The authors would like to thank Prof. Paul Hooykaas for kindly providing the pCAMBIA1302 vector and Agrobacterium tumefaciens AGL1 from the Institute of Biology Leiden, Leiden University, the Netherlands. The authors would also like to thank Eva Colic for her help in growing the fluorescent transformants. This work was funded by the Natural Sciences and Engineering Research Council of Canada and the Mitacs Accelerate program.

All media and solutions must be autoclaved prior to use unless otherwise stated. All centrifuge tubes, pipette tips, etc., should be sterile or autoclaved before use. For easy reference, the media recipes used in this protocol are listed in Table 1.
1. Preparation of A. tumefaciens electrocompetent cells
<ol>
	<li>Inoculate Agrobacterium (AGL-1) into a 25 mL sterile shaker flask of LB media (supplemented with rifampicin, 20 mg/L-1) from a frozen glycerol stock and grow overnight at 28-30 &#176;C and 150 rpm. 
	&#8203;NOTE: The Agrobacterium strain AGL-1 is (see Table of Materials) resistant to rifampicin, ampicillin, chloramphenicol, and streptomycin and can be obtained from several suppliers.</li>
	<li>The following day, dilute the culture 1,00,000-fold by adding 0.5 &#181;L of the overnight culture to 50 mL autoclaved ultra-pure water and spread 10 &#181;L of this diluted culture on an LB plate, and then incubate at 28-30 &#176;C for 1-3 days.</li>
	<li>Pick a colony and start a 20 mL overnight culture in LB with rifampicin at 28-30 &#176;C.</li>
	<li>The next day, inoculate 500 mL LB media (no antibiotic) in a shaker flask with 9 mL of the overnight culture and grow at 28-30 &#176;C until the OD600 reaches 0.5.</li>
	<li>Divide the culture evenly into ten 50 mL centrifuge tubes and chill on ice for 30 min. Pre-cool the centrifuge to 4 &#176;C.</li>
	<li>Centrifuge the tubes at 4 &#176;C and 4000 x g for 15 min. Subsequently, remove as much supernatant as possible using a pipette and resuspend the pellet in each tube in 50 mL of ice-cold water.</li>
	<li>Centrifuge the cells at 4 &#176;C and 4000 x g for 15 min. Remove the supernatant and resuspend the pellet in 25 mL of ice-cold water in each tube.</li>
	<li>Centrifuge the cells at 4 &#176;C and 4000 x g for 15 min. Remove the supernatant and resuspend the pellet in 1 mL of ice-cold 10% (w/v) glycerol in each tube.</li>
	<li>Combine all tubes into one 50 mL tube and centrifuge the cells at 4 &#176;C and 4000 x g for 15 min. Remove the supernatant and resuspend the pellet in 400 &#181;L ice-cold 10% (w/v) glycerol. The cell concentration should be about 1-3 x 1010 cells/mL.</li>
	<li>Distribute the cells as 50 &#181;L aliquots in sterile prechilled microtubes. Freeze in liquid nitrogen and store in a -80 &#176;C freezer.</li>
</ol>
2. Electroporation of A. tumefaciens
<ol>
	<li>Add 50 &#181;L of AGL-1 A. tumefaciens electrocompetent cells into a prechilled 0.1 mm cuvette and add 2 &#181;L of pCAMBIA1302 or similar plasmid (conc 15 ng/&#181;L) (see Table of Materials).</li>
	<li>Electroporate at 2400 V using an electroporator (200 &#937;, capacitance extender 250 &#181;FD, capacitance 25 &#181;FD, exponential decay, see Table of Materials). The time constant should be &#62;4.5 ms for successful electroporation with exponential decay.</li>
	<li>Immediately add 1 mL of LB media to the cuvette and gently pipette up and down to mix. Transfer the 1 mL of resuspended cells into a 1.5 mL microtube and incubate it at 28-30 &#176;C for at least 1 h to recover.</li>
	<li>Plate the cells on LB agar containing the appropriate antibiotic (i.e., 50 mg/L of kanamycin for pCAMBIA1302 for prokaryotic selection).</li>
	<li>Incubate at 28-30 &#176;C for 2-3 days.</li>
	<li>Select one colony, grow overnight in LB with the appropriate selection (50 mg/L of kanamycin for pCAMBIA1302), and cryopreserve the plasmid-containing strain using 50% glycerol at -80 &#176;C for future use.</li>
</ol>
3. AMT of C. vulgaris
NOTE: Prepare C. vulgaris (UTEX 395, see Table of Materials) and A. tumefaciens cultures in parallel for co-cultivation. C. vulgaris cultures should be started 3 days before preparing A. tumefaciens cultures. Protocol was modified based on that published by Kumar et al.7.
<ol>
	<li>Prepare C. vulgaris culture
	<ol>
		<li>C. vulgaris is traditionally stored on slants or maintained in log-phase cultures in illuminated conditions. From a log phase culture at OD600 = 1.0, spread 0.5 mL onto a Tris-Acetate-Phosphate (TAP, see Table 1) agar plates (1.2% w/v agar A) and grow for 5 days at 25 &#176;C with illumination (50 &#181;E/m2s). This will yield approximately 5 x 106 cells.</li>
	</ol>
	</li>
	<li>Prepare A. tumefaciens culture
	<ol>
		<li>Grow A. tumefaciens AGL-1 pCAMBIA1302 strain in a shaker flask by inoculating 10 mL of LB media supplemented with 15 mM glucose, 20 mg/L&#160;rifampicin, and 50 mg/L kanamycin (see Table of Materials) using the glycerol stock. Incubate at 28-30 &#176;C and 250 rpm overnight.</li>
		<li>Inoculate 1 mL of overnight culture into 50 mL of LB with 15 mM glucose, 20 mg/L&#160;rifampicin, and 50 mg/L kanamycin and incubate at 28-30 &#176;C and 250 rpm until the OD600 reaches 1.0.</li>
	</ol>
	</li>
	<li>Cocultivate C. vulgaris and A. tumefaciens
	<ol>
		<li>To prepare the A. tumefaciens culture for co-cultivation, transfer the grown culture to a 50 mL tube and centrifuge at 4000 x g for 30 min at room temperature. Remove the supernatant using a pipette and wash the cells twice with the induction medium. 
		NOTE: The induction media used is TAP media adjusted to pH 5.5 and supplemented with F/2 medium trace metals and vitamins with 200 &#181;M acetosyringone (AS, see Table of Materials). Resuspend the cells in induction media such that OD600 = 0.5.</li>
