This work is supported by the Topsector Life Sciences &#38; Health - Topconsortium voor Kennis en Innovatie Health~Holland (LSH-TKI) public-private partnerships (PPP) allowance of the Dutch LSH sector with Project number LSHM16021 Organoids as novel tool for toxicology modelling to Hubrecht Organoid Technology (HUB) and HUB internal funding to Disease Modeling and Toxicology department. We thank the laboratories of Sabine Middendorp (Division of Pediatric Gastroenterology, Wilhelmina Children&#39;s Hospital, UMC, Utrecht) and Hugo R. de Jonge and Marcel J.C. Bijvelds (Department of Gastroenterology and Hepatology, Erasmus MC, Rotterdam) for providing initial technical support to set up monolayers on membrane inserts.

<ol>
	<li>Haegebarth, A., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt+signaling,+lgr5,+and+stem+cells+in+the+intestine+and+skin.">Wnt signaling, lgr5, and stem cells in the intestine and skin.</a> The American Journal of Pathology. 174 (3), 715-721 (2009).</li><li>Schoultz, I., Keita, &. #. 1. 9. 7. ;. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+intestinal+barrier+and+current+techniques+for+the+assessment+of+gut+permeability.">The intestinal barrier and current techniques for the assessment of gut permeability.</a> Cells. 9 (8), 1909 (2020).</li><li>Mart&#237;nez-Maqueda, D., Miralles, B., Recio, I., Verhoeckx, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HT29+Cell+Line.">HT29 Cell Line.</a> The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 113-124 (2015).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single+Lgr5+stem+cells+build+crypt-villus+structures+in+vitro+without+a+mesenchymal+niche.">Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche.</a> Nature. 459 (7244), 262-265 (2009).</li><li>Sato, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expansion+of+epithelial+organoids+from+human+colon,+adenoma,+adenocarcinoma,+and+Barrett's+epithelium.">Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium.</a> Gastroenterology. 141 (5), 1762-1772 (2011).</li><li>Huch, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+expansion+of+single+Lgr5(+)+liver+stem+cells+induced+by+Wnt-driven+regeneration.">In vitro expansion of single Lgr5(+) liver stem cells induced by Wnt-driven regeneration.</a> Nature. 11 (2), 179-194 (2013).</li><li>Sachs, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+expanding+human+airway+organoids+for+disease+modeling.">Long-term expanding human airway organoids for disease modeling.</a> The EMBO Journal. 38 (4), 1-20 (2019).</li><li>Karthaus, W. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+multipotent+luminal+progenitor+cells+in+human+prostate+organoid+cultures.">Identification of multipotent luminal progenitor cells in human prostate organoid cultures.</a> Cell. 159 (1), 163-175 (2014).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+models+of+human+and+mouse+ductal+pancreatic+cancer.">Organoid models of human and mouse ductal pancreatic cancer.</a> Cell. 160 (1-2), 324-338 (2015).</li><li>Sachs, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+living+biobank+of+breast+cancer+organoids+captures+disease+heterogeneity.">A living biobank of breast cancer organoids captures disease heterogeneity.</a> Cell. 172 (1-2), 373-386 (2018).</li><li>Vlachogiannis, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patient-derived+organoids+model+treatment+response+of+metastatic+gastrointestinal+cancers.">Patient-derived organoids model treatment response of metastatic gastrointestinal cancers.</a> Science. 359 (6378), 920-926 (2018).</li><li>Van De Wetering, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prospective+derivation+of+a+living+organoid+biobank+of+colorectal+cancer+patients.">Prospective derivation of a living organoid biobank of colorectal cancer patients.</a> Cell. 161 (4), 933-945 (2015).</li><li>Driehuis, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pancreatic+cancer+organoids+recapitulate+disease+and+allow+personalized+drug+screening.">Pancreatic cancer organoids recapitulate disease and allow personalized drug screening.</a> Proceedings of the National Academy of Sciences of the United States of America. 116 (52), 26580-26590 (2019).</li><li>Tiriac, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoid+profiling+identifies+common+responders+to+chemotherapy+in+pancreatic+cancer.">Organoid profiling identifies common responders to chemotherapy in pancreatic cancer.</a> Cancer Discovery. 8 (9), 1112-1129 (2018).</li><li>d'Aldebert, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+human+colon+organoids+from+inflammatory+bowel+disease+patients.">Characterization of human colon organoids from inflammatory bowel disease patients.</a> Frontiers in Cell and Developmental Biology. 8, 363 (2020).</li><li>Dotti, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alterations+in+the+epithelial+stem+cell+compartment+could+contribute+to+permanent+changes+in+the+mucosa+of+patients+with+ulcerative+colitis.">Alterations in the epithelial stem cell compartment could contribute to permanent changes in the mucosa of patients with ulcerative colitis.</a> Gut. 66 (12), 2069-2079 (2017).</li><li>VanDussen, K. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+an+enhanced+human+gastrointestinal+epithelial+culture+system+to+facilitate+patient-based+assays.">Development of an enhanced human gastrointestinal epithelial culture system to facilitate patient-based assays.</a> Gut. 64 (6), 911-920 (2015).</li><li>Noel, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+primary+human+macrophage-enteroid+co-culture+model+to+investigate+mucosal+gut+physiology+and+host-pathogen+interactions.">A primary human macrophage-enteroid co-culture model to investigate mucosal gut physiology and host-pathogen interactions.</a> Scientific Reports. 7, 45270 (2017).</li><li>Bartfeld, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+expansion+of+human+gastric+epithelial+stem+cells+and+their+responses+to+bacterial+infection.">In vitro expansion of human gastric epithelial stem cells and their responses to bacterial infection.</a> Gastroenterology. 148 (1), 126-136 (2015).</li><li>van Es, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt+signalling+induces+maturation+of+Paneth+cells+in+intestinal+crypts.">Wnt signalling induces maturation of Paneth cells in intestinal crypts.</a> Nature Cell Biology. 7 (4), 381-386 (2005).</li><li>van Es, J. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dll1+marks+early+secretory+progenitors+in+gut+crypts+that+can+revert+to+stem+cells+upon+tissue+damage.">Dll1 marks early secretory progenitors in gut crypts that can revert to stem cells upon tissue damage.</a> Nature Cell Biology. 14 (10), 1099-1104 (2012).</li><li>de Lau, W. B. M., Snel, B., Clevers, H. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+R-spondin+protein+family.">The R-spondin protein family.</a> Genome Biology. 13 (3), 1-10 (2012).</li><li>Basak, O., Beumer, J., Wiebrands, K., Seno, H., van Oudenaarden, A., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+quiescence+of+Lgr5++stem+cells+in+intestinal+organoids+enables+differentiation+of+hormone-producing+enteroendocrine+cells.">Induced quiescence of Lgr5+ stem cells in intestinal organoids enables differentiation of hormone-producing enteroendocrine cells.</a> Cell Stem Cell. 20 (2), 177-190 (2017).</li><li>Beumer, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enteroendocrine+cells+switch+hormone+expression+along+the+crypt-to-villus+BMP+signalling+gradient.">Enteroendocrine cells switch hormone expression along the crypt-to-villus BMP signalling gradient.</a> Nature Cell Biology. 20 (8), 909-916 (2018).</li><li>Yin, X., Farin, H. F., van Es, J. H., Clevers, H., Langer, R., Karp, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Niche-independent+high-purity+cultures+of+Lgr5++intestinal+stem+cells+and+their+progeny.">Niche-independent high-purity cultures of Lgr5+ intestinal stem cells and their progeny.</a> Nature Methods. 11 (1), 106-112 (2014).</li><li>Boj, S. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Forskolin-induced+swelling+in+intestinal+organoids:+An+in+vitro+assay+for+assessing+drug+response+in+cystic+fibrosis+patients.">Forskolin-induced swelling in intestinal organoids: An in vitro assay for assessing drug response in cystic fibrosis patients.</a> Journal of Visualized Experiments. (120), (2017).</li><li>Miao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-generation+surrogate+Wnts+support+organoid+growth+and+deconvolute+Frizzled+pleiotropy+in+vivo.">Next-generation surrogate Wnts support organoid growth and deconvolute Frizzled pleiotropy in vivo.</a> Cell Stem Cell. 27 (5), 840-851 (2020).</li><li>Srinivasan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TEER+measurement+techniques+for+in+vitro+barrier+model+systems.">TEER measurement techniques for in vitro barrier model systems.</a> Journal of Laboratory Automation. 20 (2), 107-126 (2015).</li><li>Blume, L. -. F., Denker, M., Gieseler, F., Kunze, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temperature+corrected+transepithelial+electrical+resistance+(TEER)+measurement+to+quantify+rapid+changes+in+paracellular+permeability.">Temperature corrected transepithelial electrical resistance (TEER) measurement to quantify rapid changes in paracellular permeability.</a> Die Pharmazie. 65 (1), 19-24 (2010).</li><li>Lea, T., Verhoeckx, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Caco-2+cell+line.">Caco-2 cell line.</a> The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 103-111 (2015).</li><li>Heo, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modelling+Cryptosporidium+infection+in+human+small+intestinal+and+lung+organoids.">Modelling Cryptosporidium infection in human small intestinal and lung organoids.</a> Nature Microbiology. 3 (7), 814-823 (2018).</li><li>Watanabe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+ROCK+inhibitor+permits+survival+of+dissociated+human+embryonic+stem+cells.">A ROCK inhibitor permits survival of dissociated human embryonic stem cells.</a> Nature Biotechnology. 25 (6), 681-686 (2007).</li></ol>

