Name: hox loci focused crispr/sgrna library screening identifying critical ctcf boundaries
Uploaded: 2019-03-31T14:00:00.000+00:00
Duration: 10 min 10 s
Description: Watch this Scientific Journal Video about HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries at JoVE.com

The authors also thank Nicholas Cesari for editing the manuscript. The work was supported by grants from National Institute of Health (S.H., R01DK110108, R01CA204044).

&#8203;1. CTCF sgRNALibrary Design Using an Online Tool
<ol>
	<li>Design the sgRNA targeting CTCF binding sites in the human HOX loci using the genetic perturbation platform (GPP) designer tool (https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design).</li>
	<li>Synthesize a total of 1,070 sgRNAs consisting of sgRNAs targeting 303 random targeting genes, 60 positive controls, 500 non-Human-targeting controls, and 207 CTCF elements or lncRNA targeting genes (Figure 1, Table 1). Each targeting DNA element is targeted by 5-10 different sgRNAs.</li>
</ol>
2. sgRNA Library Cloning
<ol>
	<li>Clone the synthesized oligonucleotides into the CRISPR lentiviral backbone vector (lentiCRISPRv2).
	<ol>
		<li>Digest the LentiCRISPRv2 vector with BsmBI restriction enzyme at 37 &#176;C for 2 h.</li>
		<li>Look for the presence of the larger band (around 12,873 bp) on the gel after BsmBI digestion, and then purify it with the gel extraction kit. 
		NOTE: A 2kb small filler piece is also present on the gel after digestion, but this should be ignored.</li>
		<li>Ligate the synthesized oligonucleotides and digested LentiCRISPR vector with 150 ng of digested LentiCRISPR DNA, 1 &#181;L of 10 &#181;M oligos, 2 &#181;L of 10x T4 ligase buffer, 1 &#181;L of T4 ligase, and then incubate them at 16 &#176;C overnight.</li>
	</ol>
	</li>
	<li>Transform the lentiviral CRISPR/sgRNA library into electro-competent cells for amplification.
	<ol>
		<li>Prepare the electroporator at 1.8 kV, 200 &#937; and 25 &#181;F. Then pre-warm the recovery SOC media in a 37 &#176;C water bath, and pre-warm LB ampicillin antibiotic plates at 37 &#176;C.</li>
		<li>Thaw the competent cells on ice for 10 min.</li>
		<li>Prepare 1.5 mL micro-centrifuge tubes and 1 mm electroporation cuvettes on ice.</li>
		<li>Mix 1 &#181;L of a 10 ng/&#181;L library plasmid DNA into 25 &#181;L of competent cells in a 1.5 mL micro-centrifuge tube, and gently mix by flicking the bottom of the tube a few times manually.</li>
		<li>Once the cuvette is cold enough, transfer the DNA/competent cell mixture to it. Tap twice on the countertop and wipe any water droplets from the exterior of cuvette with a tissue paper. Then place the cuvette in the electroporation module and press pulse.</li>
		<li>Immediately add 975 &#181;L of 37 &#176;C pre-warmed SOC media. Mix by pipetting up and down and transfer to a 15 mL tube.</li>
		<li>Rotate and incubate at 37 &#176;C for 1 h.</li>
		<li>Dilute 100 &#181;L cells into 900 &#181;L of SOC media and place 100 &#181;L on a LB ampicillin antibiotic agar plate. Incubate overnight at 37 &#176;C.</li>
	</ol>
	</li>
	<li>Extract the plasmid DNA from the combined colonies using a maxi-prep column as detailed in the manufacturer&#39;s protocol.
	<ol>
		<li>Scrape all the colonies from the LB agar plate and inoculate a starter culture of 2 mL of LB ampicillin antibiotic medium and incubate overnight at 37 &#176;C with vigorous shaking (~200 x g).</li>
		<li>Dilute the starter culture 1:500 into 100 mL of LB ampicillin medium and incubate at 37 &#176;C for 12-16 h with vigorous shaking (~200 x g).</li>
		<li>Harvest the bacterial cell pellet by centrifugation at 6,000 x g for 15 min at 4 &#176;C.</li>
		<li>Re-suspend the bacterial pellet in 10 mL of suspension buffer.</li>
		<li>Lyse the suspended pellet with 10 mL of the lysis buffer, and vigorously invert 4-6 times. Incubate the lysate for 5 min at room temperature.</li>
		<li>Neutralize the lysate with 10 mL of chilled Neutralization Buffer. Mix by gently inverting the tubes 4-6 times and incubate it for 20 min on ice.</li>
		<li>Spin down at 13,500 x g for 30 min at 4 &#176;C. Promptly transfer the supernatant containing the plasmid DNA to a new tube.</li>
		<li>Repeat step 2.3.7, and promptly transfer the supernatant containing the plasmid DNA to a new tube.</li>
		<li>Equilibrate the column by applying 10 mL of equilibration buffer and allow the column to empty by gravity flow.</li>
		<li>Add the supernatant to the column and allow it to enter the resin by gravity flow.</li>
		<li>Wash the column with 2x 30 mL of washing buffer.</li>
		<li>Elute the DNA with 15 mL of elution buffer.</li>
		<li>Precipitate the DNA with 10.5 mL of room-temperature isopropanol to the eluted DNA. Mix and spin down immediately at 15,000 x g for 30 min at 4 &#176;C, and gently decant the supernatant.</li>
		<li>Wash the DNA pellet with 5 mL of 70% ethanol, centrifuge DNA pellet at 15,000 x g for 10 min and discard the clear supernatant.</li>
		<li>Repeat step 2.5.14 twice more.</li>
		<li>Centrifuge DNA pellet at 15,000 x g for 10 min, and gently decant the supernatant without disturbing the DNA pellet.</li>
		<li>Air-dry the pellet for 5-10 min, and dissolve the DNA in a required volume of buffer (TE buffer, pH 8.0).</li>
	</ol>
	</li>
</ol>
3. The High Titer sgRNA Library Lentivirus Generation
<ol>
	<li>Cell preparation: Culture HEK293T cells in Dulbecco&#39;s Modified Eagle Medium (DMEM) supplemented with 10% (vol/vol) fetal bovine serum (FBS) and 1% (vol/vol) penicillin-streptomycin (PS) antibiotic in T-25 flasks. Place them in the incubator at 37 &#176;C and 5% CO2.</li>