		<li>To prepare the C. vulgaris culture for co-cultivation, add 25 mL of induction media to the C. vulgaris plate containing ~ 5 x 106 cells. Transfer to a 50 mL tube. Centrifuge the cells at 4000 x g for 15 min at room temperature and discard the supernatant.</li>
		<li>Mix the algal cell pellet with 200 &#181;L of the bacterial suspension (OD600: 0.5) and incubate them in a rotary shaker at 21-25 &#176;C at 150 rpm for 1 h.</li>
		<li>Spread the mixed culture (200 &#181;L) onto induction media plates supplemented with 15 mM glucose and incubate at 21-25 &#176;C in the dark for 3 days.</li>
		<li>After 3 days, use 10 mL of TAP media supplemented with 400 mg/L cefotaxime or 20 mg/L of tetracycline (see Table of Materials) to collect the microalgae and incubate in the dark at 21-25 &#176;C for 2 days to eliminate A. tumefaciens from the culture.</li>
		<li>Plate 500 &#181;L of the culture onto selective media, e.g., TAP media supplemented with 20-70 mg/L of Hygromycin B (when using pCAMBIA1302) and 400 mg/L-1 cefotaxime or 20 mg/L of tetracycline. Incubate 21-25 &#176;C in the dark for 2 days before placing them in an illuminated chamber. 
		NOTE: Resistant colonies will appear 5-7 days after light exposure.</li>
		<li>Pick single colonies from the transformation plate and re-streak them on TAP agar plates supplemented with 400 mg/L of cefotaxime or 20 mg/L of tetracycline and 20-70 mg/L of Hygromycin B.</li>
	</ol>
	</li>
</ol>
4. Colony PCR (cPCR) to confirm gene integration in C. vulgaris transformants
<ol>
	<li>Extract genomic DNA from a C. vulgaris transformant after subculturing at least twice from a single colony using a plant genomic DNA extraction kit (see Table of Materials). Using this as a template for PCR, design primers for the mgfp5 region of the T-DNA (mgfp5-Fwd: 5&#39; CCCATCTCATAAATAACGTC 3&#39;, and M13-Rev: 5&#39; CAGGAAACAGCTATGAC 3&#39;).
	<ol>
		<li>Using a Q5 high-fidelity DNA polymerase master mix kit (see Table of Materials), perform polymerase chain reaction (PCR) to validate transgene integration. 
		NOTE: The following conditions were used for the present study: 98 &#176;C for 3 min; 35 cycles (98 &#176;C for 10 s, 57 &#176;C for 30 s, 72 &#176;C for 1 min); 72 &#176;C for 5min. Use pCAMBIA1302 as a positive control and wild-type C. vulgaris genomic DNA as a negative control.</li>
	</ol>
	</li>
	<li>To confirm that there is no pCAMBIA1302 present in the sample due to residual contamination by A. tumefaciens, use colony PCR. Add a small amount of transformant cells to 10 &#181;L of sterile water and boil at 98 &#176;C for 15 min. Use this as a template for PCR.
	<ol>
		<li>Design primers for a region outside of the T-DNA on pCAMBIA1302 (B1-Fwd: 5&#39;AGTAAAGGAGAAGAACTTTTC 3&#39; and B1-Rev: 5&#39;CCTGATGCGGTATTTTCTC 3&#39;). 
		NOTE: The following conditions were used for the present study: 94 &#176;C for 3 min; 30 cycles (94 &#176;C for 30 s, 48 &#176;C for 30 s, 68 &#176;C for 5 min); 68 &#176;C for 7 min. Use a boiled colony of A. tumefaciens AGL-1 (pCAMBIA1302) as a positive control and a boiled colony of wild-type C. vulgaris as a negative control.</li>
	</ol>
	</li>
	<li>To confirm that there is no A. tumerfaciens contamination present in the sample, use colony PCR. Add a small amount of transformant cells to 10 &#181;L of sterile water and boil at 98 &#176;C for 15 min. Use this as a template for PCR.
	<ol>
		<li>Design primers for the virE2 gene contained on the AGL-1 virulence plasmid (virE2-Fwd: 5&#39; AGGGAGCCCTACCCG 3&#39; and virE2-Rev: 5&#39; GAACCAGCCTGGAGTTCG 3&#39;). 
		NOTE: The following conditions were used for the present study: 94 &#176;C for 3 min; 30 cycles (94 &#176;C for 30 s, 53 &#176;C for 30 s, 68 &#176;C for 3 min); 68 &#176;C for 7 min. Use a boiled colony of A. tumefaciens AGL-1 (pCAMBIA1302) as a positive control and a boiled colony of wild-type C. vulgaris as a negative control.</li>
	</ol>
	</li>
	<li>Run PCR samples on a DNA agarose gel along with a ladder (1 Kbp DNA ladder, see Table of Materials) to confirm the size of the resulting fragments16.</li>
</ol>
5. Measuring the fluorescence of transformants
<ol>
	<li>Inoculate each transformant from a log-phase maintenance culture or TAP agar slant into 50 mL of TAP supplemented with 200 mg/L-1 cefotaxime and 25 mg/L-1 Hygromycin B such that the starting OD600 = 0.1. Inoculate one culture with wild-type C. vulgaris and only 200 mg/L-1 cefotaxime as the negative control. Incubate at 25 &#176;C at 150 rpm with 150 &#181;mol/m2s of photosynthetically active light (see Table of Materials).</li>
	<li>Every 24 h, take a 300 &#181;L of sample and measure the absorbance and fluorescence (excitation 488 nm, emission 526 nm) in a 96-well plate reader or UV/Vis spectrometer and fluorometer (see Table of Materials). Use a black plate with a transparent bottom for simultaneous measurements.</li>
</ol>
6. Crude protein extraction, protein purification, and SDS-PAGE electrophoresis
<ol>
	<li>Inoculate transformant (#50) from a log-phase maintenance culture into 300 mL of TAP supplemented with 200 mg/L-1 cefotaxime and 25 mg/L-1 Hygromycin B to reach the OD680 = 0.1. Inoculate one culture with wild-type C. vulgaris and only 200 mg/L-1 cefotaxime as the negative control. Incubate at 25 &#176;C at 150 rpm with 150 &#181;mol/m2s of photosynthetically active light.</li>
	<li>Extract the crude protein sample from the transformant (#50) and wild-type strains using 5 mL lysis buffer (see Table 1), followed by sonication for 4 min.</li>
	<li>Purify crude protein sample with a Ni-NTA resin through 5 mL polypropylene columns (see Table of Materials).</li>
	<li>Lyophilize the 15 mL purified protein samples and resuspend them in 1 mL lysis buffer for SDS-PAGE analysis17.</li>
</ol>