The authors declare no conflict of interest.

This protocol describes the general manipulation and maintenance of intestinal organoids as well as the preparation and possible applications of epithelial monolayers derived from these organoids. To date, monolayers have been successfully prepared from the duodenum, ileum, and different regions of colon organoids derived from normal as well as previously and actively inflamed intestinal tissue (unpublished data). The application of patient-derived organoid monolayers facilitates the study of barrier function in a diseas...

The intestinal epithelium acts as a physical barrier between the luminal content of the intestines and the underlying tissue. This barrier comprises a single epithelial layer of mainly absorptive enterocytes that are connected by tight junctions, which establish strong intercellular connections between adjacent cells. These cells form a polarized epithelial lining that separates the apical (lumen) and basolateral sides of the intestine, while simultaneously regulating paracellular transport of digested nutrients and metabolites. In addition to enterocytes, other important epithelial cells such as goblet, Paneth, and enteroendocrine cells also contribute to intestinal homeostasis by producing mucus, antimicrobial peptides, and hormones, respectively. The intestinal epithelium is constantly replenished by dividing leucine-rich repeat-containing G-protein-coupled receptor 5-positive (LGR5+) stem cells in the bottom of intestinal crypts producing transit-amplifying (TA) cells that migrate upwards and differentiate into other cell types1. Disruption of intestinal epithelial homeostasis by genetic and environmental factors, such as exposure to food allergens, medicinal compounds, and microbial pathogens, leads to disruption of intestinal barrier function. These conditions cause several intestinal diseases including inflammatory bowel disease (IBD), celiac disease, and drug-induced GI toxicity2.
Studies on the intestinal epithelium are performed using several in vitro platform systems such as membrane inserts, organs-on-a-chip systems, Ussing chambers, and intestinal rings.These platforms are suitable for establishing polarized epithelial monolayers with access to both apical and basolateral sides of the membrane, using transformed cell lines or primary tissue as models. Although transformed cell lines, such as the colorectal (adeno)carcinoma cell lines Caco-2, T84, and HT-29, are able to differentiate into polarized intestinal enterocytes or mucus-producing cells to some extent, they are not representative of the in vivo&#160;epithelium as several cell types are missing, and various receptors and transporters are aberrantly expressed3. In addition, as cell lines are derived from a single donor, they do not represent interpatient heterogeneity and suffer from reduced complexity and physiological relevance. Although primary tissues used in Ussing chambers and as intestinal rings are more representative of the in vivo&#160;situation, their limited availability, short-term viability, and lack of expandability make them unsuitable as a medium for high-throughput (HT) studies.
Organoids are in vitro epithelial cultures established from different organs such as the intestine, kidney, liver, pancreas, and lung. They are proven to have long-term, stable expandability as well as genetic and phenotypic stability and therefore are representative biological miniatures of the epithelium of the original organ with faithful responses to external stimuli4,5,6,7,8,9. Organoids are efficiently established from either resected or biopsied normal, diseased, inflamed, or cancerous tissue, representing heterogeneous patient-specific responses10,11,12,13,14,15,16. This paper demonstrates how to establish intestinal epithelial monolayers derived from organoid cultures. Monolayers have been successfully established from small intestinal as well as colonic and rectal organoid cultures. This model creates an opportunity to study the transport and permeability of the epithelial cells to drugs as well as their toxicological effects on the epithelium. Moreover, the model allows co-culture with immune cells and bacteria to study their interactions with the intestinal epithelium17,18,19. Furthermore, this model can be used to study responses to therapies in a patient-specific manner and initiate screening efforts to look for the next wave of epithelial barrier-focused therapeutics. Such an approach could be extended to the clinic and pave the way toward personalized treatments.
Although the epithelial monolayers in this protocol are prepared from human normal intestinal organoids, the protocol can be applied and optimized for other organoid models. Epithelial organoid monolayers are cultured in intestinal organoid expansion medium containing Wnt to support stem cell proliferation and represent intestinal crypt cellular composition. Intestinal organoids can be enriched to have different intestinal epithelial fates, such as enterocytes, Paneth, goblet, and enteroendocrine cells, by modulating Wnt, Notch, and epidermal growth factor (EGF) pathways. Here, after the establishment of monolayers in expansion medium, they are driven toward more differentiated intestinal epithelial cells, as described previously20,21,22,23,24,25. For screening purposes, depending on the mode of action of the compound of interest, its target cells, and the experimental conditions, the monolayers can be driven toward the cellular composition of choice to measure the effects of the compound with relevant functional readouts.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>100% ethanol</td>
