This work was supported by the National Natural Science Foundation of China (Grant No. 81902094, 81600497), and the Science and Technology Plan Project of Hunan Province (2019RS1036).

1. Midgut dissection and cultivable bacteria isolation
<ol>
	<li>Prepare the mosquito for dissection.
	<ol>
		<li>Collect the mosquitoes 7&#8211;9 days after emergence with an aspirator. Anesthetize the collected mosquitoes by subjecting them to a temperature of 4 &#176;C for 3&#8211;5 min and keep the mosquitoes anesthetized in an ice-cold Petri dish until dissection.</li>
	</ol>
	</li>
	<li>Sterilize laboratory instruments and the mosquito surface.
	<ol>
		<li>Sterilize the experiment bench, dissecting microscope, forceps, and glass slide by spraying 75% ethanol to avoid contamination by bacteria from the environment.</li>
		<li>Prepare a sterile Petri dish containing 75% ethanol and two Petri dishes containing sterile 1x phosphate buffered saline (1x PBS).</li>
		<li>Surface-sterilize the mosquito by dipping and shaking them in 75% ethanol for 3 min, and rinse twice with 1x PBS buffer in case the ethanol affects the dissected gut flora.</li>
	</ol>
	</li>
	<li>Dissect the mosquito midgut.
	<ol>
		<li>Transfer the surface-sterilized mosquito onto the glass slide with a drop of sterile 1x PBS buffer. Dissect under the dissecting microscope.</li>
		<li>Under the lower magnification of the dissecting microscope, carefully remove the legs, wings, and head of the mosquito to prevent escape. Remove the last somite of the mosquito by cutting directly, rather than pulling it, to prevent the digestive tract from breaking.</li>
		<li>Clamp the mosquito&#39;s thorax and the end of the abdomen with forceps. Gently pull out the mosquito&#39;s digestive tract. The acquired digestive tract usually contains the crop, foregut, midgut, hindgut, and the Malpighian tubes.</li>
		<li>Adjust the dissecting microscope to a higher magnification. Remove the crop, foregut, hindgut, and the Malpighian tubes from the dissected digestive tract to get the midgut of the mosquito.</li>
		<li>Take care while removing the crop, as the crop inflates and resembles the midgut after the mosquito takes a sugar meal. The Malpighian tubes, a group of long and thin excretory tubes, are located at the boundary between the midgut and the hindgut.</li>
	</ol>
	</li>
	<li>Isolate gut bacteria.
	<ol>
		<li>Transfer the dissected midgut to a sterile 1.5 mL tube with 200 &#181;L of sterile 1x PBS buffer.</li>
		<li>Grind the midgut on a sterile bench thoroughly with a sterile pestle to allow complete releasing of gut bacteria to the buffer.</li>
		<li>Serial dilute the homogenate to three 10-fold dilutions. Add 50 &#181;L of each dilution to the LB (Luria broth) agar plate, and then spread it on the plate. If the midgut contains a high concentration of gut flora, it is essential to make more serial dilutions to pick out single colonies.</li>
		<li>Incubate the plate at 37 &#176;C for 1&#8211;2 days until single colonies are visible.</li>
	</ol>
	</li>
	<li>Species identification
	<ol>
		<li>Pick single colonies and inoculate them respectively into a 150 mL conical flask containing 50 mL of LB broth medium.</li>
		<li>Shake the bacteria at 37 &#176;C overnight.</li>
		<li>Extract total DNA by bacterial genomic DNA extraction kit. Amplify 16S rDNA by polymerase chain reaction (PCR). 
		NOTE: There are multiple segments in 16S rDNA that are conserved. Based on these conserved regions, universal primers for bacteria can be designed to amplify 16S rDNA fragments of all bacteria. These primers are specific to bacteria, and the difference in the variable region of 16S rDNA can be used to distinguish different bacteria. Therefore, 16S rDNA is widely used for bacterial identification.</li>
		<li>Recover and purify DNA fragments from PCR products by agarose gel electrophoresis and a commercial gel recovery kit.</li>
		<li>Perform DNA sequencing on the purified DNA fragments to obtain bacterial gene sequences.</li>
		<li>Compare the 16S rRNA gene sequence with the bacterial sequence available in GenBank. Select the Bacteria and Archaea database. 
		NOTE: Identification to the species level was defined as &#8805;99% 16S rDNA sequence similarity to the closest GenBank entry. The isolate was assigned to the corresponding genus when its 16S rDNA sequence similarity was &#60;99% and &#8805;95%.</li>
	</ol>
	</li>
</ol>
2. Antibiotic treatment and bacterium reintroduction
<ol>
	<li>Prepare the antibiotic solution.
	<ol>
		<li>Weigh the required amount of sucrose, penicillin, and streptomycin to prepare a 10% sucrose solution including 20 units of penicillin and 20 &#181;g of streptomycin per mL.</li>
	</ol>
	</li>
	<li>Feed mosquitoes with the antibiotic solution.
	<ol>