	<li>Package lentivirus: Co-transfect HEK293T cells with 20 &#181;g of purified library vectors from step 2, 15 &#181;g of the package plasmid (psPAX2) and 10 &#181;g of the envelope plasmid (pMD2.G) for 48 h before harvesting the viruses.</li>
	<li>Virus collection: After 48 h, collectthe virus supernatant and filter the virus supernatant through a 0.45 &#181;m low protein binding PVDF membrane.</li>
	<li>Virus concentration: Concentrate the lentiviral supernatant by 50-fold using the concentrator and test the virus MOI in step 5.</li>
	<li>Virus storage: Aliquot the concentrated viruses and store in a -80 &#176;C freezer.</li>
</ol>
4. Optimized Puromycin Concentration
<ol>
	<li>Leukemia cell culture: Culture MOLM13 AML cells in RPMI 1640 supplemented with 10% (vol/vol) fetal bovine serum (FBS) and 1x penicillin-streptomycin (PS) antibiotics in a T-125 flask. Place them in an incubator at 37 &#176;C and 5% CO2. 
	NOTE: Cells are typically passed every 4-5 d at a split ratio of 1:4 or 1:6, never allowing cells to reach more than 70% confluency.</li>
	<li>Set up MOLM13 cells in a 12-well plate with a density of 1.0 x 104 cell/mL, at a total volume of 2 mL per well (2.0 x 104 cells).</li>
	<li>Time-course assay: Treat MOLM13 cells with puromycin for 7 days in increasing concentrations (0.1 &#181;g/mL, 0.2 &#181;g/mL, 0.5 &#181;g/mL, 1.0 &#181;g/mL and 2.0 &#181;g/mL)
	<ol>
		<li>Set up MOLM13 cells without puromycin treatment on day 0 and set up 3 replicate wells without puromycin treatment as a control from day 0 to day 7.</li>
		<li>Treat MOLM13 cells with 0.1 &#181;g/mL, 0.2 &#181;g/mL, 0.5 &#181;g/mL, 1.0 &#181;g/mL and 2.0 &#181;g/mL, separately, with each experimental condition containing 3 replicate wells.</li>
		<li>Count the live cell ratio and make a survival curve from day 0 to day 7 containing all conditions.</li>
	</ol>
	</li>
	<li>Survival curve: Stain cells with Trypan blue and count viability daily to obtain the survival curves for each puromycin concentration.</li>
	<li>Optimizing minimal puromycin concentration: Determine the minimal puromycin concentration through Trypan blue staining, in which all MOLM13 cells are killed between 5-7 days.</li>
</ol>
5. Titration of Lentiviral Library in MOLM13 Leukemia Cells
<ol>
	<li>AML cells preparation: Collect MOLM13 AML cells with the transduction medium (RPMI 1640, 10% FBS, 1% PS, and 8.0 &#181;g/mL coating medium) at a density of 1.5 x 106 cells /mL.</li>
	<li>Place MOLM13 cells in the 12-well plate with 1.5 x 106 cells in each well.</li>
	<li>Thaw the lentivirus: Remove the concentrated lentivirus from the -80 &#176;C freezer and thaw it on ice.</li>
	<li>Mix MOLM13 cells with a different dose of the concentrated lentivirus in separate wells, including 0, 1, 2.5, 5, 7.5 and 10 &#181;L (total 6 groups).</li>
	<li>Immediately centrifuge these mixtures at 1,000 x g for 2 h at 33 &#176;C and transfer the 12-well plates back to the incubator at 37 &#176;C and 5% CO2 for 4 h.</li>
	<li>After 4 h, spin down the infected cells at 400 x g for 5 min at room temperature.</li>
	<li>Gently aspirate the supernatant without disturbing the cell pellet, and re-suspend the transduced cells with fresh media (RPMI 1640, 10% FBS and 1% PS), and then transfer them to T-25 flasks and incubate at 37 &#176;C for 48 h without puromycin.</li>
	<li>After 48 h, split these cells into 2 flasks (2 groups): an experimental group treated with 1 &#181;g/mL puromycin for 5 days, and a control group without puromycin treatment for 5 days.</li>
	<li>Carry out puromycin selection for 5 days with 1 &#181;g/mL puromycin according to the step 4 until all the non-transduced control cells are dead. Exchange for fresh media every 2 days.</li>
	<li>Measure the optimized MOI value for transduction by dividing the number of live cells treated with puromycin with the number of cells without puromycin treatment.</li>
</ol>
6. Transduction of the Pooled CRISPR-Cas9 KO Library
<ol>
	<li>Transduction with lentivirus: Infect 1.5 x 106 MOLM13 cells with 0.3 MOI of sgRNA pooled lentivirus in medium (RPMI 1640, 10% FBS, 1% PS, and 8 &#181;g/mL coating medium) in 6-well plate and use the cells without the lentivirus infection as a control.</li>
	<li>Immediately centrifuge the 6-well plate at 1,000 x g for 2 h at 33 &#176;C to spinfect the cells and transfer the plates back to the incubator at 37 &#176;C and 5% CO2 for 4 h.</li>
	<li>Spin down the infected cells at 400 x g for 5 min at room temperature.</li>
	<li>Gently aspirate supernatant without disturbing the cell pellet, and re-suspend the transduced cells with fresh media (RPMI 1640, 10% FBS and 1% PS), and then transfer them to T-25 flasks and incubate at 37 &#176;C for 48 h without puromycin.</li>
	<li>After 48 h, treat cells with 1 &#181;g/mL puromycin for 5 days. Exchange for fresh media after 2 days and keep at an optimal cell density.</li>
	<li>Seed the single clone in 96-well plates with limiting dilution methods and incubate these single clones at 37 &#176;C and 5% CO2. Culture them for 3-4 weeks.</li>
	<li>After a single cell grows up into a population, transfer half of the cells into 24-well plates for further culture under puromycin selection and verify these clones in the next step. Keep the rest of the cells.</li>
</ol>
7. Screening of the Pooled CRISPR-Cas9 KO Library with One-step RT-qPCR
<ol>
	<li>Determine the effectiveness of the sgRNA integrated clone screening by evaluating the expression of the marker gene HOXA9 with one step reverse-transcriptase polymerase chain reaction (one-step RT-qPCR). 