			<td>Fisher Emergo</td>
			<td>10644795</td>
			<td></td>
		</tr>
		<tr>
			<td>1250, 300, and 20 &#181;L low-retention filter-tips</td>
			<td>Greiner bio-one</td>
			<td>732-1432 / 732-1434 / 732-2383</td>
			<td></td>
		</tr>
		<tr>
			<td>15 mL conical tubes</td>
			<td>Greiner bio-one</td>
			<td>188271</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well cell culture plates</td>
			<td>Greiner bio-one</td>
			<td>662160</td>
			<td></td>
		</tr>
		<tr>
			<td>24-well HTS Fluoroblok Transwell plate (light-tight)</td>
			<td>Corning</td>
			<td>351156</td>
			<td rowspan="2">Plates require REMS AutoSampler for TEER measurements</td>
		</tr>
		<tr>
			<td>24-well HTS Transwell plates (Table 1)</td>
			<td>Corning</td>
			<td>3378</td>
		</tr>
		<tr>
			<td>24-well plate with Transwell inserts</td>
			<td>Corning</td>
			<td>3470</td>
			<td>membrane inserts</td>
		</tr>
		<tr>
			<td>40 &#181;m cell strainer</td>
			<td>PluriSelect</td>
			<td>43-50040-01</td>
			<td></td>
		</tr>
		<tr>
			<td>50 mL conical tubes</td>
			<td>Greiner bio-one</td>
			<td>227261</td>
			<td></td>
		</tr>
		<tr>
			<td>6-well cell culture plates</td>
			<td>Greiner bio-one</td>
			<td>657160</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well black plate transparent bottom</td>
			<td>Greiner bio-one</td>
			<td>655090</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well fast thermal cycling plates</td>
			<td>Life Technologies Europe BV</td>
			<td>4346907</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well HTS Fluoroblok Transwell plate</td>
			<td>Corning</td>
			<td>351162</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well HTS Transwell plates (Table 1)</td>
			<td>Corning</td>
			<td>7369</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well transparent culture plate</td>
			<td>Greiner bio-one</td>
			<td>655180</td>
			<td></td>
		</tr>
		<tr>
			<td>A83-01</td>
			<td>Bio-Techne Ltd</td>
			<td>2939</td>
			<td></td>
		</tr>
		<tr>
			<td>Accutase Cell Dissociation Reagent</td>
			<td>Life Technologies Europe BV</td>
			<td>A11105-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Advanced DMEM/F-12</td>
			<td>Life Technologies Europe BV</td>
			<td>12634028</td>
			<td></td>
		</tr>
		<tr>
			<td>B27 supplement</td>
			<td>Life Technologies Europe BV</td>
			<td>17504001</td>
			<td></td>
		</tr>
		<tr>
			<td>Cell culture microscope (light / optical microscope)</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CellTiter-Glo</td>
			<td>Promega</td>
			<td>G9683</td>
			<td></td>
		</tr>
		<tr>
			<td>Centrifuge</td>
			<td>Eppendorf</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CO2 incubator</td>
			<td>PHCBI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DAPT</td>
			<td>Sigma-Aldrich</td>
			<td>D5942</td>
			<td></td>
		</tr>
		<tr>
			<td>DEPC treated H2O</td>
			<td>Life Technologies Europe BV</td>
			<td>750024</td>
			<td></td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s phosphate-buffered saline (DPBS) with Ca2+ and Mg2+</td>
			<td>Life Technologies Europe BV</td>
			<td>14040091</td>
			<td></td>
		</tr>
		<tr>
			<td>DPBS, powder, no calcium, no magnesium</td>
			<td>Life Technologies Europe BV</td>
			<td>21600069</td>
			<td></td>
		</tr>
		<tr>
			<td>EnzChek Lysozyme Assay Kit</td>
			<td>Life Technologies Europe BV</td>
			<td>E22013</td>
			<td></td>
		</tr>
		<tr>
			<td>EVOM2 meter with STX electrode</td>
			<td>WTI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Gastrin</td>
			<td>Bio-Techne Ltd</td>
			<td>3006</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass pipettes</td>
			<td>Volac</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>GlutaMAX</td>
			<td>Life Technologies Europe BV</td>
			<td>35050038</td>
			<td></td>
		</tr>
		<tr>
			<td>hEGF</td>
			<td>Peprotech</td>
			<td>AF-100-15</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Life Technologies Europe BV</td>
			<td>15630056</td>
			<td></td>
		</tr>
		<tr>
			<td>Human Noggin</td>
			<td>Peprotech</td>
			<td>120-10C</td>
			<td></td>
		</tr>
		<tr>
			<td>Human Rspo3</td>
			<td>Bio-Techne Ltd</td>
			<td>3500-RS/CF</td>
			<td></td>
		</tr>
		<tr>
			<td>IWP-2</td>
			<td>Miltenyi Biotec</td>
			<td>130-105-335</td>
			<td></td>
		</tr>
		<tr>
			<td>Ki67 primary antibody</td>
			<td>Sanbio</td>
			<td>BSH-7302-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Ki67 secondary antibody</td>
			<td>Agilent</td>
			<td>K400111-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Kova International Glasstic Slide with Counting grids</td>
			<td>Fisher Emergo</td>
			<td>10298483</td>
