This work was supported by UNAM Technology Innovation and Research Support Program (PAPIIT) grant number IN207319 and the Science and Technology National Council (CONACyT-FORDECyT) grant number 303068. A.E.-L. is a master&#39;s student supported by the Science and Technology National Council (CONACyT) CVU number 968128.

1. Fixation
<ol>
	<li>Start with 10 million Schneider&#39;s line 2 plus (S2R+) cells to prepare 17.5 mL of a cell suspension in Schneider medium containing 10% fetal bovine serum (FBS) at room temperature (RT).</li>
	<li>Add methanol-free formaldehyde to obtain a final concentration of 2%. Mix and incubate for 10 min at RT, taking care to mix every minute. 
	NOTE: Formaldehyde is a hazardous chemical. Follow the appropriate health and safety regulations, and work in the fume hood.</li>
	<li>Quench the reaction by adding glycine to achieve a final concentration of 0.125 M and mix. Incubate for 5 min at RT, followed by 15 min on ice.</li>
	<li>Centrifuge for 400 &#215; g at RT for 5 min and then for 10 min at 4 &#176;C; discard the supernatant. Resuspend the pellet carefully in 25 mL of cold 1x phosphate-buffered saline.</li>
	<li>Centrifuge at 400 &#215; g for 10 min at 4 &#176;C, then discard the supernatant. 
	NOTE: If continuing with the protocol, go to step 2.1 for lysis; otherwise, flash-freeze the pellet in liquid N2 and store the pellet at -80 &#176;C.</li>
</ol>
2. Lysis
<ol>
	<li>Resuspend the cells in 1 mL of ice-cold lysis buffer (10 mM Tris-HCl, pH 8; 0.2% of non-ionic surfactant (see the Table of Materials); 10 mM NaCl; 1x protease inhibitors), and adjust the volume to 10 mL with ice-cold lysis buffer. Adjust the volume to obtain a concentration of 1 &#215; 106 cells/mL. Incubate on ice for 30 min, mixing every 2 min by inverting the tubes.</li>
	<li>Centrifuge the nuclei at 300 &#215; g for 5 min at 4 &#176;C, and then carefully discard the supernatant. Wash the pellet 1x with 1 mL of cold lysis buffer, and transfer it to a microcentrifuge tube. Wash the pellet 1x with 1 mL of cold 1.25x restriction buffer, and resuspend each cell pellet in 360 &#181;L of 1.25x restriction buffer.</li>
	<li>Add 11 &#181;L of 10% sodium dodecyl sulfate (SDS) per tube (0.3% final concentration), mix carefully by pipetting, and incubate at 37 &#176;C for 45 min, shaking at 700-950 rpm. Pipet up and down to disrupt clumps a few times during incubation.</li>
	<li>Quench the SDS by adding 75 &#181;L of non-ionic surfactant (10% solution, see the Table of Materials) per tube (1.6% final concentration), and incubate at 37 &#176;C for 45 min, shaking at 950 rpm. Pipet up and down a few times to disrupt clumps during incubation. 
	NOTE: If clumps are large and difficult to disrupt, decrease the rotating speed to 400 rpm during SDS and surfactant treatments. If the clumps are difficult to disaggregate by pipetting, split the sample into two; adjust the volumes of restriction buffer, SDS, and surfactant; and proceed with the permeabilization. Next, spin the nuclei at minimum speed (200 &#215; g), carefully discard the supernatant, pool the samples together in&#160;1X&#160;restriction&#160;buffer, and proceed with digestion. Take a 10 &#181;L aliquot as the undigested sample (UD).</li>
</ol>
3. Enzymatic digestion
<ol>
	<li>Digest the chromatin by adding 200 units (U) of Mbo I per tube, and incubate at 37 &#176;C for a period ranging from 4 h to overnight while rotating (950 rpm).</li>
	<li>On the next day, add an additional 50 U of Mbo I per tube, and incubate at 37 &#176;C for 2 h while rotating (950 rpm).</li>
	<li>Inactivate the enzyme by incubating the tubes at 60 &#176;C for 20 min. Place the tubes on ice. 
	NOTE: Take a 10 &#181;L aliquot as the digested sample (D).</li>
</ol>
4. Biotinylation of DNA ends
<ol>
	<li>To fill in the restriction fragment overhangs and label the DNA ends with biotin, add 1.5 &#181;L each of 10 mM dCTP, dGTP, dTTP, 20 &#181;L of 0.4 mM biotin dATP, 17.5 &#181;L of Tris low-EDTA (TLE) buffer [10 mM Tris-HCl, 0.1 mM EDTA, pH 8.0], and 10 &#181;L of 5 U/&#181;L of Klenow (DNA polymerase I large fragment) to all the tubes. Mix carefully and incubate for 75 min at 37 &#176;C. Shake at 700 rpm every 10 s for 30 s. Place all the tubes on ice while preparing the ligation mix.</li>
</ol>
5. Ligation
<ol>
	<li>Transfer each digested chromatin mixture to a separate 1 mL tube with ligation mix (100 &#181;L of 10x ligation buffer, 10 &#181;L of 10 mg/mL bovine serum albumin, 15 U of T4 DNA ligase, and 425 &#181;L of double-distilled water [ddH2O]). Mix thoroughly by gentle pipetting, and incubate overnight at 16 &#176;C.</li>
</ol>
6. Crosslink reversal and DNA purification
<ol>
	<li>Degrade proteins by adding 50 &#181;L of 10 mg/mL Proteinase K per tube, and incubate at 37 &#176;C for 2 h. Reverse crosslinks by increasing the temperature to 65 &#176;C and incubate overnight.</li>
	<li>Degrade RNA by adding 20 &#181;L of 10 mg/mL RNase A, and incubate at 37 &#176;C for 1 h.</li>
	<li>Perform phenol:chloroform extraction followed by ethanol precipitation.
	<ol>
		<li>Add 1 volume of phenol-chloroform, and mix thoroughly by inversion to obtain a homogeneous white phase. 
		NOTE: Phenol is a hazardous chemical. Follow the appropriate health and safety regulations. Work in the fume hood.</li>