	NOTE: HOXA9 are highly expressed in MOLM13 AML cells in leukemogenesis22,23.</li>
	<li>Count the sgRNA integrated MOLM13 cell and transfer 1 x 104 cells per well to a 96-well PCR plate.</li>
	<li>Centrifuge the tube at 1,000 x g for 5 min, and then thoroughly remove and discard the supernatant with a pipet without disturbing the cell pellet.</li>
	<li>Wash cells with 125 &#181;L of PBS buffer, and centrifuge the tube at 1,000 x g for 5 min. Then remove 120 &#181;L of the supernatant using a pipette and retain approximately 5 &#181;L of PBS in each well.</li>
	<li>Add 50 &#181;L of the cell lysis master mix containing 48 &#181;L of cell lysis buffer, 1 &#181;L of proteinase K solution (10 mg/mL) and 1 &#181;L of DNase solution (1 mg/mL) to each well. Then pipet up and down 5 times to re-suspend the cell pellet.</li>
	<li>Incubate the mix for 10 min at room temperature, followed by 5 min at 37 &#176;C, and then 75 &#176;C for 5 min.</li>
	<li>Store the cell lysate at -80 &#176;C freezer.</li>
	<li>The preparation of one-step RT-qPCR reaction: Thaw the one-step reaction mix and other reaction components to 4 &#176;C. Then spin down briefly to collect solutions at the bottom of tubes, and place on ice without light. Mix and spin gently.</li>
	<li>Add 1 &#181;L of cell lysate to the PCR wells with the RT-qPCR reaction mix, including 1 &#181;L of the marker gene&#39;s forward primer (300 nM) and reverse primer (300 nM), 0.125 &#181;L of reverse transcriptase (10 U/&#181;L), and 5 &#181;L of one-step reaction mix (2x).</li>
	<li>Seal wells with optically transparent film, and gently vortex and mix the reaction components.</li>
	<li>Place the 96-well PCR plate on a real-time PCR instrument.</li>
	<li>Run the reverse transcription reaction for 10 min at 50 &#176;C, followed by polymerase inactivation and DNA denaturation for 1 min at 95 &#176;C.</li>
	<li>Perform RT-PCR with 40 cycles of PCR reaction: denaturation for 15 s at 95 &#176;C, annealing/extension and plate fluorescence reading for 20 s at 60 &#176;C, and then melt curve analysis at 65-95 &#176;C via 0.5 &#176;C increments at 2-5 s/step.</li>
	<li>Set up upregulated, downregulated and no change groups according to the expression levels of HOXA9 gene by comparison to the control, separately. Use &#946;-actin gene as a housekeeping gene control.</li>
</ol>
8. Verification of Integrated sgRNAs Positive Clones through Genotyping and Sanger Sequence
<ol>
	<li>Verify the HOXA9 decreased expression clones through Sanger sequencing and perform PCR with 50-100 ng MOLM13 genome DNA, 5 &#181;L polymerase reaction buffer (10x), 1 &#181;L forward primer (10 &#181;M) (AATGGACTATCATATGCTTACCGTAACTTGAAAGTATTTCG) and 1 &#181;L reverse primer (10 &#181;M) (TCTACTATTCTTTCCCCTGCACTGTTGTGGGCGATGTGCGCTCTG), 1 &#181;L dNTP (10mM), 1 unit polymerase (5 U /&#181;L). Perform the PCR reaction with the initial denaturation at 94 &#176;C for 30 s, and then more denaturation at 94 &#176;C for 20 s, annealing at 56 &#176;C for 20 s, extension at 68 &#176;C for 20 s (total 30 cycles), final extension at 68 &#176;C for 10 min, and then holding at 4 &#176;C.</li>
	<li>Extract and purify the PCR products (size 285 bp) with a PCR Purification Kit.</li>
	<li>Ligate the purified PCR products into the T vector with 2 &#181;L T4 ligation buffer (10x), 50 ng T vector DNA (50 ng/&#181;L), 25 ng purified PCR DNA (285 bp), 1 &#181;L T4 ligase (3 units/&#181;L), and place the ligation mix into an incubator at 16 &#176;C overnight.</li>
	<li>Transfer the ligation mix into DH5&#945; competent cell, grow on a LB ampicillin antibiotic agar plate, and incubate overnight at 37 &#176;C.</li>
	<li>Pick the single clones from the LB plate and verify them by genotyping and Sanger sequencing.</li>
</ol>
9. Detection of sgRNAs Induced Indel Mutation by Nuclease Digestion Assay
<ol>
	<li>Detect the sgRNA integrated single clone induced Indel rates by a nuclease test assay.</li>
	<li>Separately prepare PCR amplicons with 50-100 ng Indel mutant (test) and wild-type (WT, reference) DNA as PCR template, 5 &#181;L polymerase reaction buffer (10x), 1 &#181;L dNTP (10mM), 1 unit polymerase (5 U/&#181;L), 1 &#181;L forward primer (10 &#181;M)( 5&#39;-GAGATGGCGGCGCGGAAG-3&#39;), and 1 &#181;L reverse primer (10 &#181;M) (5&#39;-AAATATAGGGCGGCTGTTCACT-3&#39;). The PCR reaction was performed with initial denaturation at 98 &#176;C for 30 s, and then denaturation at 98 &#176;C for 20 s, annealing at 56 &#176;C for 20 s, extension at 72 &#176;C for 30 s (total 30 cycles), and final extension at 72 &#176;C for 10 min, and holding at 4 &#176;C.</li>
	<li>Set up the heteroduplex mixture group with 200 ng of the &#34;reference&#34; (20 ng/&#181;L) and 200 ng of &#34;test&#34; (20 ng/&#181;L) PCR amplicons in 0.2 mL PCR tube, and the homoduplex mixture group with only 400 ng of &#34;reference&#34; PCR amplicons as a control.</li>
	<li>Separately incubate the heteroduplex and homoduplex mixture at 95 &#176;C for 5 min in a 1 L beaker filled with 800 mL of water and then cool down gradually to room temperature to anneal and form heteroduplex or homoduplexes.</li>
	<li>Separately digest 400 ng of the annealed heteroduplex and homoduplex mixture with 1 &#181;L indel mutation detection nuclease (2.5 U/&#181;L) and 2 &#181;L nuclease reaction buffer (10x) at 42 &#176;C for 60 min.</li>
	<li>Analyze the digested samples with agarose gel electrophoresis, the heteroduplex mixture DNA should be cut into small fragments (70-250 bp), and the homoduplex DNA (320 bp) should not be cut.</li>
</ol>