Stable Gene Integration in Chlorella vulgaris Using Agrobacterium tumefaciens

<ol>
	<li>Smith, E. F., Townsend, C. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+plant+tumor+of+bacterial+origin.">A plant tumor of bacterial origin.</a> Science. 25 (643), 671-673 (1907).</li><li>Chilton, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stable+incorporation+of+plasmid+DNA+into+higher+plant+cells:+The+molecular+basis+of+tumorigenesis.">Stable incorporation of plasmid DNA into higher plant cells: The molecular basis of tumorigenesis.</a> Cell. 11 (2), 263-271 (1977).</li><li>De Cleene, M., De Ley, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+range+of+crown+gall.">The host range of crown gall.</a> The Botanical Review. 42, 389-466 (1976).</li><li>Hooykaas, P. J., Schilperoort, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacterium+and+plant+genetic+engineering.">Agrobacterium and plant genetic engineering.</a> Plant Molecular Biology. 19, 15-38 (1992).</li><li>Bundock, P., den Dulk-Ras, A., Beijersbergen, A., Hooykaas, P. J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transkingdom+T-DNA+transfer+from+Agrobacterium+tumefaciens+to+Saccharomyces+cerevisiae.">Transkingdom T-DNA transfer from Agrobacterium tumefaciens to Saccharomyces cerevisiae.</a> The European Molecular Biology Organization. 14 (13), 3206-3214 (1995).</li><li>Piers, K. L., Heath, J. D., Liang, X., Stephens, K. M., Nester, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacteriumtumefaciens-mediated+transformation+of+yeast.">Agrobacteriumtumefaciens-mediated transformation of yeast.</a> Proceedings of the National Academy of Sciences of the United States of America. 93 (4), 1613-1618 (1996).</li><li>Kumar, S. V., Misquitta, R. W., Reddy, V. S., Rao, B. J., Rajam, M. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+the+green+alga-Chlamydomonas+reinhardtii+by+Agrobacteriumtumefaciens.">Genetic transformation of the green alga-Chlamydomonas reinhardtii by Agrobacteriumtumefaciens.</a> Plant Science. 166 (3), 731-738 (2004).</li><li>de Groot, M. J., Bundock, P., Hooykaas, P. J., Beijersbergen, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agrobacteriumtumefaciens-mediated+transformation+of+filamentous+fungi.">Agrobacteriumtumefaciens-mediated transformation of filamentous fungi.</a> Nature Biotechnology. 16 (9), 839-842 (1998).</li><li>Hajdukiewicz, P., Svab, Z., Maliga, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+small,+versatile+pPZP+family+of+Agrobacterium+binary+vectors+for+plant+transformation.">The small, versatile pPZP family of Agrobacterium binary vectors for plant transformation.</a> Plant Molecular Biology. 25 (6), 989-994 (1994).</li><li>Dehghani, J., Adibkia, K., Movafeghi, A., Pourseif, M. M., Omidi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designing+a+new+generation+of+expression+toolkits+for+engineering+of+green+microalgae;+robust+production+of+human+interleukin-2.">Designing a new generation of expression toolkits for engineering of green microalgae; robust production of human interleukin-2.</a> BioImpacts. 10 (4), 259-268 (2020).</li><li>Berndt, A. J., Smalley, T. N., Ren, B., Simkovsky, R., Badary, A., Sproles, A. E., Fields, F. J., Torres-Tiji, Y., Heredia, V., Mayfield, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+production+of+a+functional+SARS-CoV-2+spike+receptor+binding+domain+in+the+green+algae+Chlamydomonas+reinhardtii.">Recombinant production of a functional SARS-CoV-2 spike receptor binding domain in the green algae Chlamydomonas reinhardtii.</a> PLoS One. 16, 0257089 (2021).</li><li>Li, A., Huang, R., Wang, C., Hu, Q., Li, H., Li, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+anti-lipopolysaccharide+factor+isoform+3+in+Chlamydomonas+reinhardtii+showing+high+antimicrobial+activity.">Expression of anti-lipopolysaccharide factor isoform 3 in Chlamydomonas reinhardtii showing high antimicrobial activity.</a> Marine Drugs. 19 (5), 239 (2021).</li><li>Xue, B., Dong, C. M., Hu, H. H., Dong, B., Fan, Z. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chlamydomonas+reinhardtii-expressed+multimer+of+ToAMP4+inhibits+the+growth+of+bacteria+of+both+Gram-positive+and+Gram-negative.">Chlamydomonas reinhardtii-expressed multimer of ToAMP4 inhibits the growth of bacteria of both Gram-positive and Gram-negative.</a> Process Biochemistry. 91, 311-318 (2020).</li><li>Khan, M. I., Shin, J. H., Kim, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+promising+future+of+microalgae:+current+status,+challenges,+and+optimization+of+a+sustainable+and+renewable+industry+for+biofuels,+feed,+and+other+products.">The promising future of microalgae: current status, challenges, and optimization of a sustainable and renewable industry for biofuels, feed, and other products.</a> Microbial Cell Factories. 17, 36 (2018).</li><li>Cha, T. S., Yee, W., Aziz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessment+of+factors+affecting+Agrobacterium-mediated+genetic+transformation+of+the+unicellular+green+alga,+Chlorella+vulgaris.">Assessment of factors affecting Agrobacterium-mediated genetic transformation of the unicellular green alga, Chlorella vulgaris.</a> World Journal of Microbiology and Biotechnology. 28, 1771-1779 (2012).</li><li>Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Agarose+gel+electrophoresis+for+the+separation+of+DNA+fragments.">Agarose gel electrophoresis for the separation of DNA fragments.</a> Journal of Visualized Experiments. (62), e3923 (2012).</li><li>Bio-Rad Laboratories Inc. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Guide+to+Polyacrylamide+Gel+Electrophoresis+and+Detection.+Bulletin+6040,+Rev+C.">A Guide to Polyacrylamide Gel Electrophoresis and Detection. Bulletin 6040, Rev C.</a> Bio-Rad Laboratories Inc. Accessed. , (2023).</li><li>NEBExpress Ni Resin Gravity Flow Typical Protocol. New England Biolabs Inc Available from: <a target="_blank" href="https://international.neb.com/protocols/2019/09/10/nebexpress-ni-resin-gravity-flow-typical-protocol">https://international.neb.com/protocols/2019/09/10/nebexpress-ni-resin-gravity-flow-typical-protocol</a> (2023)</li><li>Ward, V. C. A., Rehmann, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+media+optimization+for+mixotrophic+cultivation+of+Chlorella+vulgaris.">Fast media optimization for mixotrophic cultivation of Chlorella vulgaris.</a> Scientific Reports. 9, 19262 (2019).</li><li>Morton, E. R., Fuqua, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+maintenance+of+Agrobacterium.">Laboratory maintenance of Agrobacterium.</a> Current Protocols in Microbiology. , (2012).</li><li>Haddadi, F., Abd Aziz, M., Abdullah, S. N., Tan, S. G., Kamaladini, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+Agrobacterium-mediated+transformation+of+strawberry+cv.+Camarosa+by+a+dual+plasmid+system.">An efficient Agrobacterium-mediated transformation of strawberry cv. Camarosa by a dual plasmid system.</a> Molecules. 20 (3), 3647-3666 (2015).</li><li>Wang, X., Ryu, D., Houtkooper, R. H., Auwerx, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic+use+and+abuse:+a+threat+to+mitochondria+and+chloroplasts+with+impact+on+research,+health,+and+environment.">Antibiotic use and abuse: a threat to mitochondria and chloroplasts with impact on research, health, and environment.</a> Bioessays. 37 (10), 1045-1053 (2015).</li><li>Gelvin, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plant+DNA+repair+and+Agrobacterium+T-DNA+integration.">Plant DNA repair and Agrobacterium T-DNA integration.</a> International Journal of Molecular Sciences. 22 (16), 8458 (2021).</li></ol>

