This work was supported by introduces the talented person scientific research start funds subsidization project of Chengdu University of Traditional Chinese Medicine (030040015).

1. Sample preparation
<ol>
	<li>The present study utilized two-year-old A. sinensis with low temperature and long sunshine at an altitude of 2800 m from Min County, Gansu Province, as experimental materials.Three plants were selected from which more than three roots were selected for experimentation. Rinse the roots first with sterilized water and then clean them with an alcohol sprayer or alcohol swabs to prevent contamination that could affect the accuracy of the experimental results. Cut the roots into pieces smaller than 5 mm using a sterilized scalpel and mix for further analysis. (Figure 2). 
	NOTE: Alternatively, place the roots in liquid nitrogen to crisp up, making them easier to break. Depending on the shape, hardness, and other characteristics of the medicinal plants, use instruments to deal with them.</li>
	<li>Prepare three tubes of experimental samples for parallel experiments. Label each sample as AS-1, AS-2, and AS-3. Take about 100 mg fresh or 20 mg dry-weight tissue (air-dried) and place it in a 2 mL centrifuge tube.</li>
	<li>Place two 5 mm stainless steel beads into the 2 mL centrifuge tubes. Transfer the tubes to a high-throughput tissue grinder operating at 60 Hz for 60 s.</li>
</ol>
2 DNA extraction from sample
NOTE: This study uses a Plant Genomic DNA Extraction Kit, which is based on the CTAB method. DNA extraction is performed following the instruction manual with some modifications, including the addition of a unique Nuclear Isolation Buffer (NIB). The protocol improves DNA purity by first separating the contaminants from the tissue and then adding an initial nuclei isolation step28,29,30.
<ol>
	<li>Add 800 &#181;L of pre-cooled NIB and place the sample on a vortex mixer, vibrating for 5 min.</li>
	<li>Place in a centrifuge and process at 13,780 x g for 10 min. Remove the supernatant.</li>
	<li>Repeat steps 2.1-2.2 for an additional 3 rounds. 
	NOTE: NIB extracts higher-quality DNA, and its preparation contains some hazardous chemicals that must be handled in a fume hood, making it more difficult for novices to handle. However, this step is not mandatory. Users may opt to follow this recommendation or skip these steps. Its detailed formulation is in Table 1.</li>
	<li>Add 600 &#181;L of Buffer P1 and 5 &#181;L of RNase A (10 mg/mL). Place the sample on a vortex mixer and vortex to mix. Incubate the samples in a water bath at 65 &#176;C for 1.5 h, inverting the tubes 2x-3x during incubation.</li>
	<li>Add 200 &#181;L of Buffer P2, mix thoroughly, place on ice for 15 min, and then centrifuge at 13,780 x g for 10 min.</li>
	<li>Carefully aspirate the supernatant onto a filter column AF, centrifuge at 13,780 x g for 2 min, and transfer the lower filtrate collected in the collection tube to a new 1.5 mL centrifuge tube.</li>
	<li>Calculate the volume of filtrate, add 1.5x the volume of P3, and shake immediately to get a mixed solution.</li>
	<li>Add 650 &#181;L of the prepared mixture to an adsorbent column adsorption column (AC) and incubate for 5 min, then centrifuge at 13,780 x g for 30-60 s.</li>
	<li>Add the filtrate obtained from step 2.8 to the AC again, centrifuge, and discard the waste liquid. Repeat the procedure with the remaining mixed solution from step 2.7.</li>
	<li>Add 600 &#181;L of rinse solution WB, centrifuge at 13,780 x g for 30 s, discard the waste solution, and repeat the procedure 1x.</li>
	<li>Place the column AC back into the empty collection tube, centrifuge at 13,780 x g for 2 min, and leave at room temperature to remove residual ethanol.</li>
	<li>Take the adsorbent column AC and place it in a clean 1.5 mL centrifuge tube. Add 45 &#181;L of sterilized deionized water (ddH2O) to the middle of the adsorbent membrane, which has been heated to 65 &#176;C. Leave at room temperature for 5 min. Centrifuge at 13,780 x g for 2 min.</li>
	<li>Add the resulting solution back to the column and centrifuge at 13,780 x g for 2 min at room temperature.</li>
