Name: generation, amplification, and titration of recombinant respiratory syncytial viruses
Uploaded: 2019-04-04T13:00:00
Description: Watch this Scientific Journal Video about Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses at JoVE.com

The authors thank Dr. Qin Yu from AstraZeneca R&#38;D Boston, MA, USA, for providing the AZD4316 drug. The authors are grateful to the Cymages platform for access to the ScanR Olympus microscope, which was supported by grants from the region Ile-de-France (DIM ONE HEALTH). The authors acknowledge support from the INSERM and the Versailles Saint-Quentin University.

1. Material Preparation
<ol>
	<li>Purchase cell media (reduced serum media, minimum essential media [MEM], 10x MEM, and Dulbecco&#8217;s modified Eagle&#8217;s medium [DMEM]), transfection reagent, and microcrystalline cellulose (see Table of Materials).</li>
	<li>Obtain the following vectors for reverse genetics: the genomic vector(s) and the expression vectors encoding the N protein and the polymerase complex proteins. The genomic vectors contain the full cDNA genome of RSV-GFP (p-RSV-GFP) and of RSV...

<ol>
	<li>Shi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global,+regional,+and+national+disease+burden+estimates+of+acute+lower+respiratory+infections+due+to+respiratory+syncytial+virus+in+young+children+in+2015:+a+systematic+review+and+modelling+study.">Global, regional, and national disease burden estimates of acute lower respiratory infections due to respiratory syncytial virus in young children in 2015: a systematic review and modelling study.</a> The Lancet. 390 (10098), 946-958 (2017).</li><li>Falsey, A. R., Hennessey, P. A., Formica, M. A., Cox, C., Walsh, E. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Respiratory+Syncytial+Virus+Infection+in+Elderly+and+High-Risk+Adults.">Respiratory Syncytial Virus Infection in Elderly and High-Risk Adults.</a> The New England Journal of Medicine. 352 (17), 1749-1759 (2005).</li><li>DeVincenzo, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activity+of+Oral+ALS-008176+in+a+Respiratory+Syncytial+Virus+Challenge+Study.">Activity of Oral ALS-008176 in a Respiratory Syncytial Virus Challenge Study.</a> The New England Journal of Medicine. 373 (21), 2048-2058 (2015).</li><li>DeVincenzo, J. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+GS-5806+Activity+in+a+Respiratory+Syncytial+Virus+Challenge+Study.">Oral GS-5806 Activity in a Respiratory Syncytial Virus Challenge Study.</a> The New England Journal of Medicine. 371 (8), 711-722 (2014).</li><li>Afonso, C. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Taxonomy+of+the+order+Mononegavirales:+update+2016.">Taxonomy of the order Mononegavirales: update 2016.</a> Archives of Virology. 161 (8), 2351-2360 (2016).</li><li>Collins, P. L., Hill, M. G., Cristina, J., Grosfeld, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcription+elongation+factor+of+respiratory+syncytial+virus,+a+nonsegmented+negative-strand+RNA+virus.">Transcription elongation factor of respiratory syncytial virus, a nonsegmented negative-strand RNA virus.</a> Proceedings of the National Academy of Sciences of the United States of America. 93 (1), 81-85 (1996).</li><li>Hoenen, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inclusion+bodies+are+a+site+of+ebolavirus+replication.">Inclusion bodies are a site of ebolavirus replication.</a> Journal of Virology. 86 (21), 11779-11788 (2012).</li><li>Heinrich, B. S., Cureton, D. K., Rahmeh, A. A., Whelan, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+expression+redirects+vesicular+stomatitis+virus+RNA+synthesis+to+cytoplasmic+inclusions.">Protein expression redirects vesicular stomatitis virus RNA synthesis to cytoplasmic inclusions.</a> PLoS Pathogens. 6 (6), e1000958 (2010).</li><li>Lahaye, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+Characterization+of+Negri+Bodies+(NBs)+in+Rabies+Virus-Infected+Cells:+Evidence+that+NBs+Are+Sites+of+Viral+Transcription+and+Replication.">Functional Characterization of Negri Bodies (NBs) in Rabies Virus-Infected Cells: Evidence that NBs Are Sites of Viral Transcription and Replication.</a> Journal of Virology. 83 (16), 7948-7958 (2009).</li><li>Kolesnikova, L., M&#252;hlberger, E., Ryabchikova, E., Becker, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructural+organization+of+recombinant+Marburg+virus+nucleoprotein:+comparison+with+Marburg+virus+inclusions.">Ultrastructural organization of recombinant Marburg virus nucleoprotein: comparison with Marburg virus inclusions.