		<li>Centrifuge at 15,000 &#215; g for 15 min. Transfer the aqueous phase into a fresh 2 mL microcentrifuge tube. Perform a back-extraction of the lower layer with 100 &#181;L of TLE buffer, and transfer the aqueous phase into the same 2 mL tube.</li>
		<li>Precipitate DNA by adding 2 volumes of 100% ethyl alcohol (EtOH), 0.1 volumes of 3 M sodium acetate, and 2 &#181;L of 20 mg/mL glycogen. Incubate at -20 &#176;C for a period ranging from 2 h to overnight.</li>
		<li>Spin at 15,000 &#215; g for 30 min at 4 &#176;C, and wash the pellets 2x with ice-cold 70% EtOH. Dry the pellets at RT, and resuspend in 100 &#181;L of TLE buffer. Quantify the DNA using a fluorogenic dye that binds selectively to DNA and a fluorometer according to the manufacturer&#39;s instructions (Table of Materials). 
		NOTE: The protocol can be paused here. Store ligation products at 4 &#176;C for the short term or at -20 &#176;C for the long term. Use an aliquot (100 ng) of the material as the ligated sample (L) for quality control.</li>
	</ol>
	</li>
</ol>
7.&#160;Assess Hi-C template quality
<ol>
	<li>Digestion and ligation qualitative controls
	<ol>
		<li>Purify DNA from the UD and D aliquots by reversing the crosslinks, and perform phenol:chloroform extraction and ethanol precipitation as described above.</li>
		<li>Load 100 ng of UD, D, and L samples in a 1.5% agarose gel. Look for a smear centered around 500 bp in the D sample versus a high molecular weight band for the L sample (see representative results).</li>
	</ol>
	</li>
	<li>Digestion efficiency quantitative control 
	NOTE: To assess the digestion efficiency more accurately, use the UD and D samples as templates to perform quantitative polymerase chain reactions (qPCR) using primers designed as follows.
	<ol>
		<li>Design a primer pair that amplifies a DNA fragment containing the DNA restriction site for the enzyme used for digestion (Mbo I in the present protocol), called R in the formula in step 7.2.3.</li>
		<li>Design a primer pair that amplifies a control DNA fragment that does not contain the restriction site for the enzyme used for digestion (Mbo I for the present protocol), called C in the formula in step 7.2.3.</li>
		<li>Use the cycle threshold values (Ct values) of the amplification to calculate restriction efficiency according to the formula shown below: 
		% Restriction = 100 - 100/2{(CtR - CtC)D - (CtR - CtC)UD} 
		Where CtR refers to the Ct value of fragment R, and CtC refers to the Ct value of the fragment C for sample D and sample UD. 
		NOTE: The restriction percentage reflects the efficiency of the restriction enzyme cleaving the restricted (R) DNA fragment compared to a control (C) DNA fragment that does not contain the restriction DNA site. A restriction efficiency of &#8805; 80% is recommended.</li>
	</ol>
	</li>
	<li>Detection of known interactions
	<ol>
		<li>Perform PCR to amplify an internal ligation control to examine short-range and/or medium- or long-range interactions (see representative results).</li>
		<li>Alternatively, design primers to amplify a ligation product in which the primers are in forward-forward or reverse-reverse orientation in adjacent restriction fragments.</li>
	</ol>
	</li>
	<li>Fill-in and biotin-labeling control
	<ol>
		<li>Verify Hi-C marking and ligation efficiency by amplification and digestion of a known interaction or a ligation product between adjacent restriction fragments in the genome, as described above. 
		NOTE: Successful fill-in and ligation of the Mbo I site (GATC) generates a new site for the restriction enzyme Cla I (ATCGAT) at the ligation junction and regenerates the Mbo I site.</li>
		<li>Digest the PCR product with Mbo I, Cla I, or both. After running the samples on a 1.5-2% gel, estimate the relative number of 3C and Hi-C ligation junctions by quantifying the intensity of the cut and uncut bands26. 
		NOTE: An efficiency of &#62; 70% is desired (see representative results).</li>
	</ol>
	</li>
</ol>
8. Sonication
<ol>
	<li>Sonicate the samples to obtain 200-500 bp DNA fragments. For the instrument used in this protocol (see the Table of Materials), dilute the sample (from 5 to 10 &#181;g) in 130 &#181;L of ddH2O per tube, and set the instrument to sonicate to 400 bp: fill level: 10; duty factor: 10%; peak incident power (w): 140; cycles per burst: 200; time (s): 80.</li>
</ol>
9. Biotin removal/end repair
NOTE: The steps shown below are adjusted for 5 &#181;g of Hi-C DNA.
<ol>
	<li>To perform biotin removal, transfer the sample (130 &#181;L) into a fresh microcentrifuge tube. Add 16 &#181;L of 10x ligation buffer, 2 &#181;L of 10 mM dATP, 5 &#181;L of T4 DNA Polymerase (15U), and 7 &#181;L of ddH2O (160 &#181;L of total volume). Incubate at 20 &#176;C for 30 min.</li>
	<li>Add 5 &#181;L of 10 mM dNTPs, 4 &#181;L of 10x ligation buffer, 5 &#181;L of T4 polynucleotide kinase (10 U/&#181;L), 1 &#181;L of Klenow, and 25 &#181;L of ddH2O (200 &#181;L of total volume). Incubate at 20 &#176;C for 30 min.</li>
</ol>
10. Size selection
<ol>
	<li>To select fragments mostly in the 250-550 bp size range, perform sequential solid phase reversible immobilization (SPRI) size selection first with 0.6x, followed by 0.90x according to the manufacturer&#39;s instructions, and elute the DNA using 100 &#181;L of TLE.</li>