		<li>Anesthetize the mosquitoes in 4 &#176;C for 3&#8211;5 min. Transfer the mosquitoes to a paper cup. Cover the top with gauze and enwind the gauze with tape to prevent mosquitoes from escaping.</li>
		<li>Dip sterile cotton balls into the antibiotic solution and place them carefully on the mosquito cup. Squeeze the cotton balls before use to prevent mosquitoes from drowning in the dripping cotton balls.</li>
		<li>Cover the cotton balls with a 10 cm Petri dish to prevent moisture evaporation. Replace the cotton balls twice a day for three consecutive days.</li>
	</ol>
	</li>
	<li>Confirm the effectiveness of the antibiotic treatment.
	<ol>
		<li>According to the above method, dissect the midgut of antibiotic-treated mosquitoes.</li>
		<li>Transfer the dissected midguts to a sterile 1.5 mL tube with 200 &#181;L of sterile 1x PBS buffer.</li>
		<li>Grind midguts in a sterile bench thoroughly with a sterile pestle to allow complete release of gut bacteria to the buffer.</li>
		<li>Extract the gut microbial DNA by bacterial genomic DNA extraction kit.</li>
		<li>Perform bacterial quantitation by real-time quantitative PCR (qPCR) on genomic DNA using universal eubacteria primers (16S rRNA F: TCCTACGGGAGGCAGCAGT and R: GGACTACCAGGGTATCTAATCCTGTT).</li>
	</ol>
	</li>
	<li>Preparation of bacterial suspension
	<ol>
		<li>Measure the bacterial solution with a spectrophotometer. Add 1 OD (OD600) bacterial suspension into a 1 mL tube. Centrifuge the suspension at 5,000 x g for 5 min at 4 &#176;C.</li>
		<li>Discard the supernatant and add 1 mL of sterile 1x PBS buffer to 1.5 mL tube for&#160;suspension precipitation.</li>
		<li>Centrifuge at 5,000 x g for 5 min at 4 &#176;C; discard the supernatant.</li>
		<li>Repeat steps 2.4.2 and 2.4.3.</li>
		<li>Add 200 &#181;L of sterile 1x PBS buffer to the bacterial precipitation.</li>
		<li>Add 600 &#181;L of 10% sucrose solution, 200 &#181;L of 10 mm ATP (which acts as a phagostimulant), and 200 &#181;L of bacterial suspension into a sterile 1.5 mL tube. Mix by vortexing. Alternatively, suspend bacterial pelleted in heat-inactivated blood.</li>
		<li>Preparation of heat-inactivated blood
		<ol>
			<li>Collect fresh blood with an anticoagulant tube.</li>
			<li>Take 2&#8211;3 mL of fresh blood. Centrifuge at 1,000 x g for 10 min at 4 &#176;C to separate plasma and blood cells. Note that the blood will be lost during the centrifugation and washing process; there is a need to calculate the usage in advance.</li>
			<li>Collect the plasma into a new 1.5 mL tube and heat-inactivate at 56 &#176;C for 1 h.</li>
			<li>Add 500 &#181;L of sterile 1x PBS buffer to 1.5 mL tube for&#160;suspension of blood cells. Centrifuge at 1,000 x g for 10 min at 4 &#176;C and then discard the supernatant.</li>
			<li>Repeat step 2.4.7.4 twice.</li>
			<li>Resuspend blood cells with heat-inactivated plasma to obtain heat-inactivated blood.</li>
			<li>Follow steps 2.4.1 to 2.4.4 to get 1 OD bacterial pelleted.</li>
			<li>Resuspend the bacteria pelleted with 1 mL of heat-inactivated blood.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Feed the mosquito with bacteria suspension.
	<ol>
		<li>Starve the mosquitoes for 24 h, allowing antibiotics to metabolize before feeding bacteria.</li>
		<li>Assemble the membrane-feeding system.</li>
		<li>Seal the sterilized feeder unit with a parafilm, alternatively a&#160;collagen membrane.</li>
		<li>Put on a plastic ring and fix it with parafilm to avoid breaking due to friction during feeding.</li>
		<li>Slowly add the prepared bacterial solution to the feeder unit. Note that only one well of the two-well feeder unit can be filled with the solution and cover the feeder unit only from the reagent dropping side.</li>
		<li>Connect the feeder unit to a feeding system preheated to 37 &#176;C, which simulates human temperature to attract mosquitoes. Place the feeding device on a paper cup filled with mosquitoes and feed for 90 min.</li>
		<li>After feeding, anesthetize the mosquitoes by subjecting them to a temperature of 4 &#176;C for 3&#8211;5 min and keep the mosquitoes anesthetized in an ice-cold Petri dish.</li>
		<li>Pick the fully engorged mosquitoes for further studies.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Tolle, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosquito-borne+diseases.">Mosquito-borne diseases.</a> Current Problems in Pediatric and Adolescent Health Care. 39 (4), 97-140 (2009).</li><li>Wu, P., Yu, X., Wang, P., Cheng, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arbovirus+lifecycle+in+mosquito:+acquisition,+propagation+and+transmission.">Arbovirus lifecycle in mosquito: acquisition, propagation and transmission.</a> Expert Reviews in Molecular Medicine. 21, 1 (2019).</li><li>Jayakrishnan, L., Sudhikumar, A. V., Aneesh, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+gut+inhabitants+on+vectorial+capacity+of+mosquitoes.">Role of gut inhabitants on vectorial capacity of mosquitoes.