			<td></td>
		</tr>
		<tr>
			<td>Laminar flow hood</td>
			<td>Thermo scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Lucifer Yellow CH dilithium salt</td>
			<td>Sigma-Aldrich</td>
			<td>L0259</td>
			<td></td>
		</tr>
		<tr>
			<td>Matrigel, Growth Factor Reduced (GFR)</td>
			<td>Corning</td>
			<td>356231</td>
			<td>extracellular matrix (ECM)</td>
		</tr>
		<tr>
			<td>MicroAmp Fast 8-Tube Strip, 0.1 mL</td>
			<td>Life Technologies Europe BV</td>
			<td>4358293</td>
			<td></td>
		</tr>
		<tr>
			<td>MicroAmp Optical 8-Cap Strips</td>
			<td>Life Technologies Europe BV</td>
			<td>4323032</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge tubes</td>
			<td>Eppendorf</td>
			<td>0030 120 086</td>
			<td></td>
		</tr>
		<tr>
			<td>Micropipettes (1000, 200, and 20 &#181;L)</td>
			<td>Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microtome</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>MUC2 primary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-15334</td>
			<td></td>
		</tr>
		<tr>
			<td>MUC2 secondary antibody</td>
			<td>VWR</td>
			<td>VWRKS/DPVR-HRP</td>
			<td></td>
		</tr>
		<tr>
			<td>Multichannel pipette (200 &#181;L)</td>
			<td>Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>N-acetylcysteine</td>
			<td>Sigma-Aldrich</td>
			<td>A9165</td>
			<td></td>
		</tr>
		<tr>
			<td>NGS Wnt</td>
			<td>U-Protein Express</td>
			<td>N001-0.5mg</td>
			<td></td>
		</tr>
		<tr>
			<td>Nicotinamide</td>
			<td>Sigma-Aldrich</td>
			<td>N0636</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide ALPI1/Forward</td>
			<td>Custom-made</td>
			<td>GGAGTTATCCTGCTCCCCAC</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide ALPI1/Reverse</td>
			<td>Custom-made</td>
			<td>CTAGGAGGTGAAGGTCCAACG</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide LGR5/Forward</td>
			<td>Custom-made</td>
			<td>ACACGTACCCACAGAAGCTC</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide LGR5/Reverse</td>
			<td>Custom-made</td>
			<td>GGAATGCAGGCCACTGAAAC</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide MUC2/Forward</td>
			<td>Custom-made</td>
			<td>AGGATCTGAAGAAGTGTGTCACTG</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide MUC2/Reverse</td>
			<td>Custom-made</td>
			<td>TAATGGAACAGATGTTGAAGTGCT</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide TBP/Forward</td>
			<td>Custom-made</td>
			<td>ACGCCGAATATAATCCCAAGCG</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotide TBP/Reverse</td>
			<td>Custom-made</td>
			<td>AAATCAGTGCCGTGGTTCGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>Optical adhesive covers</td>
			<td>Life Technologies Europe BV</td>
			<td>4311971</td>
			<td></td>
		</tr>
		<tr>
			<td>PD0325901</td>
			<td>Stemcell Technologies</td>
			<td>72184</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin/streptomycin</td>
			<td>Life Technologies Europe BV</td>
			<td>15140122</td>
			<td></td>
		</tr>
		<tr>
			<td>Plate shaker</td>
			<td>Panasonic</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PowerUp SYBR Green Master Mix</td>
			<td>Fisher Emergo</td>
			<td>A25776</td>
			<td></td>
		</tr>
		<tr>
			<td>Primocin</td>
			<td>InvivoGen</td>
			<td>ANT-PM-2</td>
			<td>antimicrobial formulation for primary cells</td>
		</tr>
		<tr>
			<td>Qubit RNA HS Assay Kit</td>
			<td>Life Technologies Europe BV</td>
			<td>Q32852</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent reservoir for multichannel pipet</td>
			<td>Sigma-Aldrich</td>
			<td>CLS4870</td>
			<td></td>
		</tr>
		<tr>
			<td>REMS AutoSampler with 24-probe or 96C-probe</td>
			<td>WTI</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Richard-Allan Scientific Alcian Blue/PAS Special Stain Kit</td>
			<td>Thermo scientific</td>
			<td>87023</td>
			<td></td>
		</tr>
		<tr>
			<td>RNase-Free DNase Set</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td></td>
		</tr>
		<tr>
			<td>RNeasy Mini Kit</td>
			<td>Qiagen</td>
			<td>74106</td>
			<td></td>
		</tr>
		<tr>
			<td>SB202190</td>
			<td>Sigma-Aldrich</td>
			<td>S7076</td>
			<td></td>
		</tr>
		<tr>
			<td>Serological pipettes</td>
			<td>Greiner bio-one</td>
			<td>606180 / 607180 / 760180</td>
			<td></td>
		</tr>
		<tr>
			<td>Serological pipettor (Pipet-Aid)</td>
			<td>Drummond</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Single edge razor blade</td>
			<td>GEM Scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Superscript 1st strand system for RT-PCR</td>
			<td>Life Technologies Europe BV</td>
			<td>11904018</td>
			<td></td>
		</tr>
		<tr>
			<td>Tecan Spark 10M plate reader</td>
			<td>Tecan</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Trypan Blue Solution, 0.4%</td>
			<td>Life Technologies Europe BV</td>
			<td>15250-061</td>
			<td></td>
		</tr>
		<tr>
			<td>TrypLE Express Enzyme (1x)</td>
			<td>Life Technologies Europe BV</td>
			<td>12605-010</td>
			<td>Cell dissociation reagent</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Grant</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Y27632 (ROCK inhibitor)</td>
			<td>AbMole</td>
			<td>M1817</td>
			<td></td>
		</tr>
	</tbody>
</table>