<ol>
	<li>Dixon, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Topological+domains+in+mammalian+genomes+identified+by+analysis+of+chromatin+interactions.">Topological domains in mammalian genomes identified by analysis of chromatin interactions.</a> Nature. 485 (7398), 376-380 (2012).</li><li>Cuddapah, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+analysis+of+the+insulator+binding+protein+CTCF+in+chromatin+barrier+regions+reveals+demarcation+of+active+and+repressive+domains.">Global analysis of the insulator binding protein CTCF in chromatin barrier regions reveals demarcation of active and repressive domains.</a> Genome research. 19 (1), 24-32 (2009).</li><li>Phillips, J. E., Corces, V. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF:+master+weaver+of+the+genome.">CTCF: master weaver of the genome.</a> Cell. 137 (7), 1194-1211 (2009).</li><li>Tang, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF-Mediated+Human+3D+Genome+Architecture+Reveals+Chromatin+Topology+for+Transcription.">CTCF-Mediated Human 3D Genome Architecture Reveals Chromatin Topology for Transcription.</a> Cell. 163 (7), 1611-1627 (2015).</li><li>Lupianez, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disruptions+of+topological+chromatin+domains+cause+pathogenic+rewiring+of+gene-enhancer+interactions.">Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions.</a> Cell. 161 (5), 1012-1025 (2015).</li><li>Dowen, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+cell+identity+genes+occurs+in+insulated+neighborhoods+in+mammalian+chromosomes.">Control of cell identity genes occurs in insulated neighborhoods in mammalian chromosomes.</a> Cell. 159 (2), 374-387 (2014).</li><li>Phillips-Cremins, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architectural+protein+subclasses+shape+3D+organization+of+genomes+during+lineage+commitment.">Architectural protein subclasses shape 3D organization of genomes during lineage commitment.</a> Cell. 153 (6), 1281-1295 (2013).</li><li>Narendra, V., Bulajic, M., Dekker, J., Mazzoni, E. O., Reinberg, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF-mediated+topological+boundaries+during+development+foster+appropriate+gene+regulation.">CTCF-mediated topological boundaries during development foster appropriate gene regulation.</a> Genes &amp; Development. 30 (24), 2657-2662 (2016).</li><li>Narendra, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+establishes+discrete+functional+chromatin+domains+at+the+Hox+clusters+during+differentiation.">CTCF establishes discrete functional chromatin domains at the Hox clusters during differentiation.</a> Science. 347 (6225), 1017-1021 (2015).</li><li>Deng, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HoxBlinc+RNA+Recruits+Set1/MLL+Complexes+to+Activate+Hox+Gene+Expression+Patterns+and+Mesoderm+Lineage+Development.">HoxBlinc RNA Recruits Set1/MLL Complexes to Activate Hox Gene Expression Patterns and Mesoderm Lineage Development.</a> Cell Reports. 14 (1), 103-114 (2016).</li><li>Patel, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aberrant+TAL1+activation+is+mediated+by+an+interchromosomal+interaction+in+human+T-cell+acute+lymphoblastic+leukemia.">Aberrant TAL1 activation is mediated by an interchromosomal interaction in human T-cell acute lymphoblastic leukemia.</a> Leukemia. 28 (2), 349-361 (2014).</li><li>Luo, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+boundary+remodels+chromatin+domain+and+drives+aberrant+HOX+gene+transcription+in+acute+myeloid+leukemia.">CTCF boundary remodels chromatin domain and drives aberrant HOX gene transcription in acute myeloid leukemia.</a> Blood. 132 (8), 837-848 (2018).</li><li>Dou, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Medial+HOXA+genes+demarcate+haematopoietic+stem+cell+fate+during+human+development.">Medial HOXA genes demarcate haematopoietic stem cell fate during human development.</a> Nature Cell Biology. 18 (6), 595-606 (2016).</li><li>Lawrence, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+expression+of+the+Hoxa-9+homeobox+gene+impairs+the+proliferation+and+repopulating+ability+of+hematopoietic+stem+cells.">Loss of expression of the Hoxa-9 homeobox gene impairs the proliferation and repopulating ability of hematopoietic stem cells.</a> Blood. 106 (12), 3988-3994 (2005).</li><li>Deng, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=USF1+and+hSET1A+mediated+epigenetic+modifications+regulate+lineage+differentiation+and+HoxB4+transcription.">USF1 and hSET1A mediated epigenetic modifications regulate lineage differentiation and HoxB4 transcription.</a> PLOS Genetics. 9 (6), e1003524 (2013).</li><li>Rawat, V. P., Humphries, R. K., Buske, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Beyond+Hox:+the+role+of+ParaHox+genes+in+normal+and+malignant+hematopoiesis.">Beyond Hox: the role of ParaHox genes in normal and malignant hematopoiesis.</a> Blood. 120 (3), 519-527 (2012).</li><li>Alharbi, R. A., Pettengell, R., Pandha, H. S., Morgan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+HOX+genes+in+normal+hematopoiesis+and+acute+leukemia.">The role of HOX genes in normal hematopoiesis and acute leukemia.</a> Leukemia. 27 (5), 1000-1008 (2013).</li><li>Rice, K. L., Licht, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HOX+deregulation+in+acute+myeloid+leukemia.">HOX deregulation in acute myeloid leukemia.</a> Journal of Clinical Investigation. 117 (4), 865-868 (2007).</li><li>Bassett, A. R., Kong, L., Liu, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genome-wide+CRISPR+library+for+high-throughput+genetic+screening+in+Drosophila+cells.">A genome-wide CRISPR library for high-throughput genetic screening in Drosophila cells.</a> Journal of Genetics and Genomics. 42 (6), 301-309 (2015).</li><li>Zhu, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+deletion+screening+of+human+long+non-coding+RNAs+using+a+paired-guide+RNA+CRISPR-Cas9+library.">Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library.</a> Nature Biotechnology. 34 (12), 1279-1286 (2016).</li><li>Kurata, J. S., Lin, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA-focused+CRISPR-Cas9+library+screen+reveals+fitness-associated+miRNAs.">MicroRNA-focused CRISPR-Cas9 library screen reveals fitness-associated miRNAs.</a> RNA. 24 (7), 966-981 (2018).</li><li>Collins, C. T., Hess, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+HOXA9+in+leukemia:+dysregulation,+cofactors+and+essential+targets.">Role of HOXA9 in leukemia: dysregulation, cofactors and essential targets.</a> Oncogene. 35 (9), 1090-1098 (2016).</li><li>Kroon, E., Thorsteinsdottir, U., Mayotte, N., Nakamura, T., Sauvageau, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NUP98-HOXA9+expression+in+hemopoietic+stem+cells+induces+chronic+and+acute+myeloid+leukemias+in+mice.">NUP98-HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice.</a> The EMBO Journal. 20 (3), 350-361 (2001).</li><li>Koike-Yusa, H., Li, Y., Tan, E. P., Velasco-Herrera Mdel, C., Yusa, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+recessive+genetic+screening+in+mammalian+cells+with+a+lentiviral+CRISPR-guide+RNA+library.">Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library.</a> Nature Biotechnology. 32 (3), 267-273 (2014).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343 (6166), 84-87 (2014).</li><li>Wang, T., Wei, J. J., Sabatini, D. M., Lander, E. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+screens+in+human+cells+using+the+CRISPR-Cas9+system.">Genetic screens in human cells using the CRISPR-Cas9 system.</a> Science. 343 (6166), 80-84 (2014).</li><li>Zhou, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+sgRNAs+facilitate+CRISPR/Cas9-mediated+mouse+genome+targeting.">Dual sgRNAs facilitate CRISPR/Cas9-mediated mouse genome targeting.</a> The FEBS Journal. 281 (7), 1717-1725 (2014).</li><li>Sanjana, N. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+interrogation+of+functional+elements+in+the+noncoding+genome.">High-resolution interrogation of functional elements in the noncoding genome.</a> Science. 353 (6307), 1545-1549 (2016).</li><li>Rajagopal, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+mapping+of+regulatory+DNA.">High-throughput mapping of regulatory DNA.</a> Nature Biotechnology. 34 (2), 167-174 (2016).</li><li>Korkmaz, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genetic+screens+for+enhancer+elements+in+the+human+genome+using+CRISPR-Cas9.">Functional genetic screens for enhancer elements in the human genome using CRISPR-Cas9.</a> Nature Biotechnology. 34 (2), 192-198 (2016).</li><li>Rezaei, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FMS-Like+Tyrosine+Kinase+3+(FLT3)+and+Nucleophosmin+1+(NPM1)+in+Iranian+Adult+Acute+Myeloid+Leukemia+Patients+with+Normal+Karyotypes:+Mutation+Status+and+Clinical+and+Laboratory+Characteristics.">FMS-Like Tyrosine Kinase 3 (FLT3) and Nucleophosmin 1 (NPM1) in Iranian Adult Acute Myeloid Leukemia Patients with Normal Karyotypes: Mutation Status and Clinical and Laboratory Characteristics.</a> Turkish Journal of Haematology. 34 (4), 300-306 (2017).</li><li>Yaragatti, M., Basilico, C., Dailey, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+active+transcriptional+regulatory+modules+by+the+functional+assay+of+DNA+from+nucleosome-free+regions.">Identification of active transcriptional regulatory modules by the functional assay of DNA from nucleosome-free regions.</a> Genome Research. 18 (6), 930-938 (2008).</li><li>Wilken, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNase+I+hypersensitivity+analysis+of+the+mouse+brain+and+retina+identifies+region-specific+regulatory+elements.">DNase I hypersensitivity analysis of the mouse brain and retina identifies region-specific regulatory elements.</a> Epigenetics Chromatin. 8, 8 (2015).</li><li>Narlikar, L., Ovcharenko, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identifying+regulatory+elements+in+eukaryotic+genomes.">Identifying regulatory elements in eukaryotic genomes.</a> Briefings in Functional Genomics and Proteomics. 8 (4), 215-230 (2009).</li><li>Hnisz, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+proto-oncogenes+by+disruption+of+chromosome+neighborhoods.">Activation of proto-oncogenes by disruption of chromosome neighborhoods.</a> Science. 351 (6280), 1454-1458 (2016).</li></ol>