</a> Journal of Vector Borne Diseases. 55 (2), 69 (2018).</li><li>Jupatanakul, N., Sim, S., Dimopoulos, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+insect+microbiome+modulates+vector+competence+for+arboviruses.">The insect microbiome modulates vector competence for arboviruses.</a> Viruses. 6 (11), 4294-4313 (2014).</li><li>Moro, C. V., Tran, F. H., Raharimalala, F. N., Ravelonandro, P., Mavingui, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+of+culturable+bacteria+including+Pantoea+in+wild+mosquito+Aedes+albopictus.">Diversity of culturable bacteria including Pantoea in wild mosquito Aedes albopictus.</a> BMC Microbiology. 13 (1), 70 (2013).</li><li>Chouaia, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+evidence+for+multiple+infections+as+revealed+by+typing+of+Asaia+bacterial+symbionts+of+four+mosquito+species.">Molecular evidence for multiple infections as revealed by typing of Asaia bacterial symbionts of four mosquito species.</a> Applied and Environmental Microbiology. 76 (22), 7444-7450 (2010).</li><li>Terenius, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Midgut+bacterial+dynamics+in+Aedes+aegypti.">Midgut bacterial dynamics in Aedes aegypti.</a> FEMS Microbiology Ecology. 80 (3), 556-565 (2012).</li><li>Bando, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intra-specific+diversity+of+Serratia+marcescens+in+Anopheles+mosquito+midgut+defines+Plasmodium+transmission+capacity.">Intra-specific diversity of Serratia marcescens in Anopheles mosquito midgut defines Plasmodium transmission capacity.</a> Scientific Reports. 3, 1641 (2013).</li><li>Telang, A., Skinner, J., Nemitz, R. Z., McClure, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Metagenome+and+culture-based+methods+reveal+candidate+bacterial+mutualists+in+the+Southern+house+mosquito+(Diptera:+Culicidae).">Metagenome and culture-based methods reveal candidate bacterial mutualists in the Southern house mosquito (Diptera: Culicidae).</a> Journal of Medical Entomology. 55 (5), 1170-1181 (2018).</li><li>Wang, Y., Gilbreath, T. M., Kukutla, P., Yan, G., Xu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+gut+microbiome+across+life+history+of+the+malaria+mosquito+Anopheles+gambiae+in+Kenya.">Dynamic gut microbiome across life history of the malaria mosquito Anopheles gambiae in Kenya.</a> PloS One. 6 (9), (2011).</li><li>Xiao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Mesh-Duox+pathway+regulates+homeostasis+in+the+insect+gut.">A Mesh-Duox pathway regulates homeostasis in the insect gut.</a> Nature Microbiology. 2 (5), 17020 (2017).</li><li>Gu&#233;gan, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Short-term+impacts+of+anthropogenic+stressors+on+Aedes+albopictus+mosquito+vector+microbiota.">Short-term impacts of anthropogenic stressors on Aedes albopictus mosquito vector microbiota.</a> FEMS Microbiology Ecology. 94 (12), 188 (2018).</li><li>Valzania, L., Coon, K. L., Vogel, K. J., Brown, M. R., Strand, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hypoxia-induced+transcription+factor+signaling+is+essential+for+larval+growth+of+the+mosquito+Aedes+aegypti.">Hypoxia-induced transcription factor signaling is essential for larval growth of the mosquito Aedes aegypti.</a> Proceedings of the National Academy of Sciences of the United States of America. 115 (3), 457-465 (2018).</li><li>Coon, K. L., Vogel, K. J., Brown, M. R., Strand, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosquitoes+rely+on+their+gut+microbiota+for+development.">Mosquitoes rely on their gut microbiota for development.</a> Molecular Ecology. 23 (11), 2727-2739 (2014).</li><li>de O Gaio, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+midgut+bacteria+to+blood+digestion+and+egg+production+in+Aedes+aegypti+(diptera:+culicidae)(L).">Contribution of midgut bacteria to blood digestion and egg production in Aedes aegypti (diptera: culicidae)(L).</a> Parasites &amp; Vectors. 4 (1), 105 (2011).</li><li>Ramirez, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reciprocal+tripartite+interactions+between+the+Aedes+aegypti+midgut+microbiota,+innate+immune+system+and+dengue+virus+influences+vector+competence.">Reciprocal tripartite interactions between the Aedes aegypti midgut microbiota, innate immune system and dengue virus influences vector competence.</a> PLoS Neglected Tropical Diseases. 6 (3), 1561 (2012).</li><li>Dong, Y., Morton, J. C., Ramirez, J. L., Souza-Neto, J. A., Dimopoulos, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+entomopathogenic+fungus+Beauveria+bassiana+activate+toll+and+JAK-STAT+pathway-controlled+effector+genes+and+anti-dengue+activity+in+Aedes+aegypti.">The entomopathogenic fungus Beauveria bassiana activate toll and JAK-STAT pathway-controlled effector genes and anti-dengue activity in Aedes aegypti.</a> Insect Biochemistry and Molecular Biology. 42 (2), 126-132 (2012).