technology has also greatly facilitated the development of vaccines by allowing specific attenuation through targeted series of modifications. Genome modifications allowing a rapid quantification of viral multiplication greatly improved the antiviral screening and study of their mode of action.
Although previously described, obtaining genetically modified RSVs remains delicate. Here, we detail a protocol to create two types of recombinant HRSV, respectively expressing RSV-GFP or RSV-M2-1-GFP. In this protocol, we describe the transfection conditions needed to rescue the new recombinant viruses, as well as their amplification to obtain viral stocks with high titer, suitable for reproducible experimentations. The construction of the reverse genetics&#39; vectors per se is not described here. We do describe methods for the optimal harvesting and freezing of viral stocks. The most accurate method to quantify viral infectious particles remains plaque assay. Cells are infected with serial dilutions of the analyzed suspension and incubated with an overlay that prohibits the diffusion of free viral particles in the supernatant. In such conditions, the virus will only infect contiguous cells forming a &#34;plaque&#34; for each initial infectious particle. In the conventional RSV titration assay, plaques are revealed by immunostaining and counted under microscopic observation. This method is expensive and time-consuming. Here we described a very simple protocol for an RSV plaque assay using microcrystalline cellulose overlay that enables the formation of plaques visible to the naked eye. We show how RSV-GFP can be used to measure RSV replication and, thus, to quantify the impact of antivirals. Combining reverse genetics and live imaging technology, we demonstrate how RSV-M2-1-GFP allows scientists to visualize M2-1 in live cells and to follow the dynamics of intracellular viral structures, such as IBs.

<table>
	<tbody>
		<tr>
			<td>35mm &#181; dish for live cell imaging</td>
			<td>Ibidi</td>
			<td>81156</td>
			<td></td>
		</tr>
		<tr>
			<td>A549</td>
			<td>ATCC</td>
			<td>ATCC CCL-185</td>
			<td></td>
		</tr>
		<tr>
			<td>Avicel RC-591</td>
			<td>FMC BioPolymer</td>
			<td>Avicel RC-591</td>
			<td>Technical and other information on Avicels is available at http://www.fmcbiopolymer.com. Store at room temperature. Protocol in step 4 is optimized for this reagent.</td>
		</tr>
		<tr>
			<td>BSRT7/5</td>
			<td></td>
			<td>not commercially available</td>
			<td>See ref 22. Buchholz et al, 1999</td>
		</tr>
		<tr>
			<td>Crystal violet solution</td>
			<td>Sigma</td>
			<td>HT90132</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence microscope for observations</td>
			<td>Olympus</td>
			<td>IX73 Olympus microscope</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence microscope for videomicroscopy</td>
			<td>Olympus</td>
			<td>ScanR Olympus microscope</td>
			<td></td>
		</tr>
		<tr>
			<td>HEp-2</td>
			<td>ATCC</td>
			<td>ATCC CCL-23</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES &#8805;99.5%</td>
			<td>Sigma</td>
			<td>H3375</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Glutamine (200 mM)</td>
			<td>ThermoFisher Scientific</td>
			<td>25030024</td>
			<td></td>
		</tr>
		<tr>
			<td>LIPOFECTAMINE 2000 REAGENT</td>
			<td>ThermoFisher Scientific</td>
			<td>11668019</td>
			<td>Protocol in step 2.3. is optimized for this reagent.</td>
		</tr>
		<tr>
			<td>MEM (10X), no glutamine</td>
			<td>ThermoFisher Scientific</td>
			<td>11430030</td>
			<td></td>
		</tr>
		<tr>
			<td>MEM, GlutaMAX Supplement</td>
			<td>ThermoFisher Scientific</td>
			<td>41090-028</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4 ReagentPlus, &#8805;99.5%</td>
			<td>Sigma</td>
			<td>M7506</td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM I Reduced Serum Medium</td>
			<td>ThermoFisher Scientific</td>
			<td>51985-026</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde Aqueous Solution, 32%, EM Grade</td>
			<td>Electron Microscopy Sciences</td>
			<td>15714</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (10,000 U/mL)</td>
			<td>ThermoFisher Scientific</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmids</td>
			<td></td>
			<td>not commercially available</td>
			<td>see ref 21. Rameix-Welti et al, 2014</td>
		</tr>
		<tr>
			<td>See Saw Rocker</td>
			<td>VWR</td>
			<td>444-0341</td>
			<td></td>
		</tr>
		<tr>
			<td>Si RNA GAPDH</td>
			<td>Dharmacon</td>
			<td>ON-TARGETplus siRNA 
			D-001810-10-05</td>
			<td>SMARTpool and 3 of 4 individual siRNAs designed by Dharmacon.</td>
		</tr>
		<tr>
			<td>Si RNA IMPDH2</td>
			<td>Dharmacon</td>
			<td>ON-TARGETplus siRNA IMPDH2 Pool- Human 
			L-004330-00-0005</td>
			<td>SMARTpool of 4 individual siRNAs designed by Dharmacon. 
			Individual references and sequences 
			J-004330-06: GGAAAGUUGCCCAUUGUAA; 
			J-004330-07: GCACGGCGCUUUGGUGUUC; 
			J-004330-08: AAGGGUCAAUCCACAAAUU; 
			J-004330-09: GGUAUGGGUUCUCUCGAUG;</td>
		</tr>
		<tr>
			<td>Si RNA RSV N</td>
			<td>Dharmacon</td>
			<td>ON-TARGETplus custom siRNA</td>
			<td>UUCAGAAGAACUAGAGGCUAU and UUUCAUAAAUUCACUGGGUUA</td>
		</tr>
		<tr>
			<td>SiRNA NT</td>
			<td>Dharmacon</td>
			<td>ON-TARGETplus Non-targeting Pool</td>
			<td></td>
		</tr>
		<tr>
			<td>SiRNA transfection reagent</td>
			<td>Dharmacon</td>
			<td>DharmaFECT 1 Ref: T-2001-03</td>
			<td>Protocol in steps 5.1.and 5.1.2 are optimized for this reagent.</td>
		</tr>
		<tr>
			<td>Sodium Bicarbonate 7.5% solution</td>
			<td>ThermoFisher Scientific</td>
			<td>25080094</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrofluorometer</td>
			<td>Tecan</td>
			<td>Tecan infinite M200PRO</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation, amplification, and titration of recombinant respiratory syncytial viruses