No conflicts of interest were declared.

The efficiency of transformation is associated with several different parameters. The choice of A. tumefaciens strains used for AMT is crucial. AGL-1 is one of the most invasive strains discovered and, for this reason, has been routinely used in plant AMT. Supplementing the induction media with glucose (15-20 mM) is also important for AMT efficiency. Considering C. vulgaris can grow in both phototrophic and heterotrophic conditions, glucose or other carbon sources are often omitted from microalgae media...

Agrobacterium tumefaciens, a gram-negative soil-borne bacterium, possesses a unique interkingdom gene transfer ability, earning it the title &#34;natural genetic engineer&#34;1. This bacterium can transfer DNA (T-DNA) from a tumor-inducing plasmid (Ti-Plasmid) into host cells through a Type IV secretion system, resulting in the integration and expression of the T-DNA within the host genome1,2,3,4. In the natural setting, this process leads to tumor formation in plants, commonly known as crown gall disease. However, Agrobacterium can also transfer T-DNA into various other organisms, including yeast, fungi, algae, sea urchin embryos, and even human cells under laboratory conditions5,6,7,8.
Exploiting this natural system, Agrobacterium tumefaciens-mediated transformation (AMT) enables the random integration of gene(s) of interest into a host cell&#39;s nuclear genome by modifying the T-DNA region of the Ti-plasmid. For this purpose, a widely used AMT plant expression vector is pCAMBIA13029. Researchers can employ simple cloning workflows in E. coli before transferring the desired vector into A. tumefaciens for subsequent transfer to the host of interest.
Green microalgae are eukaryotes that share many similarities with land plants but are highly recalcitrant to genetic modification. However, genetic transformation plays a crucial role in both fundamental and biotechnological research of microalgae. In several microalgae species, particularly Chlamydomonas reinhardtii, genetic transformation via AMT has successfully introduced transgenes such as human interleukin-2 (hIL-2), the severe acute respiratory syndrome coronavirus 2 receptor-binding domain (SARS-CoV-2 RBD), and two antimicrobial peptides (AMPs)10,11,12,13. Among these, Chlorella vulgaris, a less fastidious and fast-growing green algae species, holds significant potential for the sustainable production of carbohydrates, proteins, nutraceuticals, pigments, and other high-value compounds14. However, the lack of reliable tools for creating transgenic strains of C. vulgaris hampers its commercial progress. Since there have been only a limited number of published works utilizing AMT in C. vulgaris15, and given the considerable differences between plant and microalgae cultivation, optimizing the AMT protocol becomes essential.
In this study, researchers inserted green fluorescent protein (mGFP5) downstream of the Cauliflower Mosaic Virus (CamV) 35S promoter and added a histidine tag to use it as a reporter gene for protein expression. Transformants were selected using Hygromycin B, and after subculturing for over twenty generations, the transformation remained stable. The pCAMBIA1302 plasmid employed in this work can be readily adapted to contain any gene of interest. Furthermore, the method and materials presented can be adjusted for other green algae species with an active CamV35S promoter, as this promoter is used for Hygromycin selection.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1 Kb Plus DNA ladder</td>
			<td>FroggaBio</td>
			<td>DM015</td>
			<td></td>
		</tr>
		<tr>
			<td>Acetosyringone</td>
			<td>Fisher Scientific</td>
			<td>D26665G</td>
			<td></td>
		</tr>
		<tr>
			<td>Agrobacterium tumefaciens</td>
			<td>Gold Biotechnologies</td>
			<td>Strain: AGL-1; Gift from Prof. Paul Hooykaas</td>
			<td>Genotype: C58 RecA (RifR/CarbR) pTiBo542DT-DNA</td>
		</tr>
		<tr>
			<td>Biotin</td>
			<td>Enzo Life Sciences</td>
			<td>89151-400</td>
			<td></td>
		</tr>
		<tr>
			<td>CaCl2&#183;2H2O</td>
			<td>VWR</td>
			<td>BDH9224-1KG</td>
			<td></td>
		</tr>
		<tr>
			<td>Cefotaxime</td>
			<td>AK Scientific</td>
			<td>J90010</td>
			<td></td>
		</tr>
		<tr>
			<td>Chlorella vulgaris</td>
			<td>University of Texas at Austin Culture Collection of Algae</td>
			<td>Strain: UTEX 395</td>
			<td>Wildtype strain</td>
		</tr>
		<tr>
			<td>CoCl2&#183;6H2O</td>
			<td>Sigma Aldrich</td>
			<td>C8661-25G</td>
			<td></td>
		</tr>
		<tr>
			<td>CuSO4&#183;5H2O</td>
			<td>EMD Millipore</td>
			<td>CX2185-1</td>
			<td></td>
		</tr>
		<tr>
			<td>FeCl3&#183;6H2O</td>
			<td>VWR</td>
			<td>BDH9234-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>Gene Pulser Xcell Electroporator</td>
			<td>Bio-Rad</td>
			<td>1652662</td>
			<td>Main unit equipped with PC module.</td>
		</tr>
		<tr>
			<td>GeneJET Plant Genome Purification Kit</td>
			<td>Thermo Scientific</td>
			<td>K0791</td>
			<td></td>
		</tr>
		<tr>
			<td>Glacial acetic acid</td>
			<td>VWR</td>
			<td>CABDH3093-2.2P</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>BioBasic</td>
			<td>GB0232</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES Buffer</td>
			<td>Sigma Aldrich</td>
			<td>H-3375</td>
			<td></td>
		</tr>
		<tr>
			<td>Hygromycin B</td>
			<td>Fisher Scientific</td>
			<td>AAJ6068103</td>
			<td></td>
		</tr>
		<tr>
			<td>K2HPO4</td>
			<td>VWR</td>
			<td>BDH9266-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin</td>
			<td>Gold Biotechnologies</td>
			<td>K-250-25</td>
			<td></td>
		</tr>
		<tr>
			<td>KH2PO4</td>
			<td>VWR</td>
			<td>BDH9268-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4&#183;7H2O</td>
			<td>VWR</td>
			<td>97062-134</td>
			<td></td>
		</tr>
		<tr>
			<td>MnCl2&#183;4H2O</td>
			<td>JT Baker</td>
			<td>BAKR2540-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2CO3</td>
			<td>VWR</td>
			<td>BDH7971-1</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2EDTA&#183;2H2O</td>
			<td>JT Baker</td>
			<td>8993-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2MoO4&#183;2H2O</td>
			<td>JT Baker</td>
			<td>BAKR3764-01</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>VWR</td>
			<td>BDH7257-7</td>
			<td></td>
		</tr>
		<tr>
			<td>NaH2PO4 H2O</td>
			<td>Millipore Sigma</td>
			<td>CA80058-650</td>
			<td></td>
		</tr>
		<tr>
			<td>NaNO3&#160;</td>
			<td>VWR</td>
			<td>BDH4574-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>NEBExpress Ni Resin</td>
			<td>NewEngland BioLabs</td>
			<td>NEB #S1427</td>
			<td></td>
		</tr>
		<tr>
			<td>NH4Cl</td>
			<td>VWR</td>
			<td>BDH9208-500G</td>
			<td></td>
		</tr>
		<tr>
			<td>pCAMBIA1302</td>
			<td>Leiden University</td>
			<td>Gift from Prof. Paul Hooykaas</td>
			<td>pBR322, KanR, pVS1, T-DNA(CaMV 35S/HygR/CaMV polyA, CaMV 35S promoter/mgpf5-6xhis/NOS terminator)</td>
		</tr>
		<tr>
			<td>Polypropylene Columns (5 mL)</td>
			<td>QIAGEN</td>
			<td>34964</td>
			<td></td>
		</tr>
		<tr>
			<td>Precision Plus Protein Unstained Protein Standards, Strep-tagged recombinant, 1 mL</td>
			<td>Bio-Rad</td>
			<td>1610363</td>
			<td></td>
		</tr>
		<tr>
			<td>Rifampicin</td>
			<td>Millipore Sigma</td>
			<td>R3501-1G</td>
			<td></td>
		</tr>
		<tr>
			<td>SunBlaster LED Strip Light 48 Inch&#160;</td>
			<td>SunBlaster</td>
			<td>210000000906</td>
			<td></td>
		</tr>
		<tr>
			<td>Synergy 4 Microplate UV/Vis spectrometer&#160;</td>
			<td>BioTEK</td>
			<td>S4MLFPTA</td>
			<td></td>
		</tr>
		<tr>
			<td>Tetracycline</td>
			<td>Thermo Scientific Chemicals</td>
			<td>CAAAJ61714-14</td>
			<td></td>
		</tr>
		<tr>
			<td>TGX Stain-Free FastCast Acrylamide Kit, 12%</td>
			<td>Bio-Rad</td>
			<td>1610185</td>
			<td></td>
		</tr>
		<tr>
			<td>Thiamine</td>
			<td>TCI America</td>
			<td>T0181-100G</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris Base</td>
			<td>Fisher Scientific</td>
			<td>BP152-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Tryptone</td>
			<td>BioBasic</td>
			<td>TG217(G211)</td>
			<td></td>
		</tr>
		<tr>
			<td>Vitamin B12 (cyanocobalamin)</td>
			<td>Enzo Life Sciences</td>
			<td>89151-436</td>
			<td></td>
		</tr>
		<tr>
			<td>Yeast Extract</td>
			<td>BioBasic</td>
			<td>G0961</td>
			<td></td>
		</tr>
		<tr>
			<td>ZnSO4&#183;7H2O</td>
			<td>JT Baker</td>
			<td>4382-01</td>
			<td></td>
		</tr>
	</tbody>
</table>