</li><li>Anglero-Rodriguez, Y. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Aedes+aegypti-associated+fungus+increases+susceptibility+to+dengue+virus+by+modulating+gut+trypsin+activity.">An Aedes aegypti-associated fungus increases susceptibility to dengue virus by modulating gut trypsin activity.</a> Elife. 6, 28844 (2017).</li><li>Wu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+gut+commensal+bacterium+promotes+mosquito+permissiveness+to+arboviruses.">A gut commensal bacterium promotes mosquito permissiveness to arboviruses.</a> Cell Host &amp; Microbe. 25 (1), 101-112 (2019).</li><li>M&#246;hlmann, T. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Impact+of+gut+bacteria+on+the+infection+and+transmission+of+pathogenic+arboviruses+by+biting+midges+and+mosquitoes.">Impact of gut bacteria on the infection and transmission of pathogenic arboviruses by biting midges and mosquitoes.</a> Microbial Ecology. , (2020).</li><li>Llorca, M., Gros, M., Rodr&#237;guez-Mozaz, S., Barcel&#243;, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sample+preservation+for+the+analysis+of+antibiotics+in+water.">Sample preservation for the analysis of antibiotics in water.</a> Journal of Chromatography. A. 1369, 43-51 (2014).</li><li>Berendsen, B., Elbers, I., Stolker, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+the+stability+of+antibiotics+in+matrix+and+reference+solutions+using+a+straightforward+procedure+applying+mass+spectrometric+detection.">Determination of the stability of antibiotics in matrix and reference solutions using a straightforward procedure applying mass spectrometric detection.</a> Food Additives &amp; Contaminants: Part A, Chemistry, Analysis, Control, Exposure &amp; Risk Assessment. 28 (12), 1657-1666 (2011).</li><li>Hill, C. L., Sharma, A., Shouche, Y., Severson, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamics+of+midgut+microflora+and+dengue+virus+impact+on+life+history+traits+in+Aedes+aegypti.">Dynamics of midgut microflora and dengue virus impact on life history traits in Aedes aegypti.</a> Acta Tropica. 140, 151-157 (2014).</li><li>Eng, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multifaceted+functional+implications+of+an+endogenously+expressed+tRNA+fragment+in+the+vector+mosquito+Aedes+aegypti.">Multifaceted functional implications of an endogenously expressed tRNA fragment in the vector mosquito Aedes aegypti.</a> PLoS Neglected Tropical Diseases. 12 (1), 0006186 (2018).</li><li>Kajla, M. K., Barrett-Wilt, G. A., Paskewitz, S. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacteria:+A+novel+source+for+potent+mosquito+feeding-deterrents.">Bacteria: A novel source for potent mosquito feeding-deterrents.</a> Science Advances. 5 (1), 6141 (2019).</li><li>Gon&#231;alves, G. G. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Use+of+MALDI-TOF+MS+to+identify+the+culturable+midgut+microbiota+of+laboratory+and+wild+mosquitoes.">Use of MALDI-TOF MS to identify the culturable midgut microbiota of laboratory and wild mosquitoes.</a> Acta Tropica. 200, 105174 (2019).</li><li>Kuss, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+microbiota+promote+enteric+virus+replication+and+systemic+pathogenesis.">Intestinal microbiota promote enteric virus replication and systemic pathogenesis.</a> Science. 334 (6053), 249-252 (2011).</li><li>Rani, A., Sharma, A., Rajagopal, R., Adak, T., Bhatnagar, R. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bacterial+diversity+analysis+of+larvae+and+adult+midgut+microflora+using+culture-dependent+and+culture-independent+methods+in+lab-reared+and+field-collected+Anopheles+stephensi-an+Asian+malarial+vector.">Bacterial diversity analysis of larvae and adult midgut microflora using culture-dependent and culture-independent methods in lab-reared and field-collected Anopheles stephensi-an Asian malarial vector.</a> BMC Microbiology. 9 (1), (2009).</li><li>Apte-Deshpande, A., Paingankar, M., Gokhale, M. D., Deobagkar, D. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serratia+odorifera+a+midgut+inhabitant+of+Aedes+aegypti+mosquito+enhances+its+susceptibility+to+dengue-2+virus.">Serratia odorifera a midgut inhabitant of Aedes aegypti mosquito enhances its susceptibility to dengue-2 virus.</a> PLoS One. 7 (7), 40401 (2012).</li><li>Behura, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mosquito+microbiota+and+metagenomics,+and+its+relevance+to+disease+transmission.">Mosquito microbiota and metagenomics, and its relevance to disease transmission.</a> Nature. 436, 257-260 (2013).</li><li>Dickson, L. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diverse+laboratory+colonies+of+Aedes+aegypti+harbor+the+same+adult+midgut+bacterial+microbiome.">Diverse laboratory colonies of Aedes aegypti harbor the same adult midgut bacterial microbiome.</a> Parasites &amp; Vectors. 11 (1), 1-8 (2018).</li></ol>