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 106 to 1 x 107 plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

In this work, we described a detailed protocol to produce recombinant RSV viruses expressing a fluorescent protein (Figure 2). In pRSV-GFP, the GFP gene was introduced between the P and M genes, as described for the Cherry gene in previously published work21. In the pRSV-M2-1-GFP, the M2 gene was left untouched and an additional gene coding for M2-1-GFP was inserted between SH and G genes12. The first step, corr...

Watch this Scientific Journal Video about Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses at JoVE.com

Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, ...

generation-amplification-titration-recombinant-respiratory-syncytial

Research

JoVE Journal

Immunology and Infection

14.6K Views.  Université de Versailles St. Quentin. We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

Video: Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently being tested in human clinical trials. Wild-type AAV is a non-pathogenic member of the parvoviridae family and inherently replication-deficient. The broad transduction profile, low immune response as well as the strong and persistent transgene expression achieved with these vectors has made them a popular and versatile tool for in vitro and in vivo gene delivery. rAAVs can be easily and cheaply produced in the laboratory and, based on their favourable safety profile, are generally given a low safety classification. Here, we describe a method for the production and titering of chimeric rAAVs containing the capsid proteins of both AAV1 and AAV2. The use of these so-called chimeric vectors combines the benefits of both parental serotypes such as high titres stocks (AAV1) and purification by affinity chromatography (AAV2). These AAV serotypes are the best studied of all AAV serotypes, and individually have a broad infectivity pattern. The chimeric vectors described here should have the infectious properties of AAV1 and AAV2 and can thus be expected to infect a large range of tissues, including neurons, skeletal muscle, pancreas, kidney among others. The method described here uses heparin column purification, a method believed to give a higher viral titer and cleaner viral preparation than other purification methods, such as centrifugation through a caesium chloride gradient. Additionally, we describe how these vectors can be quickly and easily titered to give accurate reading of the number of infectious particles produced.

Recombinant adeno-associated virus (rAAVs) vectors are becoming increasingly valuable for in vivo studies in animals. We describe how rAAVs can be produced in the laboratory and how these vectors can be titered to give an accurate reading of the number of infectious particles produced.