We have no conflicts of interest related to this report.

Protein-coding gene related sgRNA libraries have been applied in a functional screening system to identifying genes and networks regulating specific cellular functions through sgRNA enrichment24,25,26,27,28. Several non-coding region related sgRNA libraries were also shown in gene-specific functional screens for distal and proximal regulating elements, includi...

Recent genome interaction studies revealed that the human nuclear genome forms stable topologically associating domains (TADs) that are conserved across cell types and species. The organization of the genome into separate domains facilitates and restricts interactions between regulatory elements (e.g., enhancers and promoters). The CCCTC-binding factor (CTCF) binds to TAD boundaries and plays a critical role in constraining interactions of DNA elements that are located in neighboring TADs1. However, genome wide CTCF binding data revealed that although CTCF mostly interacts with the same DNA-sites in different cell types, it often functions as a chromatin barrier at a specific site in one cell type but not in the other, suggesting that CTCF functions together with other activities in the formation of chromatin boundaries2. What remains unknown is whether the boundary elements (CTCF-binding sites) are directly linked to the biological function of CTCF, and how these links occur. Therefore, we hypothesize that specific CTCF binding sites in the genome directly regulate the formation of TADs and control promoter/enhancer interactions within these domains or between neighboring domains. The completion of the human and mouse genome sequencing projects and subsequent epigenetic analyses have uncovered new molecular and genetic signatures of the genome. However, the role of specific signatures/modifications in gene regulation and cellular function, as well as their molecular mechanism(s), have yet to be fully understood.
Multiple lines of evidence support that the CTCF-mediated TADs represent functional chromatin domains3,4,5. Although CTCF mostly interacts with the same DNA-sites in different cell types, genome wide CTCF ChIP-seq data revealed that CTCF often functions as a chromatin barrier in one cell type but not in the other2. CTCF plays an essential role during development by mediating genome organization4,6,7. Disruption of CTCF boundaries impaired enhancer/promoter interactions and gene expression, leading to developmental blockage. This suggests that CTCF mediated TADs are not only structural components, but also regulatory units required for proper enhancer action and gene transcription5,8,9.
HOX genes play critical roles during embryonic development and they are temporally and spatially restricted in their expression patterns. The HOXA locus forms two stable TADs separating anterior and posterior genes by a CTCF-associated boundary element in both hESCs and IMR90 cells1. Recent reports demonstrated that HoxBlinc, a HoxB locus associated lncRNA, mediates the formation of CTCF directed TADs and enhancer/promoter interactions in the HOXB locus. This leads to anterior HOXB gene activation during ESC commitment and differentiation10. Furthermore, at specific gene loci including the HOXA locus, alteration of CTCF mediated TAD domains changed lineage specific gene expression profiles and was associated with the development of disease states11,12. The evidence supports a primary function for CTCF in coordinating gene transcription and determining cell identity by organizing the genome into functional domains.
Despite its role in the embryonic development, during hematopoiesis, HOX genes regulate hematopoietic stem and progenitor cell (HS/PC) function. This is done by controlling the balance between proliferation and differentiation10,13,14,15. The expression of HOX genes is tightly regulated throughout the specification and differentiation of hematopoietic cells, with highest expression in HS/PCs. HOX gene expression gradually decreases during maturation, with its lowest levels occurring in differentiated hematopoietic cells16. HOX gene dysregulation is a dominant mechanism of leukemic transformation by dysregulating self-renewal and differentiation properties of HS/PCs leading to leukemic transformation17,18. However, the mechanism of establishing and maintaining normal vs. oncogenic expression patterns of HOX genes as well as associated regulatory networks remains unclear.
CRISPR-Cas9 sgRNA library screening has been widely used to interrogate protein-coding genes19 as well as non-coding genes, such as lncRNA20 and miRNA21 in different species. However, the cost to use the CRISPR-Cas9 sgRNA library to identify new genomic targets remains high, because high-throughput genome sequencing is often applied to verify the sgRNA library screening. Our sgRNA screening system is focused on the specific genome loci and evaluates the targeting sgRNAs through one-step RT-PCR according to the marker gene expression, such as HOXA9. Additionally, Sanger sequencing confirmed that the sgRNA was integrated into the genome, and Indel mutations can be detected to identify the sgRNA targeting site. Through the loci-specific CRISPR-Cas9 genetic screening, the CBS7/9 chromatin boundary has been identified as a critical regulator for establishing oncogenic chromatin domain and maintaining ectopic HOX gene expression patterns in AML pathogenesis12. The method can be widely applied to identify not only specific function of CTCF boundary in embryonic development, hematopoiesis, leukemogenesis, but also CTCF boundary as potential therapeutic targets for future epigenetic therapy.