The authors have no conflicts of interest to disclose.

Research on host-microbe interactions have found that different gut microbes affect their host physiology via divergent mechanisms. This article introduces the method to investigate the respective role of mosquito gut microbe, including dissecting mosquito midgut, culturing cultivable gut bacteria, antibiotic treatment, and reintroducing the bacteria of interest.
For successful antibiotic treatment, the following details must be considered in conducting the experiment. In this protocol, mosqui...

Mosquitoes are considered to be the most important vectors of human pathogenic diseases, transmitting over a hundred pathogens including Zika virus, Dengue virus, and Plasmodium parasites1. When mosquitoes take a blood meal to acquire nutrients for oviposition, they can accidentally ingest pathogens from an infected host via the digestive tract2. Importantly, the mosquito midgut, which plays a pivotal role in both blood meal digestion and pathogen entrance, harbors a highly dynamic microbiome3.
Several studies have characterized lab-reared and field-collected mosquito microbiota using either a culture-dependent method or a bacteria sequencing assay4,5,6. Species including Pantoea, Serratia, Klebsiella, Elizabethkingia, and Enterococcus are commonly isolated from mosquitoes in various studies5,7,8,9. Interestingly, mosquito gut microbiota fluctuates dynamically in both the community diversity and the amount of bacteria species, affected by the development stage, species, geographical origin, and feeding behavior4. Studies show that blood feeding dramatically increases the total bacterial load with rapid expansion of species from Enterobacteriaceae and a reduction in overall diversity10,11. In addition, mosquito gut microbiota of the larval stage is usually eradicated when the insect undergoes metamorphosis during pupation and eclosion; thus, newly emerged adult mosquitoes need to repopulate their microbiota4.
Gut microbiota modulates insect physiology in various aspects, including nutrient absorption, immunity, development, reproduction, and vector competence12. Axenic mosquito larvae fail to develop beyond the first instar while a bacteria oral supply rescues development, indicating that the mosquito gut microbe is essential for larval development13,14. Besides, depletion of gut bacteria retards blood meal digestion and nutrient absorption, affects oocyte maturation, and decreases oviposition15. In addition, mosquitoes with gut microflora elicit higher immune responses compared to antibiotic-treated mosquitoes, with constantly elevated antimicrobial peptide expression against other pathogens to infect16. Antibiotics are usually orally administered to remove pan gut bacteria in these studies, and then experiments are conducted to compare the difference between axenic mosquitoes and mosquitoes with commensal microbes. However, the mosquito midgut harbors a diverse community of microbes, and each bacteria species could exert a distinct effect toward the host physiology.
Mosquito microbiota regulates vector competence with divergent effects. Colonization by Proteus isolated from field-derived mosquitoes of dengue-endemic areas confers upregulated antimicrobial peptide expression and resistance against dengue virus infection16. The entomopathogenic fungus Beauveria bassiana activates the Toll and JAK-STAT immune pathway against arbovirus infection17. By contrast, the fungus Talaromyces isolated from Aedes aegypti midgut facilitates dengue virus infection by modulating gut trypsin activity18. In addition, Serratia marcescens promotes arbovirus transmission through a secretory protein called SmEnhancin, which digests the mucin layer on the intestinal epithelium of mosquitoes19.
This procedure provides a systematic and intuitive method for dissection of the mosquito midgut, isolation of cultivable bacteria colonies, identification of the bacteria species, and reintroduction via oral feeding. It provides representative results of blood feeding with a commensal bacterium, Chryseobacterium meningosepticum, on mosquito ovary development and oviposition.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr >
			<td >Adenosine 5&#8242;-triphosphate disodium salt hydrate</td>
			<td >Sigma</td>
			<td >A2383</td>
			<td >Adenosine 5&#8242;-triphosphate disodium salt hydrate has been used to prepare adenosine triphosphate (ATP) standard solutions</td>
		</tr>
		<tr >
			<td >Aedes aegypti</td>
			<td></td>
			<td></td>
			<td>Female mosquitoes</td>
		</tr>
		<tr >
			<td >Anticoagulant tube</td>
			<td>BD Vacutainer</td>
			<td>363095</td>
			<td>Collect fresh blood</td>
		</tr>
		<tr >
			<td >Centrifuge tube</td>
			<td>Sangon Biotech</td>
			<td>F601620-0010</td>
			<td>1.5 ml, Natural, Graduated, Sterile</td>
		</tr>
		<tr >
			<td >Cotton balls</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr >
			<td >Disposable Tissue Grinding Pestle</td>
			<td>Sangon Biotech</td>
			<td>F619072-0001</td>
			<td>70 mm Long, Conical, Blue, Sterile</td>
		</tr>
		<tr >
			<td >Ethanol absolute</td>
			<td>Paini</td>
			<td></td>
			<td>Dilute it to 75% ethanol</td>
		</tr>
		<tr >
			<td >Forceps</td>
			<td>RWD</td>
			<td>F11029</td>
			<td>Dissection</td>
		</tr>
		<tr >
			<td >Hemotek Membrane Feeding System</td>
			<td>Hemotek</td>
			<td></td>
			<td>Components of the feeding system, including&#160; Hemotek temperature controller, feeder-housing assembly, metal feeder assembled.</td>
		</tr>
		<tr >
			<td >Incubator shaker</td>
			<td></td>
			<td>ZQZY-78AN</td>
			<td></td>
		</tr>
		<tr >
			<td >Inoculation Loops</td>
			<td>Sangon Biotech</td>
			<td>F619312-0001</td>
			<td>10 &#956;l, Yellow</td>
		</tr>
		<tr >
			<td >LB Agar Powder</td>
			<td>Sangon Biotech</td>
			<td>A507003</td>
			<td>Tryptone 10.0 g&#65307; Yeast Extract 5.0 g&#65307; NaCl 10.0 g&#65307; Agar 15.0 g.</td>
		</tr>
		<tr >
			<td >LB Broth Powder</td>
			<td>Sangon Biotech</td>
			<td>A507002</td>
			<td>Tryptone 10.0 g&#65307; Yeast Extract 5.0 g&#65307; NaCl 10.0 g.</td>
		</tr>
		<tr >
			<td >Microscope</td>
			<td>Zeiss</td>
			<td>Stemi508</td>
			<td></td>
		</tr>
		<tr >
			<td >Paper cup</td>
			<td></td>
			<td></td>
			<td>Place mosquito</td>
		</tr>
		<tr >
			<td >Parafilm</td>
			<td>Sangon Biotech</td>
			<td>F104002</td>
			<td>4 inx 125 ft</td>
		</tr>
		<tr >
			<td >Petri dish</td>
			<td>Sangon Biotech</td>
			<td>F611203</td>
			<td></td>
		</tr>
		<tr >
			<td >Penicillin G procaine salt hydrate</td>
			<td>Sangon Biotech</td>
			<td>A606248</td>
			<td>White powder. Soluble in water, soluble in methanol, slightly soluble in water, ethanol</td>
		</tr>
		<tr >
			<td >Single Channal Pipettor</td>
			<td>Gilson</td>
			<td></td>
			<td></td>
		</tr>
		<tr >
			<td >Streptomycin sulfate</td>
			<td>Sangon Biotech</td>
			<td>A610494</td>
			<td>Streptomycin sulfate is a glucosamine antibiotic that interferes with the synthesis of prokaryotic proteins.</td>
		</tr>
		<tr >
			<td >Sucrose</td>
			<td>Sangon Biotech</td>
			<td>A502792</td>
			<td>Soluble in water, ethanol and methanol, slightly soluble in glycerol and pyridine.</td>
		</tr>
		<tr >
			<td >TIANamp Bacteria DNA Kit</td>
			<td>TIANGEN</td>
			<td>DP302</td>
			<td>Extract DNA&#160;</td>
		</tr>
		<tr >
			<td >Utility Fabric-Mosquito Netting White</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr >
			<td >Vortex mixer</td>
			<td>Scintic Industries</td>
			<td>S1-0246</td>
			<td></td>
		</tr>
		<tr >
			<td >1.5ml EP tube</td>
			<td>Sangon Biotech</td>
			<td>F600620</td>
			<td></td>
		</tr>
		<tr >
			<td >10X PBS buffer</td>
			<td>Sangon Biotech</td>
			<td>E607016</td>
			<td>This product is a 10X solution. Please dilute it 10 times before use. The pH value is 7.4.</td>
		</tr>
	</tbody>
</table>