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Protein Misfolding Cyclic Amplification of Prions

Prions are infectious agents that cause the inevitably fatal transmissible spongiform encephalopathy (TSE) in animals and humans9,18. The prion protein has two distinct isoforms, the non-infectious host-encoded protein (PrPC) and the infectious protein (PrPSc), an abnormally-folded isoform of PrPC 8.
One of the challenges of working with prion agents is the long incubation period prior to the development of clinical signs following host inoculation13. This traditionally mandated long and expensive animal bioassay studies. Furthermore, the biochemical and biophysical properties of PrPSc are poorly characterized due to their unusual conformation and aggregation states.
PrPSc can seed the conversion of PrPC to PrPSc in vitro14. PMCA is an in vitro technique that takes advantage of this ability using sonication and incubation cycles to produce large amounts of PrPSc, at an accelerated rate, from a system containing excess amounts of PrPC and minute amounts of the PrPSc seed19. This technique has proven to effectively recapitulate the species and strain specificity of PrPSc conversion from PrPC, to emulate prion strain interference, and to amplify very low levels of PrPSc from infected tissues, fluids, and environmental samples6,7,16,23 .
This paper details the PMCA protocol, including recommendations for minimizing contamination, generating consistent results, and quantifying those results. We also discuss several PMCA applications, including generation and characterization of infectious prion strains, prion strain interference, and the detection of prions in the environment.

Protein misfolding cyclic amplification (PMCA) is an in vitro assay for the study of prion conversion and strain and species barriers. It can also be used as a prion detection assay.

Prions  are infectious agents that cause the inevitably fatal transmissible spongiform  encephalopathy (TSE) in animals and humans9,18. The prion protein ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field 4. The use of cell-based arenavirus minigenome systems together with the ability to generate recombinant infectious arenaviruses with predetermined mutations in their genomes has facilitated the investigation of the contribution of viral determinants to the different steps of the arenavirus life cycle, as well as virus-host interactions and mechanisms of arenavirus pathogenesis 1, 3, 11 . In addition, the development of trisegmented arenaviruses has permitted the use of the arenavirus genome to express additional foreign genes of interest, thus opening the possibility of arenavirus-based vaccine vector applications 5 . Likewise, the development of single-cycle infectious arenaviruses capable of expressing reporter genes provides a new experimental tool to improve the safety of research involving highly pathogenic human arenaviruses 16 . The generation of recombinant arenaviruses using plasmid-based reverse genetics techniques has so far relied on the use of rodent cell lines 7,19 , which poses some barriers for the development of Food and Drug Administration (FDA)-licensed vaccine or vaccine vectors. To overcome this obstacle, we describe here the efficient generation of recombinant arenaviruses in FDA-approved Vero cells.

Rescue of recombinant arenaviruses from cloned cDNAs, an approach referred to as reverse genetics, allows researchers to investigate the role of specific viral gene products, as well as the contribution of their different specific domains and residues, to many different aspects of the biology of arenavirus. Likewise, reverse genetics techniques in FDA-approved cell lines (Vero) for vaccine development provides novel possibilities for the generation of effective and safe vaccines to combat human pathogenic arenaviruses.

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

An In vitro Model to Study Immune Responses of Human Peripheral Blood Mononuclear Cells to Human Respiratory Syncytial Virus Infection

Human respiratory syncytial virus (HRSV) infections present a broad spectrum of disease severity, ranging from mild infections to life-threatening bronchiolitis. An important part of the pathogenesis of severe disease is an enhanced immune response leading to immunopathology.	Here, we describe a protocol used to investigate the immune response of human immune cells to an HRSV infection. First, we describe methods used for culturing, purification and quantification of HRSV. Subsequently, we describe a human in vitro model in which peripheral blood mononuclear cells (PBMCs) are stimulated with live HRSV. This model system can be used to study multiple parameters that may contribute to disease severity, including the innate and adaptive immune response. These responses can be measured at the transcriptional and translational level. Moreover, viral infection of cells can easily be measured using flow cytometry. Taken together, stimulation of PBMC with live HRSV provides a fast and reproducible model system to examine mechanisms involved in HRSV-induced disease.

An In vitro Model to Study Immune Responses of Human Peripheral Blood Mononuclear Cells to Human Respiratory Syncytial Virus Infection

Human respiratory syncytial virus (HRSV) can cause severe bronchiolitis in young infants. Part of the pathogenesis of severe HRSV disease is caused by the host immune response. Stimulation of primary human immune cells with HRSV provides a fast and reproducible model system to study activation of inflammatory pathways and infection.

