Non-Radioactive In Vitro Cardiac Myosin Light Chain Kinase Assays

Summary

This study describes protocols for nonradiometric methods, a bioluminescent ADP detection assay and a phosphate-affinity SDS-PAGE, to determine the kinase activity of cardiac myosin light chain kinase (cMLCK) and the phosphorylation level of its substrate, myosin regulatory light chain (MLC2v).

Abstract

Cardiac-specific myosin regulatory light chain kinase (cMLCK) regulates cardiac sarcomere structure and contractility by phosphorylating the ventricular isoform of the myosin regulatory light chain (MLC2v). MLC2v phosphorylation levels are significantly reduced in failing hearts, indicating the clinical importance of assessing the activity of cMLCK and the phosphorylation level of MLC2v to elucidate the pathogenesis of heart failure. This paper describes nonradioactive methods to assess both the activity of cMLCK and MLC2v phosphorylation levels. In vitro kinase reactions are performed using recombinant cMLCK with recombinant calmodulin and MLC2v in the presence of ATP and calcium at 25 °C, which are followed by either a bioluminescent ADP detection assay or a phosphate-affinity SDS-PAGE. In the representative study, the bioluminescent ADP detection assay showed a strict linear increase of the signal at cMLCK concentrations between 1.25 nM to 25 nM. Phosphate-affinity SDS-PAGE also showed a linear increase of phosphorylated MLC2v in the same cMLCK concentration range. Next, the time-dependency of the reactions was examined at the concentration of 5 nM cMLCK. A bioluminescent ADP detection assay showed a linear increase in the signal during 90 min of the reaction. Similarly, phosphate-affinity SDS-PAGE showed a time-dependent increase of phosphorylated MLC2v. The biochemical parameters of cMLCK for MLC2v were determined by a Michaelis-Menten plot using the bioluminescent ADP detection assay. The V_max was 1.65 ± 0.10 mol/min/mol kinase and the average K_m was around 0.5 USA µM at 25 °C. Next, the activity of wild type and the dilated cardiomyopathy-associated p.Pro639Valfs*15 mutant cMLCK were measured. The bioluminescent ADP detection assay and phosphate-affinity SDS-PAGE correctly detected defects in cMLCK activity and MLC2v phosphorylation, respectively. In conclusion, a combination of the bioluminescent ADP detection assay and the phosphate-affinity SDS-PAGE is a simple, accurate, safe, low-cost, and flexible method to measure cMLCK activity and the phosphorylation level of MLC2v.

Introduction

The cardiac-specific myosin regulatory light chain kinase (cMLCK) encoded by the MYLK3 gene is the kinase predominantly responsible for maintaining the phosphorylation of cardiac ventricular myosin regulatory light chain 2 (MLC2v)^1,2. By phosphorylating MLC2v at Ser-15, cMLCK promotes sarcomere organization¹ and potentiates cardiac contractility^2,3 as a result of increasing cross-bridge formation and therefore an increase in the lever-arm stiffness of myosin II⁴. Defects in cMLCK activity or redu....

Protocol

1. Cloning and purification of recombinant wild type and DCM-associated mutant cMLCK

1. Cloning of recombinant cardiac myosin light chain kinase into plasmid
   1. Design a continuous nucleotide sequence to represent the final plasmid.
   2. Amplify a DNA fragment coding human MYLK3 (NM_1829493.3) using a standard PCR method. The primer sequences are as follows:
      Forward primer: 5’- CACCATGTCAGGAACCTCCAAGGAGAGTCTGGGG -3’
      Reverse primer: 5’- TTAGGGAGAAGTTGGAAATTTCCTTAACCT -3’
      The melting temperature is 60 °C.
      NOTE: The single-stranded overhang sequence (CACC) is necessary to ligate....