</a> Journal of Virology. 74 (8), 3899-3904 (2000).</li><li>Dolnik, O., Stevermann, L., Kolesnikova, L., Becker, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marburg+virus+inclusions:+A+virus-induced+microcompartment+and+interface+to+multivesicular+bodies+and+the+late+endosomal+compartment.">Marburg virus inclusions: A virus-induced microcompartment and interface to multivesicular bodies and the late endosomal compartment.</a> European Journal of Cell Biology. 94 (7-9), 323-331 (2015).</li><li>Rincheval, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+organization+of+cytoplasmic+inclusion+bodies+in+cells+infected+by+respiratory+syncytial+virus.">Functional organization of cytoplasmic inclusion bodies in cells infected by respiratory syncytial virus.</a> Nature Communications. 8 (1), 563 (2017).</li><li>Santangelo, P. J., Bao, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+filamentous+viral+RNPs+prior+to+egress.">Dynamics of filamentous viral RNPs prior to egress.</a> Nucleic Acids Research. 35 (11), 3602-3611 (2007).</li><li>Lifland, A. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Respiratory+Syncytial+Virus+Nucleoprotein+and+Inclusion+Bodies+Antagonize+the+Innate+Immune+Response+Mediated+by+MDA5+and+MAVS.">Human Respiratory Syncytial Virus Nucleoprotein and Inclusion Bodies Antagonize the Innate Immune Response Mediated by MDA5 and MAVS.</a> Journal of Virology. 86 (15), 8245-8258 (2012).</li><li>Garcia, J., Garcia-Barreno, B., Vivo, A., Melero, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+inclusions+of+respiratory+syncytial+virus-infected+cells:+formation+of+inclusion+bodies+in+transfected+cells+that+coexpress+the+nucleoprotein,+the+phosphoprotein,+and+the+22K+protein.">Cytoplasmic inclusions of respiratory syncytial virus-infected cells: formation of inclusion bodies in transfected cells that coexpress the nucleoprotein, the phosphoprotein, and the 22K protein.</a> Virology. 195 (1), 243-247 (1993).</li><li>Brown, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+an+association+between+heat+shock+protein+70+and+the+respiratory+syncytial+virus+polymerase+complex+within+lipid-raft+membranes+during+virus+infection.">Evidence for an association between heat shock protein 70 and the respiratory syncytial virus polymerase complex within lipid-raft membranes during virus infection.</a> Virology. 338 (1), 69-80 (2005).</li><li>Radhakrishnan, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+analysis+of+purified+respiratory+syncytial+virus+particles+reveals+an+important+role+for+heat+shock+protein+90+in+virus+particle+assembly.">Protein analysis of purified respiratory syncytial virus particles reveals an important role for heat shock protein 90 in virus particle assembly.</a> Molecular &amp; Cellular Proteomics. 9 (9), 1829-1848 (2010).</li><li>Racaniello, V. R., Baltimore, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloned+poliovirus+complementary+DNA+is+infectious+in+mammalian+cells.">Cloned poliovirus complementary DNA is infectious in mammalian cells.</a> Science. 214 (4523), 916-919 (1981).</li><li>Schnell, M. J., Mebatsion, T., Conzelmann, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Infectious+rabies+viruses+from+cloned+cDNA.">Infectious rabies viruses from cloned cDNA.</a> The EMBO Journal. 13 (18), 4195-4203 (1994).</li><li>Collins, P. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+infectious+human+respiratory+syncytial+virus+from+cloned+cDNA+confirms+an+essential+role+for+the+transcription+elongation+factor+from+the+5'+proximal+open+reading+frame+of+the+M2+mRNA+in+gene+expression+and+provides+a+capability+for+vaccine.">Production of infectious human respiratory syncytial virus from cloned cDNA confirms an essential role for the transcription elongation factor from the 5' proximal open reading frame of the M2 mRNA in gene expression and provides a capability for vaccine.</a> Proceedings of the National Academy of Sciences of the United States of America. 92 (25), 11563-11567 (1995).</li><li>Rameix-Welti, M. -. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+the+replication+of+respiratory+syncytial+virus+in+cells+and+in+living+mice.">Visualizing the replication of respiratory syncytial virus in cells and in living mice.</a> Nature Communications. 5, 5104 (2014).</li><li>Buchholz, U. J., Finke, S., Conzelmann, K. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+bovine+respiratory+syncytial+virus+(BRSV)+from+cDNA:+BRSV+NS2+is+not+essential+for+virus+replication+in+tissue+culture,+and+the+human+RSV+leader+region+acts+as+a+functional+BRSV+genome+promoter.">Generation of bovine respiratory syncytial virus (BRSV) from cDNA: BRSV NS2 is not essential for virus replication in tissue culture, and the human RSV leader region acts as a functional BRSV genome promoter.</a> Journal of Virology. 73 (1), 251-259 (1999).</li><li>Cianci, C., Meanwell, N., Krystal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antiviral+activity+and+molecular+mechanism+of+an+orally+active+respiratory+syncytial+virus+fusion+inhibitor.">Antiviral activity and molecular mechanism of an orally active respiratory syncytial virus fusion inhibitor.</a> Journal of Antimicrobial Chemotherapy. 55 (3), 289-292 (2005).</li><li>Derscheid, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+respiratory+syncytial+virus+memphis+37+grown+in+HEp-2+cells+causes+more+severe+disease+in+lambs+than+virus+grown+in+vero+cells.">Human respiratory syncytial virus memphis 37 grown in HEp-2 cells causes more severe disease in lambs than virus grown in vero cells.</a> Viruses. 5 (11), 2881-2897 (2013).</li><li>McKimm-Breschkin, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simplified+plaque+assay+for+respiratory+syncytial+virus+-+direct+visualization+of+plaques+without+immunostaining.">A simplified plaque assay for respiratory syncytial virus - direct visualization of plaques without immunostaining.</a> Journal of Virological Methods. 120, 113-117 (2004).</li><li>Matrosovich, M., Matrosovich, T., Garten, W., Klenk, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+low-viscosity+overlay+medium+for+viral+plaque+assays.">New low-viscosity overlay medium for viral plaque assays.</a> Virology Journal. 7, 1-7 (2006).</li><li>Novina, C. D., Sharp, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RNAi+revolution.">The RNAi revolution.</a> Nature. 430 (6996), 161-164 (2004).</li><li>Sintchak, M. D., Nimmesgern, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+structure+of+inosine+5'-monophosphate+dehydrogenase+and+the+design+of+novel+inhibitors.">The structure of inosine 5'-monophosphate dehydrogenase and the design of novel inhibitors.</a> Immunopharmacology. 47 (2-3), 163-184 (2000).</li><li>Beaucourt, S., Vignuzzi, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribavirin:+A+drug+active+against+many+viruses+with+multiple+effects+on+virus+replication+and+propagation.+Molecular+basis+of+ribavirin+resistance.">Ribavirin: A drug active against many viruses with multiple effects on virus replication and propagation. Molecular basis of ribavirin resistance.</a> Current Opinion in Virology. 8, 10-15 (2014).</li><li>Hruska, J. F., Bernstein, J. M., Douglas, R. G., Hall, C. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+Ribavirin+on+Respiratory+Syncytial+Virus+in+vitro.">Effects of Ribavirin on Respiratory Syncytial Virus in vitro.</a> Antimicrobial Agents and Chemotherapy. 17 (5), 770-775 (1980).</li><li>Sim&#245;es, E. A. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Past,+Present+and+Future+Approaches+to+the+Prevention+and+Treatment+of+Respiratory+Syncytial+Virus+Infection+in+Children.">Past, Present and Future Approaches to the Prevention and Treatment of Respiratory Syncytial Virus Infection in Children.</a> Infectious Diseases and Therapy. 7 (1), 87-120 (2018).</li><li>Alvarez, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference-mediated+silencing+of+the+respiratory+syncytial+virus+nucleocapsid+defines+a+potent+antiviral+strategy.">RNA interference-mediated silencing of the respiratory syncytial virus nucleocapsid defines a potent antiviral strategy.</a> Antimicrobial Agents and Chemotherapy. 53 (9), 3952-3962 (2009).</li><li>DeVincenzo, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+randomized,+double-blind,+placebo-comtrolled+study+of+an+RNAi-based+therapy+directed+against+respiratory+syncytial+virus.">A randomized, double-blind, placebo-comtrolled study of an RNAi-based therapy directed against respiratory syncytial virus.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (19), 8800-8805 (2010).</li><li>Zhou, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+screening+of+a+CRISPR/Cas9+library+for+functional+genomics+in+human+cells.">High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells.</a> Nature. 509 (7501), 487-491 (2014).</li><li>Nikolic, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Negri+bodies+are+viral+factories+with+properties+of+liquid+organelles.">Negri bodies are viral factories with properties of liquid organelles.</a> Nature Communications. 8 (1), 58 (2017).</li></ol>