<table><tbody><tr><td>Lipofectamine 3000 reagent</td><td>Thermo Fisher Scientific</td><td>L3000-008</td><td></td></tr><tr><td>Proteinase K</td><td>Thermo Fisher Scientific</td><td>25530049</td><td></td></tr><tr><td>Puromycin</td><td>Thermo Fisher Scientific</td><td>A1113802</td><td></td></tr><tr><td>Stbl3 cells&amp;nbsp;</td><td>Life Technologies</td><td>&amp;nbsp;C737303</td><td></td></tr><tr><td>HEK293T</td><td>ATCC</td><td>CRL-3216</td><td></td></tr><tr><td>MOLM-13</td><td>DSMZ</td><td>ACC 554</td><td></td></tr><tr><td>lentiCRISPRv2</td><td>Addgene</td><td>52961</td><td></td></tr><tr><td>pMD2.G</td><td>Addgene</td><td>12259</td><td></td></tr><tr><td>psPAX2</td><td>Addgene</td><td>12260</td><td></td></tr><tr><td>pGEM&amp;reg;-T Easy Vector Systems&amp;nbsp;</td><td>Promega</td><td>A137A</td><td></td></tr><tr><td>T4 ligase&amp;nbsp;</td><td>New England Biolabs</td><td>&amp;nbsp;M0202S</td><td></td></tr><tr><td>QIAquick Gel Extract kit</td><td>QIAGEN</td><td>28706</td><td></td></tr><tr><td>QIAuick PCR purification kit</td><td>QIAGEN</td><td>28106</td><td></td></tr><tr><td>SingleShot&amp;trade; SYBR&amp;reg;&amp;nbsp;Green One-Step Kit</td><td>Bio-Rad Laboratories</td><td>1725095</td><td></td></tr><tr><td>QIAGEN Plasmid Maxi Kit</td><td>QIAGEN</td><td>12163</td><td></td></tr><tr><td>Dulbecco&amp;rsquo;s Modified Eagle Medium&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>&amp;nbsp;11965084</td><td></td></tr><tr><td>RPMI 1640&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>11875093</td><td></td></tr><tr><td>Fetal bovine serum (FBS)&amp;nbsp;</td><td>Thermo Fisher Scientific</td><td>10-082-147</td><td></td></tr><tr><td>Penicillin/streptomycin/L-glutamine&amp;nbsp;</td><td>Life Technologies&amp;nbsp;</td><td>10378016</td><td></td></tr><tr><td>Lenti-X Concentrator&amp;nbsp;</td><td>Clontech</td><td>631232</td><td></td></tr><tr><td>Trypan Blue Solution</td><td>Thermo Fisher Scientific</td><td>15250061</td><td></td></tr><tr><td>Polybrene</td><td>Santa Cruz Biotechnology</td><td>sc-134220</td><td></td></tr><tr><td>Phosphate Buffered Saline (PBS)&amp;nbsp;</td><td>Genessee Scientific</td><td>&amp;nbsp;25-507</td><td></td></tr><tr><td>TAE buffer&amp;nbsp;</td><td>Thermo Fisher Scientific&amp;nbsp;</td><td>FERB49</td><td></td></tr><tr><td>Surveyor&amp;reg; Mutation Detection Kits</td><td>Integrated DNA Technologies</td><td>706020</td><td></td></tr><tr><td>Biorad Universal Hood II Gel Doc System</td><td>Bio-Rad</td><td>170-8126</td><td></td></tr><tr><td>Centrifuge 5424 R</td><td>Eppendorf</td><td>5404000138</td><td></td></tr><tr><td>Digital Dry Baths/Block Heaters</td><td>Thermo Fisher Scientific</td><td>88870002</td><td></td></tr><tr><td>TSX Series Ultra-Low Freezers</td><td>Thermo Fisher Scientific</td><td>TSX40086V</td><td></td></tr><tr><td>Forma&amp;trade; Steri-Cult&amp;trade; CO&lt;sub&gt;2&lt;/sub&gt;&amp;nbsp;Incubators</td><td>Thermo Fisher Scientific</td><td>3308</td><td></td></tr><tr><td>Herasafe&amp;trade; KS, Class II Biological Safety Cabinet</td><td>Thermo Fisher Scientific</td><td>51022484</td><td></td></tr><tr><td>Sorvall&amp;trade; Legend&amp;trade; XT/XF Centrifuge Series</td><td>Thermo Fisher Scientific</td><td>75004506</td><td></td></tr><tr><td>Fisherbrand&amp;trade;&amp;nbsp;Isotemp&amp;trade; Water Baths</td><td>Thermo Fisher Scientific</td><td>FSGPD02</td><td></td></tr><tr><td>Thermo Scientific&amp;trade;&amp;nbsp;Locator&amp;trade; Plus Rack and Box Systems</td><td>Thermo Fisher Scientific</td><td>13-762-353</td><td></td></tr><tr><td>CFX96 Touch Real-Time PCR Detection System</td><td>Bio-Rad</td><td>1855195</td><td></td></tr><tr><td>MiniAmp&amp;trade; Thermal Cycler</td><td>Applied Biosystems technology</td><td>A37834</td><td></td></tr><tr><td>Thermo Scientific&amp;trade;&amp;nbsp;Owl&amp;trade; EC300XL2 Compact Power Supply</td><td>Thermo Fisher Scientific</td><td>7217581</td><td></td></tr><tr><td>Thermo Scientific&amp;trade;&amp;nbsp;Owl&amp;trade; EasyCast&amp;trade; B1 Mini Gel Electrophoresis Systems</td><td>Thermo Fisher Scientific</td><td>09-528-178</td><td></td></tr><tr><td>VWR&amp;reg; Tube Rotator and Rotisseries</td><td>VWR International</td><td>10136-084</td><td></td></tr><tr><td>VWR&amp;reg; Incubating Mini Shaker</td><td>VWR International</td><td>12620-942</td><td></td></tr><tr><td>Analytical Balance MS104TS/00</td><td>METTLER TOLEDO</td><td>30133522</td><td></td></tr><tr><td>DS-11 FX and DS-11 FX+ Spectrophotometer</td><td>DeNovix Inc.</td><td>DS-11 FX</td><td></td></tr></tbody></table>

hox loci focused crispr/sgrna library screening identifying critical ctcf boundaries

CCCTC-binding factor (CTCF)-mediated stable topologically associating domains (TADs) play a critical role in constraining interactions of DNA elements that are located in neighboring TADs. CTCF plays an important role in regulating the spatial and temporal expression of HOX genes that control embryonic development, body patterning, hematopoiesis, and leukemogenesis. However, it remains largely unknown whether and how HOX loci associated CTCF boundaries regulate chromatin organization and HOX gene expression. In the current protocol, a specific sgRNA pooled library targeting all CTCF binding sites in the HOXA/B/C/D loci has been generated to examine the effects of disrupting CTCF-associated chromatin boundaries on TAD formation and HOX gene expression. Through CRISPR-Cas9 genetic screening, the CTCF binding site located between HOXA7/HOXA9 genes (CBS7/9) has been identified as a critical regulator of oncogenic chromatin domain, as well as being important for maintaining ectopic HOX gene expression patterns in MLL-rearranged acute myeloid leukemia (AML). Thus, this sgRNA library screening approach provides novel insights into CTCF mediated genome organization in specific gene loci and also provides a basis for the functional characterization of the annotated genetic regulatory elements, both coding and noncoding, during normal biological processes in the post-human genome project era.

CRISPR-Cas9 technology is a powerful research tool for functional genomic studies. It is rapidly replacing conventional gene editing techniques and has high utility for both genome-wide and individual gene-focused applications. Here, the first individually cloned loci-specific CRISPR-Cas9-arrayed sgRNA library contains 1,070 sgRNAs consisting of sgRNAs targeting 303 random targeting genes, 60 positive controls, 500 non-Human-targeting controls, and 207 CTCF elements or lncRNA targeting ge...

Watch this Scientific Journal Video about HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries at JoVE.com

HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries

A CRISPR/sgRNA library has been applied to interrogating protein-coding genes.However, the feasibility of a sgRNA library to uncover the function of a CTCF boundary in gene regulation remains unexplored. Here, we describe a HOX loci specific sgRNA library to elucidate the function of CTCF boundaries in HOX loci.

HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries

CCCTC-binding factor (CTCF)-mediated stable topologically associating domains (TADs) play a critical role in constraining interactions of DNA elements ...

hox-loci-focused-crisprsgrna-library-screening-identifying-critical

Research

JoVE Journal

Genetics

8.2K Views.  Pennsylvania State University College of Medicine. A CRISPR/sgRNA library has been applied to interrogating protein-coding genes.However, the feasibility of a sgRNA library to uncover the function of a CTCF boundary in gene regulation remains unexplored. Here, we describe a HOX loci specific sgRNA library to elucidate the function of CTCF boundaries in HOX loci.