Results

The classical method for measuring kinase activity is a radiometric-based assay that quantifies the radiolabeled phosphate incorporated into the kinase substrate. For the method presented here, a nonradioactive, in vitro cMLCK kinase assay using purified wild type cMLCK (Figure 1A), MLC2v, and calmodulin was developed (Figure 1B), and kinase activity was determined using a bioluminescent ADP detection assay. For the experiments used to establish the cMLCK assay,.......

Discussion

The present study was undertaken to assess whether the combination of nonradioactive methods, the bioluminescent ADP detection assay and the phosphate-affinity SDS-PAGE could successfully be used to determine the activity of cMLCK. It is essential to perform the kinase reactions under the optimal temperature and reaction time. Increasing either of these will rapidly and strongly promote the enzyme reaction. In the present study, the in vitro kinase reaction was performed with 5 nM of cMLCK at 25 °C, which ensured si.......

Materials

Name	Company	Catalog Number	Comments
30% acrylamide/Bis solution	Bio-Rad	1610156	Store at 4℃
acrylamide	Bio-Rad	1610156	Store at 4℃
Amicon Ultra-15	Merck	UFC901008
ammonium persulfate	Wako	019-03435
ampicillin sodium	Wako	014-23302	Store at -20℃
BugBuster	Milipore	71456-4	Store at 4℃
CaCl2	Wako	031-00435
CHAPS	Dojindo	349-04722	Store at 4℃
chemiluminescence imaging analyzer TriStar2	CBERTHOLD TECHNOLOGIES	LB942-A
dithiothreitol	Wako	047-08973	Store at -20℃
ECL (Enhanced Chemi Luminescence) reagent	GE Healthcare	RPN2106	Mix reagent 1 and reagent 2 in equal amounts
EDTA	DOJINDO	345-01865
Ethanol	Wako	057-00456
FBS	Sigma-Aldrich	172012-500ML	Store at -20℃
FLAG agarose	Merck	A2220	Store at -20℃
FLAG peptide	Merck	F3290-4MG	Store at 4℃
GateWay pEF-DEST51 Vector	Invitrogen	12285011	Store at -20℃
glycine	Sigma-Aldrich	12-1210-5
HEPES	Dojindo	342-01375
Igepal CA-630 (NP40)	Sigma-Aldrich	13021-500ML
Imiadasole	Wako	095-00015
L-(+)-Arabinose	Sigma-Aldrich	A3256-25G	Store at -20℃
LAS-4000	GE Healthcare	28955810
LB	Merck	WM841485 824
Lipofectamine 2000	Invitrogen	11668-019
Manganase (II) Chloride Tetrahydrate	Wako	134-15302
MgCl2	nacalai-tesque	20909-42
N, N, N’, N’- tetramethylethylenediamin	Wako	110-18-9
NaCl	Wako	191-01665
OneShot BL21 AI	Invitrogen	44-0184	Store at -80℃
OptiMEM	gibco	31985-070	Store at 4℃
PBS	NISSUI PHARMACEUTICAL	5913	Store at 4℃
penicillin streptmycin	gibco	15140-122	Store at -20℃
pENTR/D-TOPO Cloning Kit	Invitrogen	K240020	Store at -20℃
Phos-tag Acrylamide	Wako	AAL-107	Store at 4℃
Promega ADP-Glo	Promega	V9104	Store at -20℃
protease inhibitor cock-tail	nacalai-tesque	25955-11
PVDF membrane	Merck	IPVH00010	Pore size : 0.45 μm
QIAEX II Gel Extraction Kit (150)	QIAGEN	20021
SDS	Wako	191-07145
sodium phosphate	Wako	192-02815
TALON affinity resin	TaKaRa	635504	Store at 4℃
Tris	Sigma-Aldrich	T1503-1KG
Tween 20	Wako	167-11515	Store at 4℃
Ultra Pure Agarose	Invitrogen	16500-500
Ultra Pure ATP, 100mM	Promega	V703B-C	Store at -20℃
Urea	Sigma-Aldrich	U0631-1KG