organoid-derived epithelial monolayer: a clinically relevant in vitro model for intestinal barrier function

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations as the former do not faithfully represent original tissue physiology, and the availability of the latter is limited. Hence, their application hampers fundamental and drug development research. Adult stem-cell-based organoids (henceforth referred to as organoids) are miniatures of normal or diseased epithelial tissue from which they are derived. They can be established very efficiently from different gastrointestinal (GI) tract regions, have long-term expandability, and simulate tissue- and patient-specific responses to treatments in vitro. Here, the establishment of intestinal organoid-derived epithelial monolayers has been demonstrated along with methods to measure epithelial barrier integrity, permeability and transport,&#160;antimicrobial protein secretion, as well as histology. Moreover, intestinal organoid-derived monolayers can be enriched with proliferating stem and transit-amplifying cells as well as with key differentiated epithelial cells. Therefore, they represent a model system that can be tailored to study the effects of compounds on target cells and their mode of action. Although organoid cultures are technically more demanding than cell lines, once established, they can reduce failures in the later stages of drug development as they truly represent in vivo epithelium complexity and interpatient heterogeneity.

Figure 1A shows a representative brightfield image of intestinal organoids after thawing them from a cryovial. It is important to thaw organoids at a high density to ensure optimal recovery. Organoids are plated in 24- or 6-well plates in ECM domes of approximately 10 &#181;L (Figure 1B). Most normal intestinal organoids have a cystic morphology. After recovering from the thawing process, the organoids grow to a bigger size and are ready to be passaged after 3-7...