agrobacterium tumefaciens-mediated genetic engineering of green microalgae, chlorella vulgaris

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit the capacity for gene transfer to a diverse array of species. Numerous microalgae species lack well-established methods for reliably integrating genes of interest into their nuclear genome. To harness the potential benefits of microalgal biotechnology, simple and efficient genome manipulation tools are crucial. Herein, an optimized AMT protocol is presented for the industrial microalgae species Chlorella vulgaris, utilizing the reporter green fluorescent protein (mGFP5) and the antibiotic resistance marker for Hygromycin B. Mutants are selected through plating on Tris-Acetate-Phosphate (TAP) media containing Hygromycin B and cefotaxime. Expression of mGFP5 is quantified via fluorescence after over ten generations of subculturing, indicating the stable transformation of the T-DNA cassette. This protocol allows for the reliable generation of multiple transgenic C. vulgaris colonies in under two weeks, employing the commercially available pCAMBIA1302 plant expression vector.

To show successful transformation using the method above, C. vulgaris was cocultured with either AGL-1 containing the pCAMBIA1302 plasmid or without the plasmid (wild-type and plated on TAP agar supplemented with Hygromycin B and cefotaxime (Figure 1A). The leftmost plate shows the transformed colonies capable of growth on Hygromycin B/cefotaxime plates, and the middle plate shows that wild-type AGL-1 cannot grow on the Hygromycin B/cefotaxime plates. The rightmost plate shows that ...

Watch this Scientific Journal Video about Optimized Transformation Protocol for Chlorella vulgaris Using Agrobacterium tumefaciens at JoVE.com

Author Spotlight: Optimized Transformation Protocol for Chlorella vulgaris Using Agrobacterium tumefaciens 

This protocol outlines the utilization of Agrobacterium tumefaciens-mediated transformation (AMT) for integrating gene(s) of interest into the nuclear genome of the green microalgae Chlorella vulgaris, leading to the production of stable transformants.

Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit ...

agrobacterium-tumefaciens-mediated-genetic-engineering-green

Research

JoVE Journal

Bioengineering

3.1K Views.  University of Waterloo. This protocol outlines the utilization of Agrobacterium tumefaciens-mediated transformation (AMT) for integrating gene(s) of interest into the nuclear genome of the green microalgae Chlorella vulgaris, leading to the production of stable transformants.

Video: Author Spotlight: Optimized Transformation Protocol for Chlorella vulgaris Using Agrobacterium tumefaciens 

Fabrication of Biologically Derived Injectable Materials for Myocardial Tissue Engineering

This protocol provides methods for the preparation of an injectable extracellular matrix (ECM) gel for myocardial tissue engineering applications. Briefly, decellularized tissue is lyophilized, milled, enzymatically digested, and then brought to physiological pH. The lyophilization removes all water content from the tissue, resulting in dry ECM that can be ground into a fine powder with a small mill. After milling, the ECM powder is digested with pepsin to form an injectable matrix. After adjustment to pH 7.4, the liquid matrix material can be injected into the myocardium. Results of previous characterization assays have shown that matrix gels produced from decellularized pericardial and myocardial tissue retain native ECM components, including diverse proteins, peptides and glycosaminoglycans. Given the use of this material for tissue engineering, in vivo characterization is especially useful; here, a method for performing an intramural injection into the left ventricular (LV) free wall is presented as a means of analyzing the host response to the matrix gel in a small animal model. Access to the chest cavity is gained through the diaphragm and the injection is made slightly above the apex in the LV free wall. The biologically derived scaffold can be visualized by biotin-labeling before injection and then staining tissue sections with a horse radish peroxidase-conjugated neutravidin and visualizing via diaminobenzidine (DAB) staining. Analysis of the injection region can also be done with histological and immunohistochemical staining. In this way, the previously examined pericardial and myocardial matrix gels were shown to form fibrous, porous networks and promote vessel formation within the injection region.

Methods for preparing an injectable matrix gel from decellularized tissue and injecting it into rat myocardium in vivo are described.

This protocol provides methods for the preparation of an injectable extracellular matrix (ECM) gel for myocardial tissue engineering applications.  ...

Procedure for Lung Engineering

Lung tissue, including lung cancer and chronic lung diseases such as chronic obstructive pulmonary disease, cumulatively account for some 280,000 deaths annually; chronic obstructive pulmonary disease is currently the fourth leading cause of death in the United States1. Contributing to this mortality is the fact that lungs do not generally repair or regenerate beyond the microscopic, cellular level. Therefore, lung tissue that is damaged by degeneration or infection, or lung tissue that is surgically resected is not functionally replaced in vivo. To explore whether lung tissue can be generated in vitro, we treated lungs from adult rats using a procedure that removes cellular components to produce an acellular lung extracellular matrix scaffold. This scaffold retains the hierarchical branching structures of airways and vasculature, as well as a largely intact basement membrane, which comprises collagen IV, laminin, and fibronectin. The scaffold is mounted in a bioreactor designed to mimic critical aspects of lung physiology, such as negative pressure ventilation and pulsatile vascular perfusion. By culturing pulmonary epithelium and vascular endothelium within the bioreactor-mounted scaffold, we are able to generate lung tissue that is phenotypically comparable to native lung tissue and that is able to participate in gas exchange for short time intervals (45-120 minutes). These results are encouraging, and suggest that repopulation of lung matrix is a viable strategy for lung regeneration. This possibility presents an opportunity not only to work toward increasing the supply of lung tissue for transplantation, but also to study respiratory cell and molecular biology in vitro for longer time periods and in a more accurate microenvironment than has previously been possible.

We have developed a decellularized lung extracellular matrix and novel biomimetic bioreactor that can be used to generate functional lung tissue. By seeding cells into the matrix and culturing in the bioreactor, we generate tissue that demonstrates effective gas exchange when transplanted in vivo for short periods of time.

Lung tissue, including lung cancer and chronic lung diseases such as chronic obstructive pulmonary disease, cumulatively account for some 280,000 deaths ...

Tissue Engineering of the Intestine in a Murine Model

Tissue-engineered small intestine (TESI) has successfully been used to rescue Lewis rats after massive small bowel resection, resulting in return to preoperative weights within 40 days.1 In humans, massive small bowel resection can result in short bowel syndrome, a functional malabsorptive state that confers significant morbidity, mortality, and healthcare costs including parenteral nutrition dependence, liver failure and cirrhosis, and the need for multivisceral organ transplantation.2 In this paper, we describe and document our protocol for creating tissue-engineered intestine in a mouse model with a multicellular organoid units-on-scaffold approach. Organoid units are multicellular aggregates derived from the intestine that contain both mucosal and mesenchymal elements,3 the relationship between which preserves the intestinal stem cell niche.4 In ongoing and future research, the transition of our technique into the mouse will allow for investigation of the processes involved during TESI formation by utilizing the transgenic tools available in this species.5The availability of immunocompromised mouse strains will also permit us to apply the technique to human intestinal tissue and optimize the formation of human TESI as a mouse xenograft before its transition into humans. Our method employs good manufacturing practice (GMP) reagents and materials that have already been approved for use in human patients, and therefore offers a significant advantage over approaches that rely upon decellularized animal tissues. The ultimate goal of this method is its translation to humans as a regenerative medicine therapeutic strategy for short bowel syndrome.

This article and the accompanying video present our protocol for generating tissue-engineered intestine in the mouse, using an organoid units-on-scaffold approach.

Tissue-engineered small intestine (TESI) has successfully been used to rescue Lewis rats after massive small bowel resection, resulting in return to ...