Video: HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries

Generating CRISPR/Cas9 Mediated Monoallelic Deletions to Study Enhancer Function in Mouse Embryonic Stem Cells

Enhancers control cell identity by regulating tissue-specific gene expression in a position and orientation independent manner. These enhancers are often located distally from the regulated gene in intergenic regions or even within the body of another gene. The position independent nature of enhancer activity makes it difficult to match enhancers with the genes they regulate. Deletion of an enhancer region provides direct evidence for enhancer activity and is the gold standard to reveal an enhancer's role in endogenous gene transcription. Conventional homologous recombination based deletion methods have been surpassed by recent advances in genome editing technology which enable rapid and precisely located changes to the genomes of numerous model organisms. CRISPR/Cas9 mediated genome editing can be used to manipulate the genome in many cell types and organisms rapidly and cost effectively, due to the ease with which Cas9 can be targeted to the genome by a guide RNA from a bespoke expression plasmid. Homozygous deletion of essential gene regulatory elements might lead to lethality or alter cellular phenotype whereas monoallelic deletion of transcriptional enhancers allows for the study of cis-regulation of gene expression without this confounding issue. Presented here is a protocol for CRISPR/Cas9 mediated deletion in F1 mouse embryonic stem (ES) cells (Mus musculus129 x Mus castaneus). Monoallelic deletion, screening and expression analysis is facilitated by single nucleotide polymorphisms (SNP) between the two alleles which occur on average every 125 bp in these cells.

Experimental validation of enhancer activity is best approached by loss-of-function analysis. Presented here is an efficient protocol that uses CRISPR/Cas9 mediated deletion to study allele-specific regulation of gene transcription in F1 ES cells which contain a hybrid genome (Mus musculus129 x Mus castaneus).

Enhancers control cell identity by regulating tissue-specific gene expression in a position and orientation independent manner. These enhancers are often ...

Developmental Biology

Dissection of Enhancer Function Using Multiplex CRISPR-based Enhancer Interference in Cell Lines

Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these enhancers combine to produce a transcriptional response. As millions of enhancers have been identified, high-throughput tools are needed to determine enhancer function on a genome-wide scale. Current methods for studying enhancer function include making genetic deletions using nuclease-proficient Cas9, but it is difficult to study the combinatorial effects of multiple enhancers using this technique, as multiple successive clonal cell lines must be generated. Here, we present Enhancer-i, a CRISPR interference-based method that allows for functional interrogation of multiple enhancers simultaneously at their endogenous loci. Enhancer-i makes use of two repressive domains fused to nuclease-deficient Cas9, SID and KRAB, to achieve enhancer deactivation via histone deacetylation at targeted loci. This protocol utilizes transient transfection of guide RNAs to enable transient inactivation of targeted regions and is particularly effective at blocking inducible transcriptional responses to stimuli in tissue culture settings. Enhancer-i is highly specific both in its genomic targeting and its effects on global gene expression. Results obtained from this protocol help to understand whether an enhancer is contributing to gene expression, the magnitude of the contribution, and how the contribution is affected by other nearby enhancers.

This protocol describes the steps needed to design and perform multiplexed targeting of enhancers with the deactivating fusion protein SID4X-dCas9-KRAB, also known as enhancer interference (Enhancer-i). This protocol enables the identification of enhancers that regulate gene expression and facilitates the dissection of relationships between enhancers regulating a common target gene.

Multiple enhancers often regulate a given gene, yet for most genes, it remains unclear which enhancers are necessary for gene expression, and how these ...

Pooled CRISPR-Based Genetic Screens in Mammalian Cells

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian cells, this technology represents a novel means to perform genome-wide genetic screens for functional genomics studies. Libraries of guide RNAs (sgRNA) targeting all open reading frames permit the facile generation of thousands of genetic perturbations in a single pool of cells that can be screened for specific phenotypes to implicate gene function and cellular processes in an unbiased and systematic way. CRISPR-Cas screens provide researchers with a simple, efficient, and inexpensive method to uncover the genetic blueprints for cellular phenotypes. Furthermore, differential analysis of screens performed in various cell lines and from different cancer types can identify genes that are contextually essential in tumor cells, revealing potential targets for specific anticancer therapies. Performing genome-wide screens in human cells can be daunting, as this involves the handling of tens of millions of cells and requires analysis of large sets of data. The details of these screens, such as cell line characterization, CRISPR library considerations, and understanding the limitations and capabilities of CRISPR technology during analysis, are often overlooked. Provided here is a detailed protocol for the successful performance of pooled genome-wide CRISPR-Cas9 based screens.

CRISPR-Cas9 technology provides an efficient method to precisely edit the mammalian genome in any cell type and represents a novel means to perform genome-wide genetic screens. A detailed protocol discussing the steps required for the successful performance of pooled genome-wide CRISPR-Cas9 screens is provided here.

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Cell Surface Receptor Identification Using Genome-Scale CRISPR/Cas9 Genetic Screens

Intercellular communication mediated by direct interactions between membrane-embedded cell surface receptors is crucial for the normal development and functioning of multicellular organisms. Detecting these interactions remains technically challenging, however. This manuscript describes a systematic genome-scale CRISPR/Cas9 knockout genetic screening approach that reveals cellular pathways required for specific cell surface recognition events. This assay utilizes recombinant proteins produced in a mammalian protein expression system as avid binding probes to identify interaction partners in a cell-based genetic screen. This method can be used to identify the genes necessary for cell surface interactions detected by recombinant binding probes corresponding to the ectodomains of membrane-embedded receptors. Importantly, given the genome-scale nature of this approach, it also has the advantage of not only identifying the direct receptor but also the cellular components that are required for the presentation of the receptor at the cell surface, thereby providing valuable insights into the biology of the receptor.

This manuscript describes a genome-scale cell-based screening approach to identify extracellular receptor-ligand interactions.

Intercellular communication mediated by direct interactions between membrane-embedded cell surface receptors is crucial for the normal development and ...

In Vivo CRISPR/Cas9 Screening to Simultaneously Evaluate Gene Function in Mouse Skin and Oral Cavity

Genetically modified mouse models (GEMM) have been instrumental in assessing gene function, modeling human diseases, and serving as preclinical model to assess therapeutic avenues. However, their time-, labor- and cost-intensive nature limits their utility for systematic analysis of gene function. Recent advances in genome-editing technologies overcome those limitations and allow for the rapid generation of specific gene perturbations directly within specific mouse organs in a multiplexed and rapid manner. Here, we describe a CRISPR/Cas9-based method (Clustered Regularly Interspaced Short Palindromic Repeats) to generate thousands of gene knock-out clones within the epithelium of the skin and oral cavity of mice, and provide a protocol detailing the steps necessary to perform a direct&#160;in vivo&#160;CRISPR&#160;screen for tumor suppressor genes. This approach can be applied to other organs or other CRISPR/Cas9 technologies such as CRISPR-activation or CRISPR-inactivation to study the biological function of genes during tissue homeostasis or in various disease settings.

Here we describe a rapid and direct in vivo CRISPR/Cas9 screening methodology using ultrasound-guided in utero embryonic lentiviral injections to simultaneously assess functions of several genes in the skin and oral cavity of immunocompetent mice.