</ol>
11. Biotin pulldown/A-tailing/adapter ligation
NOTE:&#160;Perform the washes by resuspending the magnetic beads by vortexing, rotate the samples for 3 min on a rotating wheel, and then briefly spin down the sample and place it on the magnetic stand. Allow the beads to stick to the magnet, discard the supernatant, and proceed with the following wash step. Perform the washes at 55 &#176;C on a thermo-block with rotation instead of the rotating wheel.
<ol>
	<li>Make up the final volume to 300 &#181;L per sample with TLE for pull-down. Prepare the bead-washing buffers: 1x Tween Buffer (TB) (TB: 5 mM Tris-HCl pH 8.0, 0.5 mM EDTA, 1 M NaCl, 0.05% Tween), 0.5x TB, 1x No-Tween buffer (NTB) (5 mM Tris-HCl pH 8.0, 0.5 mM EDTA, 1 M NaCl), 2x NTB.</li>
	<li>Use 150 &#181;L of streptavidin-linked magnetic beads (see the Table of Materials) per library. Wash the beads 2x with 400 &#181;L of 1x TB.&#160;Then resuspend beads in 300 &#181;L 2x NTB.</li>
	<li>Mix the beads with the 300 &#181;L Hi-C material and incubate at RT for 30 minutes on a rotating wheel to allow biotin binding to streptavidin beads.</li>
	<li>Wash the beads with 400 &#181;L of 0.5x TB, and incubate at 55 &#176;C for 3 min, rotating at 750 rpm. Wash the beads in 200 &#181;L of 1x restriction buffer.</li>
	<li>Resuspend the beads in 100 &#181;L of dATP tailing mix (5 &#181;L of 10 mM dATP, 10 &#181;L of 10x restriction buffer, 5 &#181;L of Klenow exo-, and 80 &#181;L of ddH2O). Incubate at 37 &#176;C for 30 min.</li>
	<li>Remove the supernatant, wash the beads 2x with 400 &#181;L of 0.5x TB by incubating at 55 &#176;C for 3 min and rotating at 750 rpm.</li>
	<li>Wash the beads with 400 &#181;L of 1x NTB and then with 100 &#181;L of 1x ligation buffer.</li>
	<li>Resuspend the beads in 50 &#181;L of 1x ligation buffer, and transfer the suspension to a new tube. Add 4 &#181;L of pre-annealed PE adapters (15 &#181;M stock) and 2 &#181;L of T4 ligase (400 U/&#181;L, i.e., 800 U/tube); incubate at RT for 2 h. 
	NOTE: Pre-anneal the adapters by adding equal volumes of both PE 1.0 and PE 2.0 adapters (30 &#181;M stock) and incubating for 10 min at RT (see the Table of Materials).</li>
	<li>Recapture the beads by removing the supernatant and washing the beads 2x with 400 &#181;L of TB. Wash the beads with 200 &#181;L of 1x NTB, then with 100 &#181;L of 1x restriction buffer, and resuspend the beads in 40 &#181;L of 1x restriction buffer.</li>
</ol>
12. PCR amplification
<ol>
	<li>Set up PCRs of 25 &#181;L volume with 5, 6, 7, and 8 cycles. For each PCR, use:
	<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
		<tbody>
			<tr>
				<td colspan="2">Reaction Recipe</td>
			</tr>
			<tr>
				<td>Hi-C beads</td>
				<td>2.5 &#181;L</td>
			</tr>
			<tr>
				<td>10 &#181;M PE PCR primer 1 (Table of Materials)</td>
				<td>0.75 &#181;L</td>
			</tr>
			<tr>
				<td>10 &#181;M PE PCR primer 2 (Table of Materials)</td>
				<td>0.75 &#181;L</td>
			</tr>
			<tr>
				<td>10 mM dNTP</td>
				<td>0.6 &#181;L</td>
			</tr>
			<tr>
				<td>5x reaction buffer</td>
				<td>5 &#181;L</td>
			</tr>
			<tr>
				<td>DNA polymerase</td>
				<td>0.3 &#181;L</td>
			</tr>
			<tr>
				<td>ddH2O</td>
				<td>14.65 &#181;L</td>
			</tr>
			<tr>
				<td>Total</td>
				<td>25 &#181;L</td>
			</tr>
		</tbody>
	</table>
	<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
		<tbody>
			<tr>
				<td>Cycles</td>
				<td>Temperature</td>
				<td>Time</td>
			</tr>
			<tr>
				<td>1</td>
				<td>98 &#176;C</td>
				<td>30 s</td>
			</tr>
			<tr>
				<td rowspan="3">n cycles</td>
				<td>98 &#176;C</td>
				<td>10 s</td>
			</tr>
			<tr>
				<td>65 &#176;C</td>
				<td>30 s</td>
			</tr>
			<tr>
				<td>72 &#176;C</td>
				<td>30 s</td>
			</tr>
			<tr>
				<td>1</td>
				<td>72 &#176;C</td>
				<td>7 min</td>
			</tr>
		</tbody>
	</table>
	</li>
</ol>
13. Final PCR amplification
<ol>
	<li>Perform final PCR amplification using the same conditions as described above and the number of cycles selected. Split the sample using 5 &#181;L of Hi-C beads as template in 50 &#181;L reactions.</li>
	<li>Collect all PCR reactions and transfer them to a fresh tube. Use the magnet to remove the streptavidin beads and recover the supernatant (PCR products). Transfer the beads to a fresh tube, wash the beads as indicated in step 11.2.9, and store in 1x restriction buffer at 4 &#176;C as a backup.</li>
	<li>Purify the PCR products using 0.85x the volume of the SPRI beads according to the manufacturer&#180;s instructions. Elute with 30 &#181;L of TLE buffer.</li>
	<li>Quantify the Hi-C library using a fluorometric instrument, and confirm the quality of the library by chip-based capillary electrophoresis.</li>
	<li>As a last quality checkpoint, use 1 &#181;L of the Hi-C library as a template to perform a PCR reaction using 10 cycles using the same conditions described in step 12.1. Divide the PCR product into two microcentrifuge tubes: digest one with Cla I and leave the other one undigested as a control. Run the products in a 1.5-2% agarose gel (see representative results).</li>
	<li>Proceed to 50 bp or 75 bp paired-end sequencing on a suitable sequencing platform.</li>
</ol>