Watch this Scientific Journal Video about Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function at JoVE.com

Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function

Here, we describe the preparation of human organoid-derived intestinal epithelial monolayers for studying intestinal barrier function, permeability, and transport. As organoids represent original epithelial tissue response to external stimuli, these models combine the advantages of expandability of cell lines and the relevance and complexity of primary tissue.

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations ...

organoid-derived-epithelial-monolayer-clinically-relevant-vitro-model

Microsoft Bing

Research

JoVE Journal

Biology

5.6K Views.  Foundation Hubrecht Organoid Technology (HUB). Here, we describe the preparation of human organoid-derived intestinal epithelial monolayers for studying intestinal barrier function, permeability, and transport. As organoids represent original epithelial tissue response to external stimuli, these models combine the advantages of expandability of cell lines and the relevance and complexity of primary tissue.

Video: Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function

Chromatin Isolation by RNA Purification (ChIRP)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental gene expression 1,2,3,4,5,6,7. The recent discovery of thousands of lncRNAs in association with specific chromatin modification complexes, such as Polycomb Repressive Complex 2 (PRC2) that mediates histone H3 lysine 27 trimethylation (H3K27me3), suggests broad roles for numerous lncRNAs in managing chromatin states in a gene-specific fashion 8,9. While some lncRNAs are thought to work in cis on neighboring genes, other lncRNAs work in trans to regulate distantly located genes. For instance, Drosophila lncRNAs roX1 and roX2 bind numerous regions on the X chromosome of male cells, and are critical for dosage compensation 10,11. However, the exact locations of their binding sites are not known at high resolution. Similarly, human lncRNA HOTAIR can affect PRC2 occupancy on hundreds of genes genome-wide 3,12,13, but how specificity is achieved is unclear. LncRNAs can also serve as modular scaffolds to recruit the assembly of multiple protein complexes. The classic trans-acting RNA scaffold is the TERC RNA that serves as the template and scaffold for the telomerase complex 14; HOTAIR can also serve as a scaffold for PRC2 and a H3K4 demethylase complex 13.
Prior studies mapping RNA occupancy at chromatin have revealed substantial insights 15,16, but only at a single gene locus at a time. The occupancy sites of most lncRNAs are not known, and the roles of lncRNAs in chromatin regulation have been mostly inferred from the indirect effects of lncRNA perturbation. Just as chromatin immunoprecipitation followed by microarray or deep sequencing (ChIP-chip or ChIP-seq, respectively) has greatly improved our understanding of protein-DNA interactions on a genomic scale, here we illustrate a recently published strategy to map long RNA occupancy genome-wide at high resolution 17. This method, Chromatin Isolation by RNA Purification (ChIRP) (Figure 1), is based on affinity capture of target lncRNA:chromatin complex by tiling antisense-oligos, which then generates a map of genomic binding sites at a resolution of several hundred bases with high sensitivity and low background. ChIRP is applicable to many lncRNAs because the design of affinity-probes is straightforward given the RNA sequence and requires no knowledge of the RNA's structure or functional domains.

Chromatin Isolation by RNA Purification ChIRP

ChIRP is a novel and rapid technique to map genomic binding sites of long noncoding RNAs (lncRNAs). The method takes advantage of the specificity of anti-sense tiling oligonucleotides to allow the enumeration of lncRNA-bound genomic sites.

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an attractive model system to study organ development and tissue-specific signaling. Although hair follicle development is genetically tractable, fast and reproducible analysis of factors essential for this process remains a challenge. Here we describe a procedure to generate targeted overexpression or shRNA-mediated knockdown of factors using lentivirus in a tissue-specific manner. Using a modified version of a hair regeneration model 5, 6, 11, we can achieve robust gain- or loss-of-function analysis in primary mouse keratinocytes or dermal cells to facilitate study of epithelial-mesenchymal signaling pathways that lead to hair follicle morphogenesis. We describe how to isolate fresh primary mouse keratinocytes and dermal cells, which contain dermal papilla cells and their precursors, deliver lentivirus containing either shRNA or cDNA to one of the cell populations, and combine the cells to generate fully formed hair follicles on the backs of nude mice. This approach allows analysis of tissue-specific factors required to generate hair follicles within three weeks and provides a fast and convenient companion to existing genetic models.

Tissue-specific analysis of a hair follicle regeneration model using lentivirus to mediate gain- or loss-of-function.

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and epithelial cell integrity, and disruption of the intestinal barrier function contributes to progression of gastrointestinal and systemic disease. Two simple methods are described here to measure the permeability of intestinal epithelium. In vitro, Caco-2BBe cells are plated in tissue culture wells as a monolayer and transepithelial electrical resistance (TER) can be measured by an epithelial (volt/ohm) meter. This method is convincing because of its user-friendly operation and repeatability. In vivo, mice are gavaged with 4 kDa fluorescein isothiocyanate (FITC)-dextran, and the FITC-dextran concentrations are measured in collected serum samples from mice to determine the epithelial permeability. Oral gavage provides an accurate dose, and therefore is the preferred method to measure the intestinal permeability in vivo. Taken together, these two methods can measure the permeability of the intestinal epithelium in vitro and in vivo, and hence be used to study the connection between diseases and barrier function.

In Vitro and In Vivo Approaches to Determine Intestinal Epithelial Cell Permeability

Two methods are presented here to determine intestinal barrier function. An epithelial meter (volt/ohm) is used for measurements of transepithelial electrical resistance of cultured epithelia directly in tissue culture wells. In mice, the FITC-dextran gavage method is used to determine the intestinal permeability in vivo.