Capillary Force Lithography for Cardiac Tissue Engineering

Cardiovascular disease remains the leading cause of death worldwide1. Cardiac tissue engineering holds much promise to deliver groundbreaking medical discoveries with the aims of developing functional tissues for cardiac regeneration as well as in vitro screening assays. However, the ability to create high-fidelity models of heart tissue has proven difficult. The heart&#8217;s extracellular matrix (ECM) is a complex structure consisting of both biochemical and biomechanical signals ranging from the micro- to the nanometer scale2. Local mechanical loading conditions and cell-ECM interactions have recently been recognized as vital components in cardiac tissue engineering3-5.
A large portion of the cardiac ECM is composed of aligned collagen fibers with nano-scale diameters that significantly influences tissue architecture and electromechanical coupling2. Unfortunately, few methods have been able to mimic the organization of ECM fibers down to the nanometer scale. Recent advancements in nanofabrication techniques, however, have enabled the design and fabrication of scalable scaffolds that mimic the in vivo structural and substrate stiffness cues of the ECM in the heart6-9.
Here we present the development of two reproducible, cost-effective, and scalable nanopatterning processes for the functional alignment of cardiac cells using the biocompatible polymer poly(lactide-co-glycolide) (PLGA)8 and a polyurethane (PU) based polymer. These anisotropically nanofabricated substrata (ANFS) mimic the underlying ECM of well-organized, aligned tissues and can be used to investigate the role of nanotopography on cell morphology and function10-14.
Using a nanopatterned (NP) silicon master as a template, a polyurethane acrylate (PUA) mold is fabricated. This PUA mold is then used to pattern the PU or PLGA hydrogel via UV-assisted or solvent-mediated capillary force lithography (CFL), respectively15,16. Briefly, PU or PLGA pre-polymer is drop dispensed onto a glass coverslip and the PUA mold is placed on top. For UV-assisted CFL, the PU is then exposed to UV radiation (&#955; = 250-400 nm) for curing. For solvent-mediated CFL, the PLGA is embossed using heat (120 &#176;C) and pressure (100 kPa). After curing, the PUA mold is peeled off, leaving behind an ANFS for cell culture. Primary cells, such as neonatal rat ventricular myocytes, as well as human pluripotent stem cell-derived cardiomyocytes, can be maintained on the ANFS2.

In this protocol, we demonstrate the fabrication of biomimetic cardiac cell culture substrata made from two distinct polymeric materials using capillary force lithography. The described methods provide a scalable, cost-effective technique to engineer the structure and function of macroscopic cardiac tissues for in vitro and in vivo applications.

Cardiovascular disease remains the leading cause of death worldwide1. Cardiac tissue engineering holds much promise to deliver groundbreaking medical ...

Evaluation of Polymeric Gene Delivery Nanoparticles by Nanoparticle Tracking Analysis and High-throughput Flow Cytometry

Non-viral gene delivery using polymeric nanoparticles has emerged as an attractive approach for gene therapy to treat genetic diseases1 and as a technology for regenerative medicine2. Unlike viruses, which have significant safety issues, polymeric nanoparticles can be designed to be non-toxic, non-immunogenic, non-mutagenic, easier to synthesize, chemically versatile, capable of carrying larger nucleic acid cargo and biodegradable and/or environmentally responsive. Cationic polymers self-assemble with negatively charged DNA via electrostatic interaction to form complexes on the order of 100 nm that are commonly termed polymeric nanoparticles. Examples of biomaterials used to form nanoscale polycationic gene delivery nanoparticles include polylysine, polyphosphoesters, poly(amidoamines)s and polyethylenimine (PEI), which is a non-degradable off-the-shelf cationic polymer commonly used for nucleic acid delivery1,3 . Poly(beta-amino ester)s (PBAEs) are a newer class of cationic polymers4 that are hydrolytically degradable5,6 and have been shown to be effective at gene delivery to hard-to-transfect cell types such as human retinal endothelial cells (HRECs)7, mouse mammary epithelial cells8, human brain cancer cells9 and macrovascular (human umbilical vein, HUVECs) endothelial cells10.
A new protocol to characterize polymeric nanoparticles utilizing nanoparticle tracking analysis (NTA) is described. In this approach, both the particle size distribution and the distribution of the number of plasmids per particle are obtained11. In addition, a high-throughput 96-well plate transfection assay for rapid screening of the transfection efficacy of polymeric nanoparticles is presented. In this protocol, poly(beta-amino ester)s (PBAEs) are used as model polymers and human retinal endothelial cells (HRECs) are used as model human cells. This protocol can be easily adapted to evaluate any polymeric nanoparticle and any cell type of interest in a multi-well plate format.

A protocol for nanoparticle tracking analysis (NTA) and high-throughput flow cytometry to evaluate polymeric gene delivery nanoparticles is described. NTA is utilized to characterize the nanoparticle particle size distribution and the plasmid per particle distribution. High-throughput flow cytometry enables quantitative transfection efficacy evaluation for a library of gene delivery biomaterials.

Non-viral gene delivery using polymeric nanoparticles has emerged as an attractive approach for gene therapy to treat genetic diseases1 and as a ...

Procedure for the Development of Multi-depth Circular Cross-sectional Endothelialized Microchannels-on-a-chip

Efforts have been focused on developing in vitro assays for the study of microvessels because in vivo animal studies are more time-consuming, expensive, and observation and quantification are very challenging. However, conventional in vitro microvessel assays have limitations when representing in vivo microvessels with respect to three-dimensional (3D) geometry and providing continuous fluid flow. Using a combination of photolithographic reflowable photoresist technique, soft lithography, and microfluidics, we have developed a multi-depth circular cross-sectional endothelialized microchannels-on-a-chip, which mimics the 3D geometry of in vivo microvessels and runs under controlled continuous perfusion flow. A positive reflowable photoresist was used to fabricate a master mold with a semicircular cross-sectional microchannel network. By the alignment and bonding of the two polydimethylsiloxane (PDMS) microchannels replicated from the master mold, a cylindrical microchannel network was created. The diameters of the microchannels can be well controlled. In addition, primary human umbilical vein endothelial cells (HUVECs) seeded inside the chip showed that the cells lined the inner surface of the microchannels under controlled perfusion lasting for a time period between 4 days to 2 weeks.

A microchannels-on-a-chip platform was developed by the combination of photolithographic reflowable photoresist technique, soft lithography, and microfluidics. The endothelialized microchannels platform mimics the three-dimensional (3D) geometry of in vivo microvessels, runs under controlled continuous perfusion flow, allows for high-quality and real-time imaging&#160;and can be applied for microvascular research.

Efforts have been focused on developing in vitro assays for the study of microvessels because in vivo animal studies are more time-consuming, expensive, ...

Production, Characterization and Potential Uses of a 3D Tissue-engineered Human Esophageal Mucosal Model

The incidence of both esophageal adenocarcinoma and its precursor, Barrett&#8217;s Metaplasia, are rising rapidly in the western world. Furthermore esophageal adenocarcinoma generally has a poor prognosis, with little improvement in survival rates in recent years. These are difficult conditions to study and there has been a lack of suitable experimental platforms to investigate disorders of the esophageal mucosa.
A model of the human esophageal mucosa has been developed in the MacNeil laboratory which, unlike conventional 2D cell culture systems, recapitulates the cell-cell and cell-matrix interactions present in vivo and produces a mature, stratified epithelium similar to that of the normal human esophagus. Briefly, the model utilizes non-transformed normal primary human esophageal fibroblasts and epithelial cells grown within a porcine-derived acellular esophageal scaffold. Immunohistochemical characterization of this model by CK4, CK14, Ki67 and involucrin staining demonstrates appropriate recapitulation of the histology of the normal human esophageal mucosa.
This model provides a robust, biologically relevant experimental model of the human esophageal mucosa. It can easily be manipulated to investigate a number of research questions including the effectiveness of pharmacological agents and the impact of exposure to environmental factors such as alcohol, toxins, high temperature or gastro-esophageal refluxate components. The model also facilitates extended culture periods not achievable with conventional 2D cell culture, enabling, inter alia, the study of the impact of repeated exposure of a mature epithelium to the agent of interest for up to 20 days. Furthermore, a variety of cell lines, such as those derived from esophageal tumors or Barrett&#8217;s Metaplasia, can be incorporated into the model to investigate processes such as tumor invasion and drug responsiveness in a more biologically relevant environment.