Here we present a method of rescue of recombinant RSVs from five plasmids, and their amplification. The ability to manipulate the genome of viruses has revolutionized virology research to test mutations and express an additional gene or a tagged viral protein. The RSV we have described and used as an example in this article is a virus expressing a reporter gene, the RSV-GFP (unpublished), and expresses an M2-1 protein fused to a GFP tag12. RSV rescue is challenging and requires practice. The trans...

Human RSV is the leading cause of hospitalization for acute respiratory tract infection in infants worldwide1. In addition, RSV is associated with a substantial disease burden in adults comparable to influenza, with most of the hospitalization and mortality burden in the elderly2. There are no vaccines or specific antivirals available yet against RSV, but promising new drugs are in development3,4. The complexity and the heaviness of the techniques of quantification of RSV multiplication impede the search for antivirals or vaccines despite current considerable efforts. The quantification of RSV multiplication in vitro is generally based on laborious, time-consuming, and expensive methods, which consist mostly in the analysis of the cytopathic effect by microscopy, immunostaining, plaque reduction assays, quantitative reverse transcriptase (qRT)-polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay tests. Viruses with modified genomes and expressing reporter genes, such as those coding for the GFP, are more suitable for such screenings. Coupled to the use of automated plate readers, reporter gene-carrying recombinant viruses can make these assays more suitable for standardization and high-throughput purposes.
RSV is an enveloped, nonsegmented negative-sense RNA virus that belongs to the Orthopneumovirus genus of the Pneumoviridae family, order Mononegavirales5. The RSV genome is a single-strand, negative-sense RNA of about 15 kb, which contains a noncoding region at the 3&#39; and 5&#39; extremities called Leader and Trailer and 10 transcriptional units encoding 11 proteins. The genes are ordered as follows: 3&#39;-NS1, NS2, N, P, M, SH, G, F, M2 (encoding for M2-1 and M2-2 proteins) and L-5&#39;. The genomic RNA is tightly packaged by the nucleoprotein N. Using the encapsidated genomic RNA as a template, viral RNA-dependent RNA polymerase (RdRp) will ensure transcription and replication of the viral RNA. Viral RdRp is composed of the large protein L which carries the nucleotide polymerase activity per se, its mandatory cofactor the phosphoprotein P and the M2-1 protein which functions as a viral transcription factor6. In infected cells, RSV induces the formation of cytoplasmic inclusions called inclusion bodies (IBs). Morphologically similar cytoplasmic inclusions have been observed for several Mononegavirales7,8,9,10. Recent studies on rabies virus, vesicular stomatitis virus (VSV), Ebola virus, and RSV showed that viral RNA synthesis occurs in IBs, which can thus be regarded as viral factories8,9,11,12. The virus factories concentrate the RNA and viral proteins required for viral RNA synthesis and also contain cellular proteins13,14,15,16,17. IBs exhibit a functional subcompartment called IB-associated granules (IBAGs), which concentrate the newly synthetized nascent viral mRNA together with the M2-1 protein. The genomic RNA and the L, P, and N are not detected in IBAGs. IBAGs are small dynamic spherical structures inside IBs that exhibit the properties of liquid organelles12. Despite the central role of IBs in viral multiplication, very little is known about the nature, internal structure, formation, and operation of these viral factories.
The expression of the genome of a poliovirus from a cDNA enabled the production of the first infectious viral clone in 198118. For single-stranded negative RNA viruses, it was not until 1994 that the production of a first rabies virus following transfection of plasmids into cells19 took place. The first plasmid-based reverse genetic system for RSV was published in 199520. Reverse genetics have led to major advances in the field of virology. The possibility of introducing specific modifications into the viral genome has provided critical insights into the replication and pathogenesis of RNA viruses. This technology has also greatly facilitated the development of vaccines by allowing specific attenuation through targeted series of modifications. Genome modifications allowing a rapid quantification of viral multiplication greatly improved the antiviral screening and study of their mode of action.
Although previously described, obtaining genetically modified RSVs remains delicate. Here, we detail a protocol to create two types of recombinant HRSV, respectively expressing RSV-GFP or RSV-M2-1-GFP. In this protocol, we describe the transfection conditions needed to rescue the new recombinant viruses, as well as their amplification to obtain viral stocks with high titer, suitable for reproducible experimentations. The construction of the reverse genetics&#39; vectors per se is not described here. We do describe methods for the optimal harvesting and freezing of viral stocks. The most accurate method to quantify viral infectious particles remains plaque assay. Cells are infected with serial dilutions of the analyzed suspension and incubated with an overlay that prohibits the diffusion of free viral particles in the supernatant. In such conditions, the virus will only infect contiguous cells forming a &#34;plaque&#34; for each initial infectious particle. In the conventional RSV titration assay, plaques are revealed by immunostaining and counted under microscopic observation. This method is expensive and time-consuming. Here we described a very simple protocol for an RSV plaque assay using microcrystalline cellulose overlay that enables the formation of plaques visible to the naked eye. We show how RSV-GFP can be used to measure RSV replication and, thus, to quantify the impact of antivirals. Combining reverse genetics and live imaging technology, we demonstrate how RSV-M2-1-GFP allows scientists to visualize M2-1 in live cells and to follow the dynamics of intracellular viral structures, such as IBs.