The intestinal barrier defends against pathogenic microorganism and microbial toxin. Its function is regulated by tight junction permeability and ...

A Mouse Model of Intestinal Partial Obstruction

Intestinal obstructions, that impede or block peristaltic movement, can be caused by abdominal adhesions and most gastrointestinal (GI) diseases including tumorous growths. However, the cellular remodeling mechanisms involved in, and caused by, intestinal obstructions are poorly understood. Several animal models of intestinal obstructions have been developed, but the mouse model is the most cost/time effective. The mouse model uses the surgical implantation of an intestinal partial obstruction (PO) that has a high mortality rate if it is not performed correctly. In addition, mice receiving PO surgery fail to develop hypertrophy if an appropriate blockade is not used or not properly placed. Here, we describe a detailed protocol for PO surgery which produces reliable and reproducible intestinal obstructions with a very low mortality rate. This protocol utilizes a surgically placed silicone ring that surrounds the ileum which partially blocks digestive movement in the small intestine. The partial blockage makes the intestine become dilated due to the halt of digestive movement. The dilation of the intestine induces smooth muscle hypertrophy on the oral side of the ring that progressively develops over 2 weeks until it causes death. The surgical PO mouse model offers an in vivo model of hypertrophic intestinal tissue useful for studying pathological changes of intestinal cells including smooth muscle cells (SMC), interstitial cells of Cajal (ICC), PDGFR&#945;+, and neuronal cells during the development of intestinal obstruction.

Intestinal obstructions are a partial or complete blockage of the intestine that can cause severe abdominal pain, nausea, vomiting, and preventing the passage of stool. This procedure for creating intestinal partial obsructions in mice is reliable in studying the mechanisms underlying pathological cell growth and death in the intestine.

Intestinal obstructions, that impede or block peristaltic movement, can be caused by abdominal adhesions and most gastrointestinal (GI) diseases including ...

Mass Spectrometry Analysis to Identify Ubiquitylation of EYFP-tagged CENP-A (EYFP-CENP-A)

Studying the structure and the dynamics of kinetochores and centromeres is important in understanding chromosomal instability (CIN) and cancer progression. How the chromosomal location and function of a centromere (i.e., centromere identity) are determined and participate in accurate chromosome segregation is a fundamental question. CENP-A is proposed to be the non-DNA indicator (epigenetic mark) of centromere identity, and CENP-A ubiquitylation is required for CENP-A deposition at the centromere, inherited through dimerization between cell division, and indispensable to cell viability.
Here we describe mass spectrometry analysis to identify ubiquitylation of EYFP-CENP-A K124R mutant suggesting that ubiquitylation at a different lysine is induced because of the EYFP tagging in the CENP-A K124R mutant protein. Lysine 306 (K306) ubiquitylation in EYFP-CENP-A K124R was successfully identified, which corresponds to lysine 56 (K56) in CENP-A through mass spectrometry analysis. A caveat is discussed in the use of GFP/EYFP or the tagging of high molecular weight protein as a tool to analyze the function of a protein. Current technical limit is also discussed for the detection of ubiquitylated bands, identification of site-specific ubiquitylation(s), and visualization of ubiquitylation in living cells or a specific single cell during the whole cell cycle.
The method of mass spectrometry analysis presented here can be applied to human CENP-A protein with different tags and other centromere-kinetochore proteins. These combinatory methods consisting of several assays/analyses could be recommended for researchers who are interested in identifying functional roles of ubiquitylation.

Mass Spectrometry Analysis to Identify Ubiquitylation of EYFP-tagged CENP-A EYFP-CENP-A

CENP-A ubiquitylation is an important requirement for CENP-A deposition at the centromere, inherited through dimerization between cell division, and indispensable to cell viability. Here we describe mass spectrometry analysis to identify ubiquitylation of EYFP-tagged CENP-A (EYFP-CENP-A) protein.

Studying the structure and the dynamics of kinetochores and centromeres is important in understanding chromosomal instability (CIN) and cancer ...

A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes

The mosquito midgut harbors a highly dynamic microbiome that affects the host metabolism, reproduction, fitness, and vector competence. Studies have been conducted to investigate the effect of gut microbes as a whole; however, different microbes could exert distinct effects toward the host. This article provides the methodology to study the effect of each specific mosquito gut microbe and the potential mechanism.
This protocol contains two parts. The first part introduces how to dissect the mosquito midgut, isolate cultivable bacteria colonies, and identify bacteria species. The second part provides the procedure to generate antibiotic-treated mosquitoes and reintroduce one specific bacteria species.

This article presents a protocol to investigate the effect of individual mosquito gut bacteria, including isolation and identification of mosquito midgut cultivable microbes, antibiotic depletion of mosquito gut bacteria, and reintroduce one specific bacteria species.

The mosquito midgut harbors a highly dynamic microbiome that affects the host metabolism, reproduction, fitness, and vector competence. Studies have been ...