	<li>Collect the filtered solution. Use a spectrophotometer to determine DNA concentration; OD260 represents the absorbance of nucleic acids. Use the following criteria for DNA quality determination standard: OD260/OD280=1.80-2.00, the normal range; OD260/OD280&#62;2.00; there is a large amount of RNA contamination; OD260/OD280&#60;1.80, there are proteins, phenols, and other contaminants.</li>
</ol>
3 Target fragment amplification and detection
NOTE: Select appropriate amplification primers based on the plant&#39;s proposed DNA barcoding regions; reaction conditions are shown in Table 2.
<ol>
	<li>Set up the reaction conditions corresponding to primer amplification. Use 0.2 mL centrifuge tubes filled with 9.5 &#181;L of ddH2O, 12.5 &#181;L of 2x PCR Master Mix, and 1 &#181;L each of forward primer, reverse primer, and template DNA for a total volume of 25 &#181;L. Prepare a negative control, replacing the template with water.</li>
	<li>Add 20 mL of 1x Tris Acetate-EDTA (TEA) buffer and 0.2 g of agarose to heat and prepare a 1% agarose gel, then add 2 &#181;L of nucleic acid gel stain (10,000x) and mix thoroughly. Pour the mixture into a gel casting tray and allow it to solidify to obtain the agarose gel. Add 3 &#181;L of the PCR product and 2 &#181;L of DNA marker 5000 bp to the gel.</li>
	<li>Set the voltage at 120 V, the current at 400 mA, and electrophoresis for 40 min. Use a versatile gel image analysis system to view gels and check the results.</li>
</ol>
4. Data collection and analysis
NOTE: There is a wide range of sequence assembly and analysis software; we use Codon code Aligner V11.0.1 and MEGA11 as examples for illustration.
<ol>
	<li>Use the aligner to open the sequencing file to observe the peak map and splice the bidirectional sequencing peak map files.
	<ol>
		<li>Select Create a New Project and click OK to go to the software homepage. Select Add Samples under the File menu, select the File to be processed as sequence trace format, and import it directly into the software as the imported file at Unassembled Samples.</li>
		<li>Choose Contig, then, in the section, choose Advanced Assembly, and then choose Assemble in Groups. First-time users, after selecting Assemble in Groups, will see this dialog: Choose Define names. Modify the Define sample name parts according to the file name and click on Assemble. The aligned sequence will be displayed.</li>
		<li>Retrieve the complete ITS2 sequences according to hidden Markov model (HMM)-based model analysis. Use the 5.8s (CGAGGGCACGCCTGCCTGGGCGTCA) and 28s (CGACCCCAGGTCAGGCGGGGCCACC) sequences31 to search the aligned sequence from the beginning to remove the 5.8s and 28s regions.</li>
		<li>Select Go, then, in the section, select Search Sequence and click OK to get the matching sequence. Choose Contig, choose Delete in the section to remove the 5.8s and 28s regions and the low-quality sequences, and then the software will output the splicing sequences for matching.</li>
	</ol>
	</li>
	<li>Use the splicing sequences obtained from the three parallel experimental steps for identification, select BLAST search using the nucleotide database at The National Center for Biotechnology Information (NCBI), and select the Species Identification Tool and the Specific Primer ITS2 corresponding in the Global Pharmacopoeia Genome Database (GPGD) database. 
	NOTE: NCBI32 and GPGD33 include the nucleotide sequences of medicinal plants and animals and they are recognized as authoritative databases. Their major methods for identification are the methods based on sequence comparison34 (BLAST). The percentage identity from the identity results is used to determine whether the species with the greatest similarity is the target genus.</li>
	<li>Use MEGA11 for sequence alignment, analyze and compare intraspecific and interspecific sequence variation, and construct a phylogenetic neighbor-joining tree.
	<ol>
		<li>Download the sequences of three species of Angelica and one species of Peucedanum praeruptorum as an out-group from NCBI. Analyze these sequences together with the result sequence obtained.</li>
		<li>Click File, choose Open a File/Session to import the file, and a dialog will appear. Choose Align &#62; DNA, and select Align by ClustalW for sequence comparison. Choose Phylogenetic Analysis in Data, then return to the home page. Click Construct/Test Neighbor-Joining Tree in PHYLOGENY. The software generates a phylogenetic tree.</li>
	</ol>
	</li>
</ol>