<table>
	<tbody>
		<tr>
			<td>35mm &#181; dish for live cell imaging</td>
			<td>Ibidi</td>
			<td>81156</td>
			<td></td>
		</tr>
		<tr>
			<td>A549</td>
			<td>ATCC</td>
			<td>ATCC CCL-185</td>
			<td></td>
		</tr>
		<tr>
			<td>Avicel RC-591</td>
			<td>FMC BioPolymer</td>
			<td>Avicel RC-591</td>
			<td>Technical and other information on Avicels is available at http://www.fmcbiopolymer.com. Store at room temperature. Protocol in step 4 is optimized for this reagent.</td>
		</tr>
		<tr>
			<td>BSRT7/5</td>
			<td></td>
			<td>not commercially available</td>
			<td>See ref 22. Buchholz et al, 1999</td>
		</tr>
		<tr>
			<td>Crystal violet solution</td>
			<td>Sigma</td>
			<td>HT90132</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence microscope for observations</td>
			<td>Olympus</td>
			<td>IX73 Olympus microscope</td>
			<td></td>
		</tr>
		<tr>
			<td>Fluorescence microscope for videomicroscopy</td>
			<td>Olympus</td>
			<td>ScanR Olympus microscope</td>
			<td></td>
		</tr>
		<tr>
			<td>HEp-2</td>
			<td>ATCC</td>
			<td>ATCC CCL-23</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES &#8805;99.5%</td>
			<td>Sigma</td>
			<td>H3375</td>
			<td></td>
		</tr>
		<tr>
			<td>L-Glutamine (200 mM)</td>
			<td>ThermoFisher Scientific</td>
			<td>25030024</td>
			<td></td>
		</tr>
		<tr>
			<td>LIPOFECTAMINE 2000 REAGENT</td>
			<td>ThermoFisher Scientific</td>
			<td>11668019</td>
			<td>Protocol in step 2.3. is optimized for this reagent.</td>
		</tr>
		<tr>
			<td>MEM (10X), no glutamine</td>
			<td>ThermoFisher Scientific</td>
			<td>11430030</td>
			<td></td>
		</tr>
		<tr>
			<td>MEM, GlutaMAX Supplement</td>
			<td>ThermoFisher Scientific</td>
			<td>41090-028</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4 ReagentPlus, &#8805;99.5%</td>
			<td>Sigma</td>
			<td>M7506</td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM I Reduced Serum Medium</td>
			<td>ThermoFisher Scientific</td>
			<td>51985-026</td>
			<td></td>
		</tr>
		<tr>
			<td>Paraformaldehyde Aqueous Solution, 32%, EM Grade</td>
			<td>Electron Microscopy Sciences</td>
			<td>15714</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin-Streptomycin (10,000 U/mL)</td>
			<td>ThermoFisher Scientific</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>Plasmids</td>
			<td></td>
			<td>not commercially available</td>
			<td>see ref 21. Rameix-Welti et al, 2014</td>
		</tr>
		<tr>
			<td>See Saw Rocker</td>
			<td>VWR</td>
			<td>444-0341</td>
			<td></td>
		</tr>
		<tr>
			<td>Si RNA GAPDH</td>
			<td>Dharmacon</td>
			<td>ON-TARGETplus siRNA 
			D-001810-10-05</td>
			<td>SMARTpool and 3 of 4 individual siRNAs designed by Dharmacon.</td>
		</tr>
		<tr>
			<td>Si RNA IMPDH2</td>
			<td>Dharmacon</td>
			<td>ON-TARGETplus siRNA IMPDH2 Pool- Human 
			L-004330-00-0005</td>
			<td>SMARTpool of 4 individual siRNAs designed by Dharmacon. 
			Individual references and sequences 
			J-004330-06: GGAAAGUUGCCCAUUGUAA; 
			J-004330-07: GCACGGCGCUUUGGUGUUC; 
			J-004330-08: AAGGGUCAAUCCACAAAUU; 
			J-004330-09: GGUAUGGGUUCUCUCGAUG;</td>
		</tr>
		<tr>
			<td>Si RNA RSV N</td>
			<td>Dharmacon</td>
			<td>ON-TARGETplus custom siRNA</td>
			<td>UUCAGAAGAACUAGAGGCUAU and UUUCAUAAAUUCACUGGGUUA</td>
		</tr>
		<tr>
			<td>SiRNA NT</td>
			<td>Dharmacon</td>
			<td>ON-TARGETplus Non-targeting Pool</td>
			<td></td>
		</tr>
		<tr>
			<td>SiRNA transfection reagent</td>
			<td>Dharmacon</td>
			<td>DharmaFECT 1 Ref: T-2001-03</td>
			<td>Protocol in steps 5.1.and 5.1.2 are optimized for this reagent.</td>
		</tr>
		<tr>
			<td>Sodium Bicarbonate 7.5% solution</td>
			<td>ThermoFisher Scientific</td>
			<td>25080094</td>
			<td></td>
		</tr>
		<tr>
			<td>Spectrofluorometer</td>
			<td>Tecan</td>
			<td>Tecan infinite M200PRO</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation, amplification, and titration of recombinant respiratory syncytial viruses