<ol>
	<li>Cremer, T., Cremer, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromosome+territories,+nuclear+architecture+and+gene+regulation+in+mammalian+cells.">Chromosome territories, nuclear architecture and gene regulation in mammalian cells.</a> Nature Review Genetics. 2, 292-301 (2001).</li><li>Lieberman-Aiden, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+mapping+of+long-range+interactions+reveals+folding+principles+of+the+human+genome.">Comprehensive mapping of long-range interactions reveals folding principles of the human genome.</a> Science. 326, 289-293 (2009).</li><li>Dixon, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Topological+domains+in+mammalian+genomes+identified+by+analysis+of+chromatin+interactions.">Topological domains in mammalian genomes identified by analysis of chromatin interactions.</a> Nature. 485, 376-380 (2012).</li><li>Sexton, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+folding+and+functional+organization+principles+of+the+Drosophila+genome.">Three-dimensional folding and functional organization principles of the Drosophila genome.</a> Cell. 148 (3), 458-472 (2012).</li><li>Dixon, J. R., Gorkin, D. U., Ren, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+domains:+the+unit+of+chromosome+organization.">Chromatin domains: the unit of chromosome organization.</a> Molecular Cell. 62, 668-680 (2016).</li><li>Bonev, B., Cavalli, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organization+and+function+of+the+3D+genome.">Organization and function of the 3D genome.</a> Nature Reviews Genetics. 17, 661-678 (2016).</li><li>Lupi&#225;&#241;ez, D. G., Spielmann, M., Mundlos, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breaking+TADs:+how+alterations+of+chromatin+domains+result+in+disease.">Breaking TADs: how alterations of chromatin domains result in disease.</a> Trends in Genetics. 32, 225-237 (2016).</li><li>Phillips, J. E., Corces, V. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF:+master+weaver+of+the+genome.">CTCF: master weaver of the genome.</a> Cell. 137 (7), 1194-1211 (2009).</li><li>Hong, S., Kim, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+characterization+of+chromatin+domain+boundary-associated+genomic+elements.">Computational characterization of chromatin domain boundary-associated genomic elements.</a> Nucleic Acids Research. 45, 10403-10414 (2017).</li><li>Zuin, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cohesin+and+CTCF+differentially+affect+chromatin+architecture+and+gene+expression+in+human+cells.">Cohesin and CTCF differentially affect chromatin architecture and gene expression in human cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (3), 996-1001 (2014).</li><li>Guo, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR+inversion+of+CTCF+sites+alters+genome+topology+and+enhancer/promoter+function.">CRISPR inversion of CTCF sites alters genome topology and enhancer/promoter function.</a> Cell. 162, 900-910 (2015).</li><li>Lupi&#225;&#241;ez, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disruptions+of+topological+chromatin+domains+cause+pathogenic+rewiring+of+gene-enhancer+interactions.">Disruptions of topological chromatin domains cause pathogenic rewiring of gene-enhancer interactions.</a> Cell. 161, 1012-1025 (2015).</li><li>Van-Steensel, B., Furlong, E. E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+transcription+in+shaping+the+spatial+organization+of+the+genome.">The role of transcription in shaping the spatial organization of the genome.</a> Nature Reviews Molecular Cell Biology. 20, 327-337 (2019).</li><li>Merkenschlager, M., Nora, E. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+and+cohesin+in+genome+folding+and+transcriptional+gene+regulation.">CTCF and cohesin in genome folding and transcriptional gene regulation.</a> Annual Review of Genomics and Human Genetics. 17 (1), 17-43 (2016).</li><li>Hansen, A. S., Pustova, I., Cattoglio, C., Tjian, R., Darzacq, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CTCF+and+cohesin+regulate+chromatin+loop+stability+with+distinct+dynamics.">CTCF and cohesin regulate chromatin loop stability with distinct dynamics.</a> Elife. 6, 1-10 (2017).</li><li>Van Bortle, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulator+function+and+topological+domain+border+strength+scale+with+architectural+protein+occupancy.">Insulator function and topological domain border strength scale with architectural protein occupancy.</a> Genome Biology. 15, 82 (2014).</li><li>Ram&#237;rez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+TADs+reveal+DNA+sequences+underlying+genome+organization+in+flies.">High-resolution TADs reveal DNA sequences underlying genome organization in flies.</a> Nature Communications. 9, 189 (2018).</li><li>Ulianov, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Active+chromatin+and+transcription+play+a+key+role+in+chromosome+partitioning+into+topologically+associating+domains.">Active chromatin and transcription play a key role in chromosome partitioning into topologically associating domains.</a> Genome Research. 26, 70-84 (2016).</li><li>Rowley, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolutionarily+conserved+principles+predict+3D+chromatin+organization.">Evolutionarily conserved principles predict 3D chromatin organization.</a> Molecular Cell. 67, 837-852 (2017).</li><li>Gavrilov, A. A., Golov, A. K., Razin, S. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Actual+ligation+frequencies+in+the+chromosome+conformation+capture+procedure.">Actual ligation frequencies in the chromosome conformation capture procedure.</a> PLoS One. 8, 60403 (2013).</li><li>Gavrilov, A. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disclosure+of+a+structural+milieu+for+the+proximity+ligation+reveals+the+elusive+nature+of+an+active+chromatin+hub.">Disclosure of a structural milieu for the proximity ligation reveals the elusive nature of an active chromatin hub.</a> Nucleic Acids Research. 41, 3563-3575 (2013).</li><li>Nagano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-cell+Hi-C+reveals+cell-to-cell+variability+in+chromosome+structure.">Single-cell Hi-C reveals cell-to-cell variability in chromosome structure.</a> Nature. 502, 59-64 (2013).</li><li>Rao, S. S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+3D+map+of+the+human+genome+at+kilobase+resolution+reveals+principles+of+chromatin+looping.">A 3D map of the human genome at kilobase resolution reveals principles of chromatin looping.</a> Cell. 159 (7), 1665-1680 (2014).</li><li>Nagano, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+Hi-C+results+using+in-solution+versus+in-nucleus+ligation.">Comparison of Hi-C results using in-solution versus in-nucleus ligation.</a> Genome Biology. 16, 175 (2015).</li><li>Arzate-Mej&#237;a, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+situ+dissection+of+domain+boundaries+affect+genome+topology+and+gene+transcription+in+Drosophila.">In situ dissection of domain boundaries affect genome topology and gene transcription in Drosophila.</a> Nature Communications. 11, 894 (2020).</li><li>Schoenfelder, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Promoter+capture+Hi-C:+high-resolution,+genome-wide+profiling+of+promoter+interactions.">Promoter capture Hi-C: high-resolution, genome-wide profiling of promoter interactions.</a> Journal of Visualized Experiments. (136), e57320 (2018).</li><li>Servant, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiC-Pro:+an+optimized+and+flexible+pipeline+for+Hi-C+processing.">HiC-Pro: an optimized and flexible pipeline for Hi-C processing.</a> Genome Biology. 16, 259 (2015).</li><li>Philip, E., M&#229;ns, M., Sverker, L., Max, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MultiQC:+Summarize+analysis+results+for+multiple+tools+and+samples+in+a+single+report.">MultiQC: Summarize analysis results for multiple tools and samples in a single report.</a> Bioinformatics. 10, 1093 (2016).</li><li>Wingett, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiCUP:+pipeline+for+mapping+and+processing+Hi-C+data.">HiCUP: pipeline for mapping and processing Hi-C data.</a> F1000 Research. 4, 1310 (2015).</li><li>Imakaev, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Iterative+correction+of+Hi-C+data+reveals+hallmarks+of+chromosome+organization.">Iterative correction of Hi-C data reveals hallmarks of chromosome organization.</a> Nature Methods. 9 (10), 999-1003 (2012).</li><li>Akdemir, K. C., Chin, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiCPlotter+integrates+genomic+data+with+interaction+matrices.">HiCPlotter integrates genomic data with interaction matrices.</a> Genome Biolog. 16, 198 (2015).</li><li>Ramirez, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+TADs+reveal+DNA+sequences+underlying+genome+organization+in+flies.">High-resolution TADs reveal DNA sequences underlying genome organization in flies.</a> Nature Communications. 9, 189 (2018).</li><li>Ando-Kuri, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+global+and+promoter-centric+3D+genome+organization+temporally+resolved+during+a+circadian+cycle.">The global and promoter-centric 3D genome organization temporally resolved during a circadian cycle.</a> bioRxiv. , (2020).</li><li>Cuellar-Partida, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+priors+for+identifying+active+transcription+factor+binding+sites.">Epigenetic priors for identifying active transcription factor binding sites.</a> Bioinformatics. 28 (1), 56-62 (2012).</li><li>Zhang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Model-based+analysis+of+ChIP-Seq+(MACS).">Model-based analysis of ChIP-Seq (MACS).</a> Genome Biology. 9, 137 (2008).</li><li>Ong, C. -. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Poly(ADP-ribosyl)ation+regulates+insulator+function+and+intrachromosomal+interactions+in+Drosophila.">Poly(ADP-ribosyl)ation regulates insulator function and intrachromosomal interactions in Drosophila.</a> Cell. 155 (1), 148-159 (2013).</li><li>Fres&#225;n, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+insulator+protein+CTCF+regulates+Drosophila+steroidogenesis.">The insulator protein CTCF regulates Drosophila steroidogenesis.</a> Biology Open. 4 (7), 852-857 (2015).</li><li>Quinodoz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+promotes+the+formation+of+spatial+compartments+in+the+nucleus.">RNA promotes the formation of spatial compartments in the nucleus.</a> Cell. 174, 744-757 (2018).</li><li>Olivares-Chauvet, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Capturing+pairwise+and+multi-way+chromosomal+conformations+using+chromosomal+walks.">Capturing pairwise and multi-way chromosomal conformations using chromosomal walks.</a> Nature. 540 (7632), 296-300 (2016).</li><li>Beagrie, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complex+multi-enhancer+contacts+captured+by+genome+architecture+mapping.">Complex multi-enhancer contacts captured by genome architecture mapping.</a> Nature. 543, 519-524 (2017).</li><li>Redolfi, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DamC+reveals+principles+of+chromatin+folding+in+vivo+without+crosslinking+and+ligation.">DamC reveals principles of chromatin folding in vivo without crosslinking and ligation.</a> Nature Structural and Molecular Biology. 26, 471-480 (2019).</li><li>Maxwell, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HiChIP:+efficient+and+sensitive+analysis+of+protein-directed+genome+architecture.">HiChIP: efficient and sensitive analysis of protein-directed genome architecture.</a> Nature Methods. 13, 919-922 (2016).</li><li>Gao, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-BERST:+Defining+subnuclear+proteomic+landscapes+at+genomic+elements+with+dCas9-APEX2.">C-BERST: Defining subnuclear proteomic landscapes at genomic elements with dCas9-APEX2.</a> Nature Methods. 15 (6), 433-436 (2018).</li></ol>