DNA Barcoding for Medicinal Plants: Identification and Phylogenetic Analysis

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Molecular identification technology is easier to learn and master than traditional identification methods. It overcomes the limitations of traditional medicinal herb identification, as it is not affected by the plant&#39;s growth stage and does not rely on subjective judgment or the accumulation of specialized expertise35. Other species are confused with A. sinensis due to its similar morphology and medicinal parts, but with the use of DNA barcoding, it&#160;can be definitively identified...

Medicinal plants have a wide range of pharmacological effects and are important substances for the treatment and prevention of diseases. The market demand for medicinal plants in herbal medicines and pharmaceutical products is huge and still growing. With the increasing market for medicinal plants, the problem of adulteration has hindered the development of medicinal plants. Currently, medicinal plant adulteration suffers from these reasons: 1) the similar morphology of medicinal plants makes it difficult to identify and use them correctly1,2,3,4,5, 2) the increasing demand for medicinal plants has led to insufficient supply in the market6,7, 3) medicinal plants are expensive and have fluctuating prices, and the use of cheap herbs instead of economically valuable materials has led to adulteration and market profiteering8,9. To solve the problems of proper identification and use of medicinal plants, there is a need for a technology that allows non-specialists to identify the source10.
There are limitations to properly identifying and using medicinal plants by appearance and odor alone11. For more accurate identification and quality control, physicochemical methods are employed12. Thin-layer chromatography (TLC), for instance, is a rapid method for identifying medicinal herbs and is included in the Chinese Pharmacopoeia. Nevertheless, it requires reference standards to identify the plants13. High-performance liquid chromatography (HPLC) can perform both qualitative and quantitative tests, making it suitable for medicine quality testing. However, this instrument is expensive and requires specialized knowledge to operate14,15. DNA barcoding technology is a rapid and accurate species identification technology that identifies species by using stable DNA sequences to differentiate between plants with similar morphology. Hebert et al. proposed DNA barcoding technology to identify species, which uses a recognized and relatively short DNA sequence within the genome16, Chen et al. proposed ITS2 as a universal sequence for the molecular identification of medicinal plants and identified more than 6600 plants and found a high identification ability17. The study of medicinal plants based on ITS2 and chloroplast gene fragments has demonstrated the ability to distinguish species at the species level, with applications in the fields of resource protection, market regulation, and international trade17,18,19. The application of DNA barcoding can overcome the limitations of traditional identification methods, which is helpful in ensuring the quality and safety of medicinal plants, preventing resource abuse and confusion20. It has proven beneficial for studying medicinal plants, supporting the growth of the herbal industry in a sustainable manner, and providing a guarantee that the consumer uses the correct medication21,22,23,24.
The paper outlines protocols for how to apply DNA barcoding to identify medicinal plants using A. sinensis as an example. DNA barcoding utilizes one or more standardized short genetic markers in an organism&#39;s DNA to recognize it as belonging to a particular species. Current methods for identifying medicinal plants have certain limitations. Traditional morphological identification relies heavily on experts&#39; extensive experience, which can be influenced by human factors, while chemical identification is prone to issues like adulteration of key compounds. In contrast, DNA barcoding provides a more accurate means of species identification, offering advantages such as speed, high reproducibility, and stability. Furthermore, this technology enables centralized management and sharing of existing species sequence data through the internet and information platforms, significantly improving the efficiency and reliability of species identification11,12. Due to their similar morphology and medicinal parts, A. sinensis is often confused with other species and is frequently misused or intentionally substituted on the market25. Yang et al. identified A. anomala using DNA barcoding to distinguish it from false drugs26. Yuan et al. collected 23 species of Angelica and used DNA barcoding to differentiate between the various species27. By following the procedures described in this protocol, users will be able to authenticate plant-based medicinal materials from pre-processing to ultimately matching the barcoding sequence with the barcode database (Figure 1).