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, both to decipher viral replication mechanisms and to study antivirals or provide development platform for vaccines. The construction and manipulation of a reverse genetic system for a negative-strand RNA virus such as a respiratory syncytial virus (RSV), however, remains delicate and requires special know-how. The RSV genome is a single-strand, negative-sense RNA of about 15 kb that serves as a template for both viral RNA replication and transcription. Our reverse genetics system uses a cDNA copy of the human RSV long strain genome (HRSV). This cDNA, as well as cDNAs encoding viral proteins of the polymerase complex (L, P, N, and M2-1), are placed in individual expression vectors under T7 polymerase control sequences. The transfection of these elements in BSR-T7/5 cells, which stably express T7 polymerase, allows the cytoplasmic replication and transcription of the recombinant RSV, giving rise to genetically modified virions. A new RSV, which is present at the cell surface and in the culture supernatant of BSRT7/5, is gathered to infect human HEp-2 cells for viral amplification. Two or three rounds of amplification are needed to obtain viral stocks containing 1 x 106 to 1 x 107 plaque-forming units (PFU)/mL. Methods for the optimal harvesting, freezing, and titration of viral stocks are described here in detail. We illustrate the protocol presented here by creating two recombinant viruses respectively expressing free green fluorescent protein (GFP) (RSV-GFP) or viral M2-1 fused to GFP (RSV-M2-1-GFP). We show how to use RSV-GFP to quantify RSV replication and the RSV-M2-1-GFP to visualize viral structures, as well as viral protein dynamics in live cells, by using video microscopy techniques.