The authors declare no competing interests.

The in-nucleus Hi-C method presented here has allowed detailed exploration of Drosophila genome topology at high resolution, providing a view of genomic interactions at different genomic scales, from chromatin loops between regulatory elements such as promoters and enhancers to TADs and large compartment identification25. The same technology has also been efficiently applied to mammalian tissues with some modifications33. For example, when processing a tissue instead of a s...

In eukaryotes, the genome is partitioned into chromosomes that occupy specific territories in the nuclear space during interphase1. The chromatin forming the chromosomes can be divided into two main states: one of accessible chromatin that is transcriptionally permissive, and the other of compact chromatin that is transcriptionally repressive. These chromatin states segregate and rarely mix in the nuclear space, forming two distinct compartments in the nucleus2. At the sub-megabase scale, boundaries separate domains of high-frequency chromatin interactions, called TADs, that mark chromosomal organization3,4,5. In mammals, TAD boundaries are occupied by cohesin and CCCTC-binding factor (CTCF)6,7,8. The cohesin complex extrudes chromatin and halts at CTCF-binding sites that are disposed in a convergent orientation in the genomic sequence to form stable chromatin loops9,10,13,14. Genetic disruption of the CTCF DNA-binding site at the boundaries or reduction in CTCF and cohesin protein abundance results in abnormal interactions between regulatory elements, loss of TAD formation, and gene expression deregulation9,10,11,13,14.
In Drosophila, the boundaries between TADs are occupied by several APs, including boundary element-associated factor 32 kDa (BEAF-32), Motif 1 binding protein (M1BP), centrosomal protein 190 (CP190), suppressor of hairy-wing (SuHW), and CTCF, and are enriched in active histone modifications and Polymerase II16,17,18. It has been suggested that in Drosophila, TADs appear as a consequence of transcription13,17,19, and the exact role of independent APs in boundary formation and insulation properties is still under investigation. Thus, whether domains in Drosophila are a sole consequence of the aggregation of regions of similar transcriptional states or whether APs, including CTCF, contribute to boundary formation remains to be fully characterized. Exploration of genomic contacts at high resolution has been possible through the development of chromosome conformation capture technologies coupled with next-generation sequencing. The Hi-C protocol was first described with the ligation step performed &#34;in solution&#34;2 in an attempt to avoid spurious ligation products between chromatin fragments. However, several studies pointed to the realization that the useful signal in the data came from ligation products formed at partially lysed nuclei that were not in solution20,21.
The protocol was then modified to perform the ligation inside the nucleus as part of the single-cell Hi-C experiment22. The in-nucleus Hi-C protocol was subsequently incorporated into cell population Hi-C to yield a more consistent coverage over the full range of genomic distances and produce data with less technical noise23,24. The protocol, described in detail here, is based on the population in-nucleus Hi-C protocol23,24 and was used to investigate the consequences of genetically removing DNA-binding motifs for CTCF and M1BP from a domain boundary at the Notch gene locus in Drosophila25. The results show that altering the DNA-binding motifs for APs at the boundary has drastic consequences for Notch domain formation, larger topological defects in the regions surrounding the Notch locus, and gene expression deregulation. This indicates that genetic elements at domain boundaries are important for the maintenance of genome topology and gene expression in Drosophila25.