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>CTAB Rapid Plant Genomic DNA Extraction Kit</td>
			<td>Shanghai Huiling Biotechnology Co.</td>
			<td>NG411M</td>
			<td>Suitable for rapid extraction of high quality genomic DNA from different tissues of a wide range of plants</td>
		</tr>
		<tr>
			<td>DL5000 DNA Marker</td>
			<td>Nanjing vazyme Bio-technology Co.</td>
			<td>MD102-02</td>
			<td>Ready-to-use product, take an appropriate amount of this product directly for electrophoresis when running the gel.</td>
		</tr>
		<tr>
			<td>Electrophoresis</td>
			<td>Beijing Liuyi Biotechnology Co.</td>
			<td>DYY-6C</td>
			<td>Adopt touch screen design, can display set voltage, set current at the same time, parallel output</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid</td>
			<td>BeijingpsaitongBiotechnologyCo.,Ltd</td>
			<td>E70015-100G</td>
			<td>Nuclear Isolation Buffer formulation reagents.</td>
		</tr>
		<tr>
			<td>Goldview Nucleic Acid Gel Stain(10,000&#215;)</td>
			<td>Yisheng Biotechnology (Shanghai) Co., Ltd</td>
			<td>10201ES03</td>
			<td>When using agarose gel electrophoresis to detect DNA, it binds to DNA and produces a strong fluorescent signal.</td>
		</tr>
		<tr>
			<td>High-Speed Tabletop Centrifuge</td>
			<td>Changsha High-tech Industrial Development Zone Xiangyi Centrifuge Instrument Co.</td>
			<td>H1650</td>
			<td>For fast and efficient separation of samples, this compact and lightweight centrifuge offers reliable safety</td>
		</tr>
		<tr>
			<td>High-Throughput Tissue Grinder</td>
			<td>Shanghai Jingxin Industrial Development Co.</td>
			<td>Tiss-48</td>
			<td>A high-frequency vibration instrument for grinding samples</td>
		</tr>
		<tr>
			<td>http://www.gpgenome.com/</td>
			<td>Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences</td>
			<td>-</td>
			<td>HerbGenomics database includes genome sequences, gene sets, organelle genomes, low coverage genome data and DNA barcode sequences.</td>
		</tr>
		<tr>
			<td>https://www.ncbi.nlm.nih.gov/</td>
			<td>U.S. National Library of Medicine</td>
			<td>-</td>
			<td>The National Center for Biotechnology Information advances science and health by providing access to biomedical and genomic information.</td>
		</tr>
		<tr>
			<td>Kylin-Bell</td>
			<td>Haimen Qilinbel Instrument Manufacturing Co.</td>
			<td>VORTEX-5</td>
			<td>Rapid mixing in the form of a high-speed vortex, mixing speed, uniformity, thoroughness</td>
		</tr>
		<tr>
			<td>LifeTouch</td>
			<td>Hangzhou BORI Technology Co.</td>
			<td>TC-96/G/H(b)B</td>
			<td>Adoption of advanced thermoelectric refrigeration technology and newly created TAS technology to enhance its overall performance</td>
		</tr>
		<tr>
			<td>Multi-functional Gel Image Analysis System</td>
			<td>Southwest Operation Center of Shanghai Tianneng Life Science Co.</td>
			<td>Tanon-Mini Space 2000</td>
			<td>Performs rapid gene amplification experiments with a gradient function for mapping amplification conditions and a gradient temperature range of up to 30&#176;C</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Beijing Solarbio Science&#38;Technology Co.,Ltd.</td>
			<td>S8210-100</td>
			<td>Nuclear Isolation Buffer formulation reagents.</td>
		</tr>
		<tr>
			<td>Nanodrop One</td>
			<td>Genes Ltd.</td>
			<td>ND ONE</td>
			<td>Quantify DNA, RNA and protein samples in seconds with just 1-2 &#181;L of sample</td>
		</tr>
		<tr>
			<td>Polyvinyl pyrrolidone</td>
			<td>Shanghai yuanye Bio-Technology Co., Ltd</td>
			<td>S30268-500g</td>
			<td>Nuclear Isolation Buffer formulation reagents.</td>
		</tr>
		<tr>
			<td>Snowflake Ice Maker</td>
			<td>Shanghai Zhixin Experimental Instrument Technology Co.</td>
			<td>ZX-60X</td>
			<td>Adopting rotary extrusion ice making method, fast ice making speed and high efficiency of ice production</td>
		</tr>
		<tr>
			<td>Stainless Steel Beads for Tissue Homogenizer</td>
			<td>Beyotime Biotechnology.&#160;</td>
			<td>F6623</td>
			<td>Equipment for grinding and mixing of tissue and other samples by vibration</td>
		</tr>
		<tr>
			<td>Tris Acetate-EDTA buffer</td>
			<td>Beyotime Biotech Inc</td>
			<td>ST716</td>
			<td>TAE is a commonly used buffer for DNA electrophoresis, frequently employed in agarose gel electrophoresis.</td>
		</tr>
		<tr>
			<td>Tris-HCl</td>
			<td>Beijing Solarbio Science&#38;Technology Co.,Ltd.</td>
			<td>T8230</td>
			<td>Nuclear Isolation Buffer formulation reagents.</td>
		</tr>
		<tr>
			<td>Water bath Kettle</td>
			<td>Shanghai Senxin Experimental Instrument Co.</td>
			<td>DK-8D</td>
			<td>Precise thermostat and temperature regulation, accurate and reliable temperature control</td>
		</tr>
		<tr>
			<td>&#946;-mercaptoethanol</td>
			<td>Shanghai Eon Chemical Technology Co.</td>
			<td>R054186-100ml&#160;&#160;</td>
			<td>Nuclear Isolation Buffer formulation reagents.</td>
		</tr>
	</tbody>
</table>