a bacterial oral feeding assay with antibiotic-treated mosquitoes

The mosquito midgut harbors a highly dynamic microbiome that affects the host metabolism, reproduction, fitness, and vector competence. Studies have been conducted to investigate the effect of gut microbes as a whole; however, different microbes could exert distinct effects toward the host. This article provides the methodology to study the effect of each specific mosquito gut microbe and the potential mechanism.
This protocol contains two parts. The first part introduces how to dissect the mosquito midgut, isolate cultivable bacteria colonies, and identify bacteria species. The second part provides the procedure to generate antibiotic-treated mosquitoes and reintroduce one specific bacteria species.

The midguts of mosquitoes treated with antibiotics and without antibiotics were taken out for DNA extraction, and qPCR was performed with universal bacterial primers. Figure 1 shows the expression of bacterial 16S rRNA in the control group and antibiotic treatment group. The results show that about 98% of the gut bacteria have been removed, and the gut sterilization of penicillin and streptomycin was successful.
With the methods described, bacteria strains were isolated and id...

Watch this Scientific Journal Video about A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes at JoVE.com

A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes

This article presents a protocol to investigate the effect of individual mosquito gut bacteria, including isolation and identification of mosquito midgut cultivable microbes, antibiotic depletion of mosquito gut bacteria, and reintroduce one specific bacteria species.

The mosquito midgut harbors a highly dynamic microbiome that affects the host metabolism, reproduction, fitness, and vector competence. Studies have been ...

a-bacterial-oral-feeding-assay-with-antibiotic-treated-mosquitoes

Research

JoVE Journal

Biology

6.2K Views.  Hunan Normal University. This article presents a protocol to investigate the effect of individual mosquito gut bacteria, including isolation and identification of mosquito midgut cultivable microbes, antibiotic depletion of mosquito gut bacteria, and reintroduce one specific bacteria species.

Video: A Bacterial Oral Feeding Assay with Antibiotic-Treated Mosquitoes

Protocols for Oral Infection of Lepidopteran Larvae with Baculovirus

Baculoviruses are widely used both as protein expression vectors and as insect pest control agents. This video shows how lepidopteran larvae can be infected with polyhedra by droplet feeding and diet plug-based bioassays. This accompanying Springer Protocols section provides an overview of the baculovirus lifecycle and use of baculoviruses as insecticidal agents, including discussion of the pros and cons for use of baculoviruses as insecticides, and progress made in genetic enhancement of baculoviruses for improved insecticidal efficacy.

In this video, we demonstrate oral infection techniques of lepidopteran larvae with baculovirus in order to determine insecticidal efficiency.

Baculoviruses are widely used both as protein expression vectors and as insect pest control agents. This video shows how lepidopteran larvae can be ...

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion rate. This method can be used to obtain a better understanding of the process of diuresis in insects and is especially useful in the study of diuresis in blood-feeding arthropods that are able to take up huge amounts of liquid in a single blood meal. 
This RNAi-mediated gene knockdown combined with an in vivo diuresis assay was developed by the Hansen lab to study the effects of RNAi-mediated knockdown of aquaporin genes on Aedes aegypti mosquito diuresis1. 
The protocol is setup in two parts: the first demonstration illustrates how to construct a simple mosquito injection device and how to prepare and inject dsRNA into the thorax of mosquitoes for RNAi-mediated gene knockdown. The second demonstration illustrates how to determine excretion rates in mosquitoes using an in vivo bioassay.

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

In this protocol we combine RNAi-mediated gene silencing with an in vivo diuresis assay to study the effects knockdown of genes of interest has on mosquito fluid excretion.

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion ...

A Multi-detection Assay for Malaria Transmitting Mosquitoes

The Anopheles gambiae species complex includes the major malaria transmitting mosquitoes in Africa. Because these species are of such medical importance, several traits are typically characterized using molecular assays to aid in epidemiological studies. These traits include species identification, insecticide resistance, parasite infection status, and host preference. Since populations of the Anopheles gambiae complex are morphologically indistinguishable, a polymerase chain reaction (PCR) is traditionally used to identify species. Once the species is known, several downstream assays are routinely performed to elucidate further characteristics. For instance, mutations known as KDR in a para gene confer resistance against DDT and pyrethroid insecticides. Additionally, enzyme-linked immunosorbent assays (ELISAs) or Plasmodium parasite DNA detection PCR assays are used to detect parasites present in mosquito tissues. Lastly, a combination of PCR and restriction enzyme digests can be used to elucidate host preference (e.g., human vs. animal blood) by screening the mosquito bloodmeal for host-specific DNA. We have developed a multi-detection assay (MDA) that combines all of the aforementioned assays into a single multiplex reaction genotyping 33SNPs for 96 or 384 samples at a time. Because the MDA includes multiple markers for species, Plasmodium detection, and host blood identification, the likelihood of generating false positives or negatives is greatly reduced from previous assays that include only one marker per trait. This robust and simple assay can detect these key mosquito traits cost-effectively and in a fraction of the time of existing assays.