Genetically modified mouse models (GEMM) have been instrumental in assessing gene function, modeling human diseases, and serving as preclinical model to ...

Screening Sperm for the Rapid Isolation of Germline Edits in Zebrafish

The advent of targeted CRISPR-Cas nuclease technologies has revolutionized the ability to perform precise genome editing in both established and emerging model systems. CRISPR-Cas genome editing systems use a synthetic guide RNA (sgRNA) to target a CRISPR-associated (Cas) endonuclease to specific genomic DNA loci, where the Cas endonuclease generates a double-strand break. The repair of double-strand breaks by intrinsic error-prone mechanisms leads to insertions and/or deletions, disrupting the locus. Alternatively, the inclusion of double-stranded DNA donors or single-stranded DNA oligonucleotides in this process can elicit the inclusion of precise genome edits ranging from single nucleotide polymorphisms to small immunological tags or even large fluorescent protein constructs. However, a major bottleneck in this procedure can be finding and isolating the desired edit in the germline. This protocol outlines a robust method for screening and isolating germline mutations at specific loci in Danio rerio (zebrafish); however, these principles may be adaptable in any model where in vivo sperm collection is possible.

CRISPR-Cas technologies have revolutionized the field of genome editing. However, finding and isolating the desired germline edit remains a major bottleneck. Therefore, this protocol describes a robust method for quickly screening F0 CRISPR-injected zebrafish sperm for germline edits using standard PCR, restriction digest, and gel electrophoresis techniques.

The advent of targeted CRISPR-Cas nuclease technologies has revolutionized the ability to perform precise genome editing in both established and emerging ...

MEDUSA for Identifying Death Regulatory Genes in Chemo-genetic Profiling Data

Systematic screening of gain- or loss-of-function genetic perturbations can be used to characterize the genetic dependencies and mechanisms of regulation for essentially any cellular process of interest. These experiments typically involve profiling from a pool of single gene perturbations and how each genetic perturbation affects the relative cell fitness. When applied in the context of drug efficacy studies, often called chemo-genetic profiling, these methods should be effective at identifying drug mechanisms of action. Unfortunately, fitness-based chemo-genetic profiling studies are ineffective at identifying all components of a drug response. For instance, these studies generally fail to identify which genes regulate drug-induced cell death. Several issues contribute to obscuring death regulation in fitness-based screens, including the confounding effects of proliferation rate variation, variation in the drug-induced coordination between growth and death, and, in some cases, the inability to separate DNA from live and dead cells. MEDUSA is an analytical method for identifying death-regulatory genes in conventional chemo-genetic profiling data. It works by using computational simulations to estimate the growth and death rates that created an observed fitness profile rather than scoring fitness itself. Effective use of the method depends on optimal tittering of experimental conditions, including the drug dose, starting population size, and length of the assay. This manuscript will describe how to set up a chemo-genetic profiling study for MEDUSA-based analysis, and we will demonstrate how to use the method to quantify death rates in chemo-genetic profiling data.

This protocol describes how to use the MEDUSA analytical method to quantify the death regulatory effect of each gene knockout. It includes instructions on determining experimental conditions that optimize sensitivity and a step-by-step tutorial on performing the analysis.

Systematic screening of gain- or loss-of-function genetic perturbations can be used to characterize the genetic dependencies and mechanisms of regulation ...

Cancer Research

Evaluation of Abnormal Growth-related Genes of Hematopoietic Stem and Progenitor Cells by Combining CRISPR/Cas9 Technology with Cell Counting

Hematopoietic stem cells possess the ability for long-term self-renewal and the potential to differentiate into various types of mature blood cells. However, the accumulation of cancerous mutations in hematopoietic stem and progenitor cells (HSPCs) can block normal differentiation, induce aberrant proliferation, and ultimately lead to leukemogenesis. To identify and/or evaluate the cancerous mutations, we integrated CRISPR/Cas9 technology with the Cell Counting Kit-8 (CCK-8) assay to investigate a model gene Trp53, that is essential for abnormal proliferative ability of HSPCs. Specifically, bone marrow cells enriched for HSPCs from Cas9 mice were harvested and then subjected to viral transfection with single-guide RNAs (sgRNAs) targeting one or several candidate genes to introduce genetic alterations in HSPCs. Then, a CCK-8 assay was performed to investigate the proliferative capacity of transfected HSPCs. The sgRNA targeting efficiency was confirmed by a Tracking of Indels by Decomposition assay. These identified genes may play crucial roles in leukemogenesis and could serve as potential therapeutic targets.

Here, we present a protocol that integrates CRISPR/Cas9 technology with the Cell Counting Kit-8 (CCK-8) assay to identify candidate genes that are crucial for the abnormal proliferative capacity of hematopoietic stem and progenitor cells.

Hematopoietic stem cells possess the ability for long-term self-renewal and the potential to differentiate into various types of mature blood cells. ...

CRISPR Gene Editing Tool for MicroRNA Cluster Network Analysis

MicroRNAs (miRNAs) have emerged as important cellular regulators (tumor suppressors, pro-oncogenic factors) of cancer and metastasis. Most published studies focus on a single miRNA when characterizing the role of small RNAs in cancer. However, ~30%&#160;of human miRNA genes are organized in clustered units that are often co-expressed, indicating a complex and coordinated system of noncoding RNA regulation. A clearer understating of how clustered miRNA networks function cooperatively to regulate tumor growth, cancer aggressiveness, and drug resistance is required before translating noncoding small RNAs to the clinic.
The use of a high-throughput clustered regularly interspaced short palindromic repeats (CRISPR)-mediated gene editing procedure has been employed to study the oncogenic role of a genomic cluster of seven miRNA genes located within a locus spanning ~35,000 bp in length in the context of prostate cancer. For this approach, human cancer cell lines were infected with a lentivirus vector for doxycycline (DOX)-inducible Cas9 nuclease grown in DOX-containing medium for 48 h. The cells were subsequently co-transfected with synthetic trans-activating CRISPR RNA (tracrRNA) complexed with genomic site-specific CRISPR RNA (crRNA) oligonucleotides to allow the rapid generation of cancer cell lines carrying the entire miRNA cluster deletion and individual or combination miRNA gene cluster deletions within a single experiment.
The advantages of this high-throughput gene editing system are the ability to avoid time-consuming DNA vector subcloning, the flexibility in transfecting cells with unique guide RNA combinations in a 24-well format, and the lower-cost PCR genotyping using crude cell lysates. Studies using this streamlined approach promise to uncover functional redundancies and synergistic/antagonistic interactions between miRNA cluster members, which will aid in characterizing the complex small noncoding RNA networks involved in human disease and better inform future therapeutic design.

This protocol describes a high-throughput clustered regularly interspaced short palindromic repeats (CRISPR) gene editing workflow for microRNA cluster network analysis that allows the rapid generation of a panel of genetically modified cell lines carrying unique miRNA cluster member deletion combinations as large as 35 kb within a single experiment.

MicroRNAs (miRNAs) have emerged as important cellular regulators (tumor suppressors, pro-oncogenic factors) of cancer and metastasis. Most published ...

HOX Loci Focused CRISPR/sgRNA Library Screening Identifying Critical CTCF Boundaries

Summary

Explore More Videos

PLAYLIST