In this work, we described a detailed protocol to produce recombinant RSV viruses expressing a fluorescent protein (Figure 2). In pRSV-GFP, the GFP gene was introduced between the P and M genes, as described for the Cherry gene in previously published work21. In the pRSV-M2-1-GFP, the M2 gene was left untouched and an additional gene coding for M2-1-GFP was inserted between SH and G genes12. The first step, corr...

Watch this Scientific Journal Video about Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses at JoVE.com

Generation, Amplification, and Titration of Recombinant Respiratory Syncytial Viruses

We describe a method for generating and amplifying genetically modified respiratory syncytial viruses (RSVs) and an optimized plaque assay for RSVs. We illustrate this protocol by creating two recombinant viruses that respectively allow quantification of RSV replication and live analysis of RSV inclusion bodies and inclusion bodies-associated granules dynamics.

The use of recombinant viruses has become crucial in basic or applied virology. Reverse genetics has been proven to be an extremely powerful technology, ...

Research

JoVE Journal

Immunology and Infection

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Production and Titering of Recombinant Adeno-associated Viral Vectors

In recent years recombinant adeno-associated viral vectors (AAV) have become increasingly valuable for in vivo studies in animals, and are also currently ...

Protein Misfolding Cyclic Amplification of Prions

Prions  are infectious agents that cause the inevitably fatal transmissible spongiform  encephalopathy (TSE) in animals and humans9,18. The prion protein ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Generation of Recombinant Arenavirus for Vaccine Development in FDA-Approved Vero Cells

The development and implementation of arenavirus reverse genetics represents a significant breakthrough in the arenavirus field  4. The use of cell-based ...

An In vitro Model to Study Immune Responses of Human Peripheral Blood Mononuclear Cells to Human Respiratory Syncytial Virus Infection

An In vitro Model to Study Immune Responses of Human Peripheral Blood Mononuclear Cells to Human Respiratory Syncytial Virus Infection

Human respiratory syncytial  virus (HRSV) infections present a broad spectrum of disease severity, ranging  from mild infections to life-threatening ...

Demonstrating a Multi-drug Resistant Mycobacterium tuberculosis Amplification Microarray

Demonstrating a Multi-drug Resistant Mycobacterium tuberculosis Amplification Microarray

Simplifying microarray workflow is a necessary first step for creating MDR-TB microarray-based diagnostics that can be routinely used in lower-resource ...

Intranasal Administration of Recombinant Influenza Vaccines in Chimeric Mouse Models to Study Mucosal Immunity

Vaccines are one of the greatest achievements of mankind, and have saved millions of lives over the last century. Paradoxically, little is known about the ...