<table><tbody><tr><td>16% (vol/vol) paraformaldehyde solution</td><td>Agar Scientific</td><td>R1026</td><td></td></tr><tr><td>Biotin-14-dATP</td><td>Invitrogen</td><td>CA1524-016</td><td></td></tr><tr><td>ClaI enzyme</td><td>NEB</td><td>R0197S</td><td></td></tr><tr><td>COVARIS Ultrasonicator</td><td>Covaris</td><td>LE220-M220</td><td></td></tr><tr><td>Cut Smart</td><td>NEB</td><td>B72002S</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium (DMEM) 1x</td><td>Life Technologies</td><td>41965-039</td><td></td></tr><tr><td>Dynabeads MyOne Streptabidin C1</td><td>Invitrogen</td><td>65002</td><td></td></tr><tr><td>Fetal bovine serum (FBS) sterile filtered</td><td>Sigma</td><td>F9665</td><td></td></tr><tr><td>Klenow Dna PolI large fragment</td><td>NEB</td><td>M0210L</td><td></td></tr><tr><td>Klenow exo(-)</td><td>NEB</td><td>M0210S</td><td></td></tr><tr><td>Ligation Buffer</td><td>NEB</td><td>B020S</td><td></td></tr><tr><td>MboI enzyme</td><td>NEB</td><td>R0147M</td><td></td></tr><tr><td>NP40-Igepal</td><td>SIGMA</td><td>CA-420</td><td>Non-ionic surfactant for addition in lysis buffer</td></tr><tr><td>PE adapter 1.0</td><td>Illumina</td><td>5&#039;-P-GATCGGAAGAGCGGTTCAGCAG&lt;br/&gt; GAATGCCGAG-3&#039;</td><td></td></tr><tr><td>PE adapter 2.0</td><td>Illumina</td><td>5&#039;-ACACTCTTTCCCTACACGACGCT&lt;br/&gt; CTTCCGATCT-3&#039;</td><td></td></tr><tr><td>PE PCR primer 1.0</td><td>Illumina</td><td>5&#039;-AATGATACGGCGACCACCGAGAT&lt;br/&gt; CTACACTCTTTCCCTACACGACG&lt;br/&gt; CTCTTCCGATCT-3&#039;</td><td></td></tr><tr><td>PE PCR primer 2.0</td><td>Illumina</td><td>5&#039;-CAAGCAGAAGACGGCATACGAG&lt;br/&gt; ATCGGTCTCGGCATTCCTGCTGA&lt;br/&gt; ACCGCTCTTCCGATCT-3&#039;</td><td></td></tr><tr><td>Phenol: Chloroform:Isoamyl Alcohol 25:24:1</td><td>SIGMA</td><td>P2069</td><td></td></tr><tr><td>Primer 1 (known interaction, Figure 2A)</td><td>Sigma</td><td>5&#039;-TCGCGGTAATTTTGCGTTTGA-3&#039;</td><td></td></tr><tr><td>Primer 2 (known interactions, Figure 2A)</td><td>Sigma</td><td>5&#039;-CCTCCCTGCCAAAACGTTTT-3&#039;</td><td></td></tr><tr><td>Protease inhibitor cocktail tablet</td><td>Roche</td><td>4693132001</td><td></td></tr><tr><td>Proteinase K</td><td>Roche</td><td>3115879001</td><td></td></tr><tr><td>Qubit</td><td>ThermoFisher</td><td>Q33327</td><td></td></tr><tr><td>RNAse</td><td>Roche</td><td>10109142001</td><td></td></tr><tr><td>SPRI Beads</td><td>Beckman</td><td>B23318</td><td></td></tr><tr><td>T4 DNA ligase</td><td>Invitrogen</td><td>15224-025</td><td></td></tr><tr><td>T4 DNA polymerase</td><td>NEB</td><td>M0203S</td><td></td></tr><tr><td>T4 polynucleotide kinase (PNK)&amp;nbsp;</td><td>NEB</td><td>M0201L</td><td></td></tr><tr><td>TaqPhusion</td><td>NEB</td><td>M0530S</td><td>DNA polymerase</td></tr><tr><td>Triton X-100</td><td></td><td></td><td>Non-ionic surfactant for quenching of SDS</td></tr></tbody></table>

in-nucleus hi-c in drosophila cells

The genome is organized into topologically associating domains (TADs) delimited by boundaries that isolate interactions between domains. In Drosophila, the mechanisms underlying TAD formation and boundaries are still under investigation. The application of the in-nucleus Hi-C method described here helped to dissect the function of architectural protein (AP)-binding sites at TAD boundaries isolating the Notch gene. Genetic modification of domain boundaries that cause loss of APs results in TAD fusion, transcriptional defects, and long-range topological alterations. These results provided evidence demonstrating the contribution of genetic elements to domain boundary formation and gene expression control in Drosophila. Here, the in-nucleus Hi-C method has been described in detail, which provides important checkpoints to assess the quality of the experiment along with the protocol. Also shown are the required numbers of sequencing reads and valid Hi-C pairs to analyze genomic interactions at different genomic scales. CRISPR/Cas9-mediated genetic editing of regulatory elements and high-resolution profiling of genomic interactions using this in-nucleus Hi-C protocol could be a powerful combination for the investigation of the structural function of genetic elements.

Described below are the results of a successful Hi-C protocol (see a summary of the Hi-C protocol workflow in Figure 1A). There are several quality control checkpoints during the in-nucleus Hi-C experiment. Sample aliquots were collected before (UD) and after (D) the chromatin restriction step as well as after ligation (L). Crosslinks were reversed, and DNA was purified and run on an agarose gel. A smear of 200-1000 bp was observed when restriction with Mbo I was successful (<strong class="x...

Watch this Scientific Journal Video about In-Nucleus Hi-C in Drosophila Cells at JoVE.com

In-Nucleus Hi-C in Drosophila Cells

The genome is organized in the nuclear space into different structures that can be revealed through chromosome conformation capture technologies. The in-nucleus Hi-C method provides a genome-wide collection of chromatin interactions in Drosophila cell lines, which generates contact maps that can be explored at megabase resolution at restriction fragment level.

The genome is organized into topologically associating domains (TADs) delimited by boundaries that isolate interactions between domains. In Drosophila, ...

Research

JoVE Journal

Genetics

4.0K Views.  Universidad Nacional Autónoma de México. The genome is organized in the nuclear space into different structures that can be revealed through chromosome conformation capture technologies. The in-nucleus Hi-C method provides a genome-wide collection of chromatin interactions in Drosophila cell lines, which generates contact maps that can be explored at megabase resolution at restriction fragment level.

Video: In-Nucleus Hi-C in Drosophila Cells

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of tissues, we have developed numerous modifications and improvements to our original fluorescent in situ hybridization (FISH) protocol. To facilitate throughput and cost effectiveness, all steps, from probe generation to signal detection, are performed using exon 96-well microtiter plates. Digoxygenin (DIG)-labelled antisense RNA probes are produced using either cDNA clones or genomic DNA as templates. After tissue fixation and permeabilization, probes are hybridized to transcripts of interest and then detected using a succession of anti-DIG antibody conjugated to biotin, streptavidin conjugated to horseradish peroxidase (HRP) and fluorescently conjugated tyramide, which in the presence of HRP, produces a highly reactive intermediate that binds to electron dense regions of immediately adjacent proteins. These amplification and localization steps produce a robust and highly localized signal that facilitates both cellular and subcellular transcript localization. The protocols provided have been optimized to produce highly specific signals in a variety of tissues and developmental stages. References are also provided for additional variations that allow the simultaneous detection of multiple transcripts, or transcripts and proteins, at the same time.

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

The described RNA in situ hybridization protocol allows the detection of RNA in whole Drosophila embryos or dissected tissues. Using 96-well microtiter plates and tyramide signal amplification, transcripts can be detected at high resolution, sensitivity, and throughput, and at a relatively low cost.

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of ...

Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos

Investigating the three-dimensional architecture of chromatin offers invaluable insight into the mechanisms of gene regulation. Here, we describe a protocol for performing the chromatin conformation capture technique in situ Hi-C on staged Drosophila melanogaster embryo populations. The result is a sequencing library that allows the mapping of all chromatin interactions that occur in the nucleus in a single experiment. Embryo sorting is done manually using a fluorescent stereo microscope and a transgenic fly line containing a nuclear marker. Using this technique, embryo populations from each nuclear division cycle, and with defined cell cycle status, can be obtained with very high purity. The protocol may also be adapted to sort older embryos beyond gastrulation. Sorted embryos are used as inputs for in situ Hi-C. All experiments, including sequencing library preparation, can be completed in five days. The protocol has low input requirements and works reliably using 20 blastoderm stage embryos as input material. The end result is a sequencing library for next generation sequencing. After sequencing, the data can be processed into genome-wide chromatin interaction maps that can be analyzed using a wide range of available tools to gain information about topologically associating domain (TAD) structure, chromatin loops, and chromatin compartments during Drosophila development.

Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos

This work describes a protocol for the generation of high resolution in situ Hi-C libraries from tightly staged pre-gastrulation Drosophila melanogaster embryos.

Investigating the three-dimensional architecture of chromatin offers invaluable insight into the mechanisms of gene regulation. Here, we describe a ...

Drosophila Larval NMJ Immunohistochemistry

The Drosophila neuromuscular junction (NMJ) is an established model system used for the study of synaptic development and plasticity. The widespread use of the Drosophila motor system is due to its high accessibility. It can be analyzed with single-cell resolution. There are 30 muscles per hemisegment whose arrangement within the peripheral body wall are known. A total of 31 motor neurons attach to these muscles in a pattern that has high fidelity. Using molecular biology and genetics, one can create transgenic animals or mutants. Then, one can study the developmental consequences on the morphology and function of the NMJ. Immunohistochemistry can be used to clearly image the components of the NMJ. In this article, we demonstrate how to use antibody staining to visualize the Drosophila larval NMJ.

Drosophila Larval NMJ Immunohistochemistry

This protocol demonstrates how to perform immunohistochemistry on dissected Drosophila larva.

The Drosophila neuromuscular junction (NMJ) is an established model system used for the study of synaptic development and plasticity. The widespread use ...

Biology

Imaging Intranuclear Actin Rods in Live Heat Stressed Drosophila Embryos

The purpose of this protocol is to visualize intranuclear actin rods that assemble in live Drosophila melanogaster embryos following heat stress. Actin rods are a hallmark of a conserved, inducible Actin Stress Response (ASR) that accompanies human pathologies, including neurodegenerative disease. Previously, we showed that the ASR contributes to morphogenesis failures and reduced viability of developing embryos. This protocol allows the continued study of mechanisms underlying actin rod assembly and the ASR in a model system that is highly amenable to imaging, genetics and biochemistry. Embryos are collected and mounted on a coverslip to prepare them for injection. Rhodamine-conjugated globular actin (G-actinRed) is diluted and loaded into a microneedle. A single injection is made into the center of each embryo. After injection, embryos are incubated at elevated temperature and intranuclear actin rods are then visualized by confocal microscopy. Fluorescence recovery after photobleaching (FRAP) experiments may be performed on the actin rods; and other actin-rich structures in the cytoplasm can also be imaged. We find that G-actinRed polymerizes like endogenous G-actin and does not, on its own, interfere with normal embryo development. One limitation of this protocol is that care must be taken during injection to avoid serious injury to the embryo. However, with practice, injecting G-actinRed into Drosophila embryos is a fast and reliable way to visualize actin rods and can easily be used with flies of any genotype or with the introduction of other cellular stresses, including hypoxia and oxidative stress.

Imaging Intranuclear Actin Rods in Live Heat Stressed Drosophila Embryos

The goal of this protocol is to inject Rhodamine-conjugated globular actin into Drosophila embryos and image intranuclear actin rod assembly following heat stress.

The purpose of this protocol is to visualize intranuclear actin rods that assemble in live Drosophila melanogaster embryos following heat stress. Actin ...

Developmental Biology

Nuclear Migration in the Drosophila Oocyte

Live cell imaging is particularly necessary to understand the cellular and molecular mechanisms that regulate organelle movements, cytoskeleton rearrangements, or polarity patterning within the cells. When studying oocyte nucleus positioning, live-imaging techniques are essential to capture the dynamic events of this process. The Drosophila egg chamber is a multicellular structure and an excellent model system to study this phenomenon because of its large size and availability of numerous genetic tools. During Drosophila mid-oogenesis, the nucleus migrates from a central position within the oocyte to adopt an asymmetric position mediated by microtubule-generated forces. This migration and positioning of the nucleus are necessary to determine the polarity axes of the embryo and the subsequent adult fly. One characteristic of this migration is that it occurs in three dimensions (3D), creating a necessity for live imaging. Thus, to study the mechanisms that regulate nuclear migration, we have developed a protocol to culture the dissected egg chambers and perform live imaging for 12 h by time-lapse acquisitions using spinning-disk confocal microscopy. Overall, our conditions allow us to preserve Drosophila egg chambers alive for a long period of time, thereby enabling the completion of nuclear migration to be visualized in a large number of samples in 3D.

Nuclear Migration in the Drosophila Oocyte

In Drosophila, the oocyte nucleus undergoes microtubule-dependent migration during oogenesis. Here, we describe a protocol that was developed to follow the migration by performing live imaging on egg chambers ex-vivo. Our procedure maintains egg chambers alive for 12 h to acquire multi-position 3D time-lapse movies using spinning-disk confocal microscopy.

Live cell imaging is particularly necessary to understand the cellular and molecular mechanisms that regulate organelle movements, cytoskeleton ...

Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis

Drosophila melanogaster embryonic and larval tissues often contain a highly heterogeneous mixture of cell types, which can complicate the analysis of gene expression in these tissues. Thus, to analyze cell-specific gene expression profiles from Drosophila tissues, it may be necessary to isolate specific cell types with high purity and at sufficient yields for downstream applications such as transcriptional profiling and chromatin immunoprecipitation. However, the irregular cellular morphology in tissues such as the central nervous system, coupled with the rare population of specific cell types in these tissues, can pose challenges for traditional methods of cell isolation such as laser microdissection and fluorescence-activated cell sorting (FACS). Here, an alternative approach to characterizing cell-specific gene expression profiles using affinity-based isolation of tagged nuclei, rather than whole cells, is described. Nuclei in the specific cell type of interest are genetically labeled with a nuclear envelope-localized EGFP tag using the Gal4/UAS binary expression system. These EGFP-tagged nuclei can be isolated using antibodies against GFP that are coupled to magnetic beads. The approach described in this protocol enables consistent isolation of nuclei from specific cell types in the Drosophila larval central nervous system at high purity and at sufficient levels for expression analysis, even when these cell types comprise less than 2% of the total cell population in the tissue. This approach can be used to isolate nuclei from a wide variety of Drosophila embryonic and larval cell types using specific Gal4 drivers, and may be useful for isolating nuclei from cell types that are not suitable for FACS or laser microdissection.

Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis

Drosophila tissues often contain a heterogeneous mixture of cell types.&#160;To examine gene expression in specific cell types from a particular tissue, nuclei can be genetically tagged and subsequently isolated using an affinity-based approach. Isolated nuclei can be used for downstream applications such as gene expression analysis and chromatin immunoprecipitation.