In Vitro Analysis of E3 Ubiquitin Ligase Function

The covalent attachment of ubiquitin (Ub) to internal lysine residue(s) of a substrate protein, a process termed ubiquitylation, represents one of the most important post-translational modifications in eukaryotic organisms. Ubiquitylation is mediated by a sequential cascade of three enzyme classes including ubiquitin-activating enzymes (E1 enzymes), ubiquitin-conjugating enzymes (E2 enzymes), and ubiquitin ligases (E3 enzymes), and sometimes, ubiquitin-chain elongation factors (E4 enzymes). Here, in vitro protocols for ubiquitylation assays are provided, which allow the assessment of E3 ubiquitin ligase activity, the cooperation between E2-E3 pairs, and substrate selection. Cooperating E2-E3 pairs can be screened by monitoring the generation of free poly-ubiquitin chains and/or auto-ubiquitylation of the E3 ligase. Substrate ubiquitylation is defined by selective binding of the E3 ligase and can be detected by western blotting of the in vitro reaction. Furthermore, an E2~Ub discharge assay is described, which is a useful tool for the direct assessment of functional E2-E3 cooperation. Here, the E3-dependent transfer of ubiquitin is followed from the corresponding E2 enzyme onto free lysine amino acids (mimicking substrate ubiquitylation) or internal lysines of the E3 ligase itself (auto-ubiquitylation). In conclusion, three different in vitro protocols are provided that are fast and easy to perform to address E3 ligase catalytic functionality.

In Vitro Analysis of E3 Ubiquitin Ligase Function

The present study provides detailed in vitro ubiquitylation assay protocols for the analysis of E3 ubiquitin ligase catalytic activity. Recombinant proteins were expressed using prokaryotic systems such as Escherichia coli culture.

The covalent attachment of ubiquitin (Ub) to internal lysine residue(s) of a substrate protein, a process termed ubiquitylation, represents one of the ...

Intestinal Epithelial Regeneration in Response to Ionizing Irradiation

The intestinal epithelium consists of a single layer of cells yet contains multiple types of terminally differentiated cells, which are generated by the active proliferation of intestinal stem cells located at the bottom of intestinal crypts. However, during events of acute intestinal injury, these active intestinal stem cells undergo cell death. Gamma irradiation is a widely used colorectal cancer treatment, which, while therapeutically efficacious, has the side effect of depleting the active stem cell pool. Indeed, patients frequently experience gastrointestinal radiation syndrome while undergoing radiotherapy, in part due to active stem cell depletion. The loss of active intestinal stem cells in intestinal crypts activates a pool of typically quiescent reserve intestinal stem cells and induces dedifferentiation of secretory and enterocyte precursor cells. If not for these cells, the intestinal epithelium would lack the ability to recover from radiotherapy and other such major tissue insults. New advances in lineage-tracing technologies allow tracking of the activation, differentiation, and migration of cells during regeneration and have been successfully employed for studying this in the gut. This study aims to depict a method for the analysis of cells within the mouse intestinal epithelium following radiation injury.

The gastrointestinal tract is one of the most sensitive organs to injury upon radiotherapeutic cancer treatments. It is simultaneously an organ system with one of the highest regenerative capacities following such insults. The presented protocol describes an efficient method to study the regenerative capacity of the intestinal epithelium.

The intestinal epithelium consists of a single layer of cells yet contains multiple types of terminally differentiated cells, which are generated by the ...

Epithelial Effects of Intestinal Inflammation on Established Murine Colonoids

Studying the Epithelial Effects of Intestinal Inflammation In Vitro on Established Murine Colonoids

The intestinal epithelium plays an essential role in human health, providing a barrier between the host and the external environment. This highly dynamic cell layer provides the first line of defense between microbial and immune populations and helps to modulate the intestinal immune response. Disruption of the epithelial barrier is a hallmark of inflammatory bowel disease (IBD) and is of interest for therapeutic targeting. The 3-dimensional colonoid culture system is an extremely useful in vitro model for studying intestinal stem cell dynamics and epithelial cell physiology in IBD pathogenesis. Ideally, establishing colonoids from the inflamed epithelial tissue of animals would be most beneficial in assessing the genetic and molecular influences on disease. However, we have shown that in vivo epithelial changes are not necessarily retained in colonoids established from mice with acute inflammation. To address this limitation, we have developed a protocol to treat colonoids with a cocktail of inflammatory mediators that are typically elevated during IBD. While this system can be applied ubiquitously to various culture conditions, this protocol emphasizes treatment on both differentiated colonoids and 2-dimensional monolayers derived from established colonoids. In a traditional culture setting, colonoids are enriched with intestinal stem cells, providing an ideal environment to study the stem cell niche. However, this system does not allow for an analysis of the features of intestinal physiology, such as barrier function. Further, traditional colonoids do not offer the opportunity to study the cellular response of terminally differentiated epithelial cells to proinflammatory stimuli. The methods presented here provide an alternative experimental framework to address these limitations. The 2-dimensional monolayer culture system also offers an opportunity for therapeutic drug screening ex vivo. This polarized layer of cells can be treated with inflammatory mediators on the basal side of the cell and concomitantly with putative therapeutics apically to determine their utility in IBD treatment.

Author Spotlight: Studying the Epithelial Effects of Intestinal Inflammation In Vitro on Established Murine Colonoids  

We describe a protocol detailing the isolation of murine colonic crypts for the development of 3-dimensional colonoids. The established colonoids can then be terminally differentiated to reflect the cellular composition of the host epithelium prior to receiving an inflammatory challenge or being directed to establish an epithelial monolayer.

The intestinal epithelium plays an essential role in human health, providing a barrier between the host and the external environment. This highly dynamic ...