Malaria transmitting mosquitoes have a number of epidemiologically important characteristics that can only be detected using molecular techniques. Utilizing a MALDI-TOF based SNP genotyping platform, we developed an assay for simultaneously detecting multiple key traits (species, insecticide resistance, parasite infection and host choice) of malaria vectors.

The Anopheles gambiae species complex includes the major malaria transmitting mosquitoes in Africa. Because these species are of such medical importance, ...

High-fat Feeding Paradigm for Larval Zebrafish: Feeding, Live Imaging, and Quantification of Food Intake

Zebrafish are emerging as a model of dietary lipid processing and metabolic disease. This protocol describes how to feed larval zebrafish a lipid-rich meal, which consists of an emulsion of chicken egg yolk liposomes created by sonicating egg yolk in embryo media. Detailed instructions are provided to screen larvae for egg yolk consumption so that larvae that fail to feed will not confound experimental results. The chicken egg yolk liposomes can be spiked with fluorescent lipid analogs, including fatty acids and cholesterol, enabling both systemic and subcellular visualization of dietary lipid processing. Several methods are described to mount larvae that are conducive to short- and long-term live imaging with both upright and inverted objectives at high and low magnification. Additionally presented is an assay to quantify larval food intake by extracting the lipids of larvae fed fluorescent lipid analogs, spotting the lipids on a thin layer chromatography plate, and quantifying the fluorescence. Finally, critical aspects of the procedures, important controls, options for modifying the protocols to address specific experimental questions, and potential limitations are discussed. These techniques can be applied not only to focused, hypothesis driven inquiries, but also to a variety of screens and live imaging techniques to study dietary lipid metabolism and the control of food intake.

Zebrafish are emerging as a valuable model of dietary lipid processing and metabolic disease. Described are protocols of lipid-rich larval feeds, live imaging of dietary fluorescent lipid analogs, and quantification of food intake. These techniques can be applied to a variety of screening, imaging, and hypothesis driven inquiry techniques.

Zebrafish are emerging as a model of dietary lipid processing and metabolic disease. This protocol describes how to feed larval zebrafish a lipid-rich ...

Maintaining Aedes aegypti Mosquitoes Infected with Wolbachia

Aedes aegypti mosquitoes experimentally infected with Wolbachia are being utilized in programs to control the spread of arboviruses such as dengue, chikungunya and Zika. Wolbachia-infected mosquitoes can be released into the field to either reduce population sizes through incompatible matings or to transform populations with mosquitoes that are refractory to virus transmission. For these strategies to succeed, the mosquitoes released into the field from the laboratory must be competitive with native mosquitoes. However, maintaining mosquitoes in the laboratory can result in inbreeding, genetic drift and laboratory adaptation which can reduce their fitness in the field and may confound the results of experiments. To test the suitability of different Wolbachia infections for deployment in the field, it is necessary to maintain mosquitoes in a controlled laboratory environment across multiple generations. We describe a simple protocol for maintaining Ae. aegypti mosquitoes in the laboratory, which is suitable for both Wolbachia-infected and wild-type mosquitoes. The methods minimize laboratory adaptation and implement outcrossing to increase the relevance of experiments to field mosquitoes. Additionally, colonies are maintained under optimal conditions to maximize their fitness for open field releases.

Maintaining Aedes aegypti Mosquitoes Infected with Wolbachia

Aedes aegypti mosquitoes infected with Wolbachia are being released into natural populations to suppress the transmission of arboviruses. We describe methods to rear Ae. aegypti with Wolbachia infections in the laboratory for experiments and field release, taking precautions to minimize laboratory adaptation and selection.

Aedes aegypti mosquitoes experimentally infected with Wolbachia are being utilized in programs to control the spread of arboviruses such as dengue, ...

Oral Bacterial Infection and Shedding in Drosophila melanogaster

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic infections, there has been a recent increase of interest in the mechanisms of gut immunocompetence to pathogens, which require methods to orally infect flies. Here we present a protocol to orally expose individual flies to an opportunistic bacterial pathogen (Pseudomonas aeruginosa) and a natural bacterial pathogen of D. melanogaster (Pseudomonas entomophila). The goal of this protocol is to provide a robust method to expose male and female flies to these pathogens. We provide representative results showing survival phenotypes, microbe loads, and bacterial shedding, which is relevant for the study of heterogeneity in pathogen transmission. Finally, we confirm that Dcy mutants (lacking the protective peritrophic matrix in the gut epithelium) and Relish mutants (lacking a functional immune deficiency (IMD) pathway), show increased susceptibility to bacterial oral infection. This protocol, therefore, describes a robust method to infect flies using the oral route of infection, which can be extended to the study of a variety genetic and environmental sources of variation in gut infection outcomes and bacterial transmission.

Oral Bacterial Infection and Shedding in Drosophila melanogaster

This protocol describes methods to orally expose and infect the fruit fly Drosophila melanogaster with bacterial pathogens, and to measure the number of infectious bacteria shed following gut infection. We further describe the effect of immune mutants on fly survival following oral bacterial infection.