Drosophila melanogaster embryonic and larval tissues often contain a highly heterogeneous mixture of cell types, which can complicate the analysis of gene ...

Multiplex Detection of Gene Expression in the Intact Drosophila Brain Using Expansion-Assisted Iterative Fluorescence In Situ Hybridization

Understanding gene expression is essential for deciphering cellular functions. However, methods for analyzing the expression of numerous genes in situ within a given tissue remain limited. The EASI-FISH protocol described here has been adapted to detect the expression of dozens of genes in the intact adult Drosophila central nervous system (CNS) using commercially available reagents. This protocol includes a new gel formulation that enhances gel robustness, enabling multiple rounds of hybridization and allowing the embedding of multiple brains per gel. This improvement increases throughput, facilitates optimal comparison of experimental conditions, and reduces reagent costs. Additionally, by employing the GAL4-UAS system for co-detection of green fluorescent protein (GFP), gene expression can be visualized in specific neuronal or glial cell types. Notably, the high resolution achieved through expansion microscopy, combined with the sensitivity of the method, allows for the detection of single RNA transcripts. This approach effectively integrates high image quality with high throughput, making it a powerful tool for studying gene expression throughout the intact fly brain.

Expansion-Assisted Iterative Fluorescence In Situ Hybridization (EASI-FISH) is a robust technique that combines expansion microscopy with fluorescence in situ hybridization (FISH) to detect the expression of multiple genes in thick tissue. This protocol outlines recent advancements in the method and its adaptation for labeling the intact Drosophila central nervous system..

Understanding gene expression is essential for deciphering cellular functions. However, methods for analyzing the expression of numerous genes in situ ...

Neuroscience

Immunofluorescent Staining for Visualization of Heterochromatin Associated Proteins in Drosophila Salivary Glands

Visualization of heterochromatin aggregates by immunostaining can be challenging. Many mammalian components of chromatin are conserved in Drosophila melanogaster. Therefore, it is an excellent model to study heterochromatin formation and maintenance. Polytenized cells, such as the ones found in salivary glands of third instar D. melanogaster larvae, provide an excellent tool to observe the chromatin amplified nearly a thousand times and have allowed researchers to study changes in the distribution of heterochromatin in the nucleus. Although the observation of heterochromatin components can be carried out directly in polytene chromosome preparations, the localization of some proteins can be altered by the severity of the treatment. Therefore, the direct visualization of heterochromatin in cells complements this type of study. In this protocol, we describe the immunostaining techniques used for this tissue, the use of secondary fluorescent antibodies, and confocal microscopy to observe these heterochromatin aggregates with greater precision and detail.

Immunofluorescent Staining for Visualization of Heterochromatin Associated Proteins in Drosophila Salivary Glands

This protocol aims to visualize heterochromatin aggregates in Drosophila polytene cells.

Visualization of heterochromatin aggregates by immunostaining can be challenging. Many mammalian components of chromatin are conserved in Drosophila ...

5-Ethynyl-2'-Deoxyuridine/Phospho-Histone H3 Dual-Labeling Protocol for Cell Cycle Progression Analysis in Drosophila Neural Stem Cells

In vivo cell cycle progression analysis is routinely performed in studies on genes regulating mitosis and DNA replication. 5-Ethynyl-2'-deoxyuridine (EdU) has been utilized to investigate replicative/S-phase progression, whereas antibodies against phospho-histone H3 have been utilized to mark mitotic nuclei and cells. A combination of both labels would enable the classification of G0/G1 (Gap phase), S (replicative), and M (mitotic) phases and serve as an important tool to evaluate the effects of mitotic gene knockdowns or null mutants on cell cycle progression. However, the reagents used to mark EdU-labelled cells are incompatible with several secondary antibody-fluorescent tags. This complicates immunostaining, where primary and tagged secondary antibodies are used to mark pH3-positive mitotic cells. This paper describes a step-by-step protocol for the dual-labeling of EdU and pH3 in Drosophila larval neural stem cells, a system utilized extensively to study mitotic factors. Additionally, a protocol is provided for image analysis and quantification to allocate labeled cells in 3 distinct categories, G0/G1, S, S&gt;G2/M (progression from S to G2/M), and M phases.

5-Ethynyl-2'-Deoxyuridine/Phospho-Histone H3 Dual-Labeling Protocol for Cell Cycle Progression Analysis in Drosophila Neural Stem Cells

Cell cycle analysis with 5-ethynyl-2'-deoxyuridine (EdU) and phospho-histone H3 (pH3) labeling is a multi-step procedure that may require extensive optimization. Here, we present a detailed protocol that describes all steps for this procedure including image analysis and quantification to distinguish cells in different cell cycle phases.

In vivo cell cycle progression analysis is routinely performed in studies on genes regulating mitosis and DNA replication. 5-Ethynyl-2'-deoxyuridine (EdU) ...

Drosophila Larval IHC

Immunohistochemistry (IHC) is a technique used to visualize the presence and location of proteins within tissues. Drosophila larvae are particularly amenable to IHC because of the ease with which they can be processed for staining. Additionally, the larvae are transparent, meaning that some tissues can be visualized without the need for dissection.
In IHC, proteins are ultimately detected with antibodies that specifically bind to &ldquo;epitopes&rdquo; within the protein of interest. In order to preserve these epitopes, tissues must be fixed prior to staining. Furthermore, in order for antibodies to penetrate membranes, cells must be permeabilized with detergents. This video article offers a detailed view of the reagents, tools, and procedures necessary for the staining of dissected larval tissues, including fixation, blocking, and staining steps. Also featured is a demonstration of tissue mounting techniques for fluorescence microscopy. Finally, examples of the broad range of applications for these techniques (and some variations upon them) are provided.

Drosophila melanogaster Larval Immunohistochemistry IHC

Immunohistochemistry (IHC) is a technique used to visualize the presence and location of proteins within tissues. Drosophila larvae are particularly ...

In-Nucleus Hi-C in Drosophila Cells

Summary

Explore More Videos

Chapters in this video

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

Generation of Genome-wide Chromatin Conformation Capture Libraries from Tightly Staged Early Drosophila Embryos

Drosophila Larval NMJ Immunohistochemistry

Imaging Intranuclear Actin Rods in Live Heat Stressed Drosophila Embryos

Nuclear Migration in the Drosophila Oocyte

Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis

Multiplex Detection of Gene Expression in the Intact Drosophila Brain Using Expansion-Assisted Iterative Fluorescence In Situ Hybridization

Immunofluorescent Staining for Visualization of Heterochromatin Associated Proteins in Drosophila Salivary Glands

5-Ethynyl-2'-Deoxyuridine/Phospho-Histone H3 Dual-Labeling Protocol for Cell Cycle Progression Analysis in Drosophila Neural Stem Cells

Drosophila Larval IHC