This manuscript describes the production, characterization and potential uses of a tissue engineered 3D esophageal construct prepared from normal primary human esophageal fibroblast and squamous epithelial cells seeded within a de-cellularized porcine scaffold. The results demonstrate the formation of a mature stratified epithelium similar to the normal human esophagus.

The incidence of both esophageal adenocarcinoma and its precursor, Barrett&#8217;s Metaplasia, are rising rapidly in the western world. Furthermore ...

Engineering 3D Cellularized Collagen Gels for Vascular Tissue Regeneration

Synthetic materials are known to initiate clinical complications such as inflammation, stenosis, and infections when implanted as vascular substitutes. Collagen has been extensively used for a wide range of biomedical applications and is considered a valid alternative to synthetic materials due to its inherent biocompatibility (i.e., low antigenicity, inflammation, and cytotoxic responses). However, the limited mechanical properties and the related low hand-ability of collagen gels have hampered their use as scaffold materials for vascular tissue engineering. Therefore, the rationale behind this work was first to engineer cellularized collagen gels into a tubular-shaped geometry and second to enhance smooth muscle cells driven reorganization of collagen matrix to obtain tissues stiff enough to be handled.
The strategy described here is based on the direct assembling of collagen and smooth muscle cells (construct) in a 3D cylindrical geometry with the use of a molding technique. This process requires a maturation period, during which the constructs are cultured in a bioreactor under static conditions (without applied external dynamic mechanical constraints) for 1 or 2 weeks. The &#8220;static bioreactor&#8221; provides a monitored and controlled sterile environment (pH, temperature, gas exchange, nutrient supply and waste removal) to the constructs. During culture period, thickness measurements were performed to evaluate the cells-driven remodeling of the collagen matrix, and glucose consumption and lactate production rates were measured to monitor the cells metabolic activity. Finally, mechanical and viscoelastic properties were assessed for the resulting tubular constructs. To this end, specific protocols and a focused know-how (manipulation, gripping, working in hydrated environment, and so on) were developed to characterize the engineered tissues.

In this work, we present a technique for the rapid fabrication of living vascular tissues by direct culturing of collagen, smooth muscle cells and endothelial cells. In addition, a new protocol for the mechanical characterization of engineered vascular tissues is described.

Synthetic materials are known to initiate clinical complications such as inflammation, stenosis, and infections when implanted as vascular substitutes. ...

Tissue Engineering by Intrinsic Vascularization in an In Vivo Tissue Engineering Chamber

In reconstructive surgery, there is a clinical need for an alternative to the current methods of autologous reconstruction which are complex, costly and trade one defect for another. Tissue engineering holds the promise to address this increasing demand. However, most tissue engineering strategies fail to generate stable and functional tissue substitutes because of poor vascularization. This paper focuses on an in vivo tissue engineering chamber model of intrinsic vascularization where a perfused artery and a vein either as an arteriovenous loop or a flow-through pedicle configuration is directed inside a protected hollow chamber. In this chamber-based system angiogenic sprouting occurs from the arteriovenous vessels and this system attracts ischemic and inflammatory driven endogenous cell migration which gradually fills the chamber space with fibro-vascular tissue. Exogenous cell/matrix implantation at the time of chamber construction enhances cell survival and determines specificity of the engineered tissues which develop. Our studies have shown that this chamber model can successfully generate different tissues such as fat, cardiac muscle, liver and others. However, modifications and refinements are required to ensure target tissue formation is consistent and reproducible. This article describes a standardized protocol for the fabrication of two different vascularized tissue engineering chamber models in vivo.

Tissue Engineering by Intrinsic Vascularization in an In Vivo Tissue Engineering Chamber

This is a guideline for constructing in vivo vascularized tissue using a microsurgical arteriovenous loop or a flow-through pedicle configuration inside a tissue engineering chamber. The vascularized tissues generated can be employed for organ regeneration and replacement of tissue defects, as well as for drug testing and disease modeling.

In reconstructive surgery, there is a clinical need for an alternative to the current methods of autologous reconstruction which are complex, costly and ...

The Arteriovenous (AV) Loop in a Small Animal Model to Study Angiogenesis and Vascularized Tissue Engineering

A functional blood vessel network is a prerequisite for the survival and growth of almost all tissues and organs in the human body. Moreover, in pathological situations such as cancer, vascularization plays a leading role in disease progression. Consequently, there is a strong need for a standardized and well-characterized in vivo model in order to elucidate the mechanisms of neovascularization and develop different vascularization approaches for tissue engineering and regenerative medicine.
We describe a microsurgical approach for a small animal model for induction of a vascular axis consisting of a vein and artery that are anastomosed to an arteriovenous (AV) loop. The AV loop is transferred to an enclosed implantation chamber to create an isolated microenvironment in vivo, which is connected to the living organism only by means of the vascular axis. Using 3D imaging (MRI, micro-CT) and immunohistology, the growing vasculature can be visualized over time. By implanting different cells, growth factors and matrices, their function in blood vessel network formation can be analyzed without any disturbing influences from the surroundings in a well controllable environment. 
In addition to angiogenesis and antiangiogenesis studies, the AV loop model is also perfectly suited for engineering vascularized tissues. After a certain prevascularization time, the generated tissues can be transplanted into the defect site and microsurgically connected to the local vessels, thereby ensuring immediate blood supply and integration of the engineered tissue. By varying the matrices, cells, growth factors and chamber architecture, it is possible to generate various tissues, which can then be tailored to the individual patient's needs.

The Arteriovenous AV Loop in a Small Animal Model to Study Angiogenesis and Vascularized Tissue Engineering

We describe a microsurgical approach for the generation of an arteriovenous (AV) loop as a model for analyzing vascularization in vivo in an isolated and well-characterized environment. This model is not only useful for the investigation of angiogenesis, but is also optimally suited for engineering axially vascularized and transplantable tissues.