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic ...

Protocols for Testing the Toxicity of Novel Insecticidal Chemistries to Mosquitoes

New classes of insecticides with novel modes of action are needed to control insecticide resistant populations of mosquitoes that transmit diseases such as Zika, dengue and malaria. Assays for rapid, high-throughput analyses of unformulated novel chemistries against mosquito larvae and adults are presented. We describe protocols for single point-dose and dose response assays to evaluate the toxicity of small molecule chemistries to the Aedes aegypti vector of Zika, dengue and yellow fever,&#160;the malaria vector, Anopheles gambiae and the northern house mosquito, Culex quinquefasciatus, on contact and via ingestion. As an example, we evaluated the toxicity of amitriptyline, a small molecule antagonist of G protein-coupled receptors, via larval, adult topical and adult blood-feeding assay. The protocols provide a starting point to investigate insecticide potential. Results are discussed in the context of additional experiments to explore product applications and mechanisms for delivery.

Protocols are described for assessing the toxicity of chemistries to immature and adult mosquitoes for development as new classes of larvicides, adulticides and endectocides. The protocols enable high-throughput testing of multiple chemistries at single-point dose and subsequent evaluation via dose response assay to determine toxicity on contact or via ingestion.

New classes of insecticides with novel modes of action are needed to control insecticide resistant populations of mosquitoes that transmit diseases such ...

Forced Salivation As a Method to Analyze Vector Competence of Mosquitoes

Vector competence is defined as the potential of a mosquito species to transmit a mosquito-borne virus (mobovirus) to a vertebrate host. Viable virus particles are transmitted during a blood meal via the saliva of an infected mosquito. Forced salivation assays allow determining the vector potential on the basis of single mosquitoes, avoiding the use of animal experiments. The method is suitable to analyze a large number of mosquitoes in one experiment within a short period of time. Forced salivation assays were used to analyze 856 individual mosquitoes trapped in Germany, including two different Culex pipiens pipiens biotypes, Culex torrentium as well as Aedes albopictus, which were experimentally infected with Zika virus (ZIKV) and incubated at 18 &#176;C or 27 &#176;C for two and three weeks. The results indicated the lack of vector competence of the different Culex taxa for ZIKV. In contrast, Aedes albopictus was susceptible to ZIKV, but only at 27 &#176;C, with transmission rates similar to an Aedes aegypti laboratory colony tested in parallel.

For efficient control of mosquito borne virus transmission, the knowledge of the vector potential of respective mosquitoes is of particular interest. We describe forced salivation as a method to analyze vector competence of Aedes albopictus and three different Culex taxa for the transmission of Zika virus.

Vector competence is defined as the potential of a mosquito species to transmit a mosquito-borne virus (mobovirus) to a vertebrate host. Viable virus ...

A Blood-Free Diet to Rear Anopheline Mosquitoes

Malaria research requires large-scale breeding and production conditions for mosquitoes (Anopheles spp.) in captivity. The sustainable and reliable production of mosquitoes is currently inhibited by the supply of fresh vertebrate blood. Alternatives to blood are required to promote efficient control strategies for malaria and other vector borne diseases that are transmitted by blood feeding insects. With this in mind, artificial liquid diets were formulated as substitutes for fresh vertebrate blood. Herein we report a blood-free artificial liquid diet that delivers feeding rates similar to blood and mimics the physiological effects of a fresh vertebrate blood meal. The diet induces ovarian and egg maturation of Anopheles mosquitoes and also produces good larval survival and development of functional adults. The formulated blood-free liquid diet is an important advance towards sustainable mosquito breeding in captivity and will reduce the maintenance costs of mosquito colonies and eliminate the need for fresh vertebrate blood.

A protocol is presented for formulation of a blood-free artificial diet to feed Anopheles mosquitoes in captivity. This diet has a similar performance to vertebrate blood and triggers oogenesis and egg maturation and produces viable adult progeny.

Malaria research requires large-scale breeding and production conditions for mosquitoes (Anopheles spp.) in captivity. The sustainable and reliable ...

Detection of Plasmodium Sporozoites in Anopheles Mosquitoes using an Enzyme-linked Immunosorbent Assay

Plasmodium sporozoites are the infective stage of malaria parasites that infect humans. The sporozoites residing in the salivary glands of female Anopheles mosquitoes are transmitted to humans via mosquito bites during blood feeding. The presence of sporozoites in the mosquito salivary glands thus defines mosquito infectiousness. To determine whether an Anopheles mosquito carries Plasmodium sporozoites, the enzyme-linked immunosorbent assay (ELISA) method has been the standard tool to detect the Plasmodium circumsporozoite protein (CSP), the major surface protein of the sporozoites. In this method, the head along with the thorax of each mosquito is separated from the abdomen, homogenized, and subjected to a sandwich ELISA to detect the presence of CSP specific to Plasmodium falciparum and each of the two subtypes, VK210 and VK247, of Plasmodium vivax.This method has been used to study malaria transmission, including the seasonal dynamics of mosquito infection and the species of the major malaria vectors in the study sites.

Detection of Plasmodium Sporozoites in Anopheles Mosquitoes using an Enzyme-linked Immunosorbent Assay

This protocol describes a sandwich enzyme-linked immunosorbent assay to detect salivary gland sporozoites in mosquitoes. Using easily available monoclonal antibodies, the method enables cost-effective, high-throughput detection of mosquitoes carrying Plasmodium falciparum or Plasmodium vivax. The method is suitable for malaria transmission research, including vector surveys.