Human respiratory syncytial  virus (HRSV) infections present a broad spectrum of disease severity, ranging  from mild infections to life-threatening ...

High-throughput Screening for Broad-spectrum Chemical Inhibitors of RNA Viruses

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat because of increased worldwide exchanges and human populations penetrating more and more natural ecosystems. A good example of such an emerging situation is chikungunya virus epidemics of 2005-2006 in the Indian Ocean. Recent progresses in our understanding of cellular pathways controlling viral replication suggest that compounds targeting host cell functions, rather than the virus itself, could inhibit a large panel of RNA viruses. Some broad-spectrum antiviral compounds have been identified with host target-oriented assays. However, measuring the inhibition of viral replication in cell cultures using reduction of cytopathic effects as a readout still represents a paramount screening strategy. Such functional screens have been greatly improved by the development of recombinant viruses expressing reporter enzymes capable of bioluminescence such as luciferase. In the present report, we detail a high-throughput screening pipeline, which combines recombinant measles and chikungunya viruses with cellular viability assays, to identify compounds with a broad-spectrum antiviral profile.

In vitro assays to measure virus replication have been greatly improved by the development of recombinant RNA viruses expressing luciferase or other enzymes capable of bioluminescence. Here we detail a high-throughput screening pipeline that combines such recombinant strains of measles and chikungunya viruses to isolate broad-spectrum antivirals from chemical libraries.

RNA viruses are responsible for major human diseases such as flu, bronchitis, dengue, Hepatitis C or measles. They also represent an emerging threat ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the physiological mechanisms that mediate immune responses to vaccines perhaps due to the overall success of vaccination, which has reduced interest into the molecular and physiological mechanisms of vaccine immunity. However, several important human pathogens including influenza virus still pose a challenge for vaccination, and may benefit from immune-based strategies. 
Although influenza reverse genetics has been successfully applied to the generation of live-attenuated influenza vaccines (LAIVs), the addition of molecular tools in vaccine preparations such as tracer components to follow up the kinetics of vaccination in vivo, has not been addressed. In addition, the recent generation of mouse models that allow specific depletion of leukocytes during kinetic studies has opened a window of opportunity to understand the basic immune mechanisms underlying vaccine-elicited protection. Here, we describe how the combination of reverse genetics and chimeric mouse models may help to provide new insights into how vaccines work at physiological and molecular levels, using as example a recombinant, cold-adapted, live-attenuated influenza vaccine (LAIV). We utilized laboratory-generated LAIVs harboring cell tracers as well as competitive bone marrow chimeras (BMCs) to determine the early kinetics of vaccine immunity and the main physiological mechanisms responsible for the initiation of vaccine-specific adaptive immunity. In addition, we show how this technique may facilitate gene function studies in single animals during immune responses to vaccines. We propose that this technique can be applied to improve current prophylactic strategies against pathogens for which urgent medical countermeasures are needed, for example influenza, HIV, Plasmodium, and hemorrhagic fever viruses such as Ebola virus.

There is an overall lack of knowledge about how vaccines work. Here we propose the combined use of reverse genetics and bone marrow chimeric mice to gain insight into the early host immune responses to vaccines with a special focus on dendritic cells and T cell immunity.

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, including the development of immunotherapeutics. However, the techniques to identify and produce such antibodies tend to be arduous and sometimes the heavy and light chain pair of the antibodies are dissociated. Here, we describe a relatively simple, straightforward protocol to produce human recombinant monoclonal antibodies from human peripheral blood mononuclear cells using immortalization with Epstein-Barr Virus (EBV) and Toll-like receptor 9 activation. With an adequate staining, B cells producing antibodies can be isolated for subsequent immortalization and clonal expansion. The antibody transcripts produced by the immortalized B cell clones can be amplified by PCR, sequenced as corresponding heavy and light chain pairs and cloned into immunoglobulin expression vectors. The antibodies obtained with this technique can be powerful tools to study relevant human immune responses, including autoimmunity, and create the basis for new therapeutics.

Synthesis of human monoclonal antibodies is the first step in studies aimed at unraveling the pathophysiological mechanisms of auto-antibody-mediated immune responses. We have developed a protocol to generate recombinant human immunoglobulin G (IgG) monoclonal antibodies from blood sorted B cells, including B-cell isolation, antibody cloning and in vitro synthesis.