application of dna barcoding to identify medicinal plants

Medicinal plants are valuable resources globally and are used worldwide to maintain health and treat disease; however, the presence of adulteration obstructs their development. DNA barcoding, a technique for species identification by standard DNA regions, facilitates prompt and accurate identification of traditional medicinal plants. The process of DNA barcoding entails six basic steps: 1) processing the medicinal plants, 2) extracting high-quality total DNA from the medicinal plants using centrifugal column method, 3) amplifying target DNA region internal transcribed spacer 2 (ITS2) with universal primers of plants and performing Sanger sequencing, 4) splicing and aligning sequence to obtain the target sequence, 5) matching the barcode sequence against the barcode library for identification, 6) aligning sequence, comparing intraspecific and interspecific variation, constructing phylogenetic neighbor-joining tree. As shown in the results, the universal primer can amplify the target region. Basic Local Alignment Search Tool (BLAST) demonstrates the percentage identified was 100%, and the neighbor-joining tree demonstrates that the splicing sequences were clustered with the A. sinensis OR879715.1 clade, and the clade support value is 100. This protocol provides a reference for applying DNA barcoding technology as an effective method to identify medicinal plants and adulterants.

Sample DNA quality
The range of OD260/OD280 absorbance ratios was 1.80-1.84. The DNA quantity measured by spectrophotometer for each sample was greater than 100 ng/&#181;L (Table 3), indicating a good quality of sample DNA extraction. This indicates that the samples were not contaminated by protein, RNA, or reagents during the extraction process and that they were of good quality and suitable for downstream PCR amplification.
<stron...

Author Spotlight: Harnessing DNA Barcode Technology to Enhance the Efficiency of Medicinal Plant Identification

The present protocol describes the use of DNA barcoding technology to authenticate plant-based medicinal materials, and the medicinal plant Angelica sinensis (Oliv.) Diels was identified as an example.

Application of DNA Barcoding to Identify Medicinal Plants

Medicinal plants are valuable resources globally and are used worldwide to maintain health and treat disease; however, the presence of adulteration ...

application-of-dna-barcoding-to-identify-medicinal-plants

Research

JoVE Journal

Genetics

1.1K Views.  Guizhou University of Traditional Chinese Medicine. The present protocol describes the use of DNA barcoding technology to authenticate plant-based medicinal materials, and the medicinal plant Angelica sinensis (Oliv.) Diels was identified as an example.

Video: Author Spotlight: Harnessing DNA Barcode Technology to Enhance the Efficiency of Medicinal Plant Identification

Peptide-derived Method to Transport Genes and Proteins Across Cellular and Organellar Barriers in Plants

The capacity to introduce exogenous proteins and express (or down-regulate) specific genes in plants provides a powerful tool for fundamental research as well as new applications in the field of plant biotechnology. Viable methods that currently exist for protein or gene transfer into plant cells, namely Agrobacterium and microprojectile bombardment, have disadvantages of low transformation frequency, limited host range, or a high cost of equipment and microcarriers. The following protocol outlines a simple and versatile method, which employs rationally-designed peptides as delivery agents for a variety of nucleic acid- and protein-based cargoes into plants. Peptides are selected as tools for development of the system due to their biodegradability, reduced size, diverse and tunable properties as well as the ability to gain intracellular/organellar access. The preparation, characterization and application of optimized formulations for each type of the wide range of delivered cargoes (plasmid DNA, double-stranded DNA or RNA, and protein) are described. Critical steps within the protocol, possible modifications and existing limitations of the method are also discussed.

Existing methods for the modification of plants have limited applicability. The novel peptide-derived technology proposed here promises both simplicity and efficiency in the introduction of exogenous protein or genes into the desired intracellular compartments of intact plants.

The capacity to introduce exogenous proteins and express (or down-regulate) specific genes in plants provides a powerful tool for fundamental research as ...

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the identification and verification of a drug resistance gene in the Apicomplexan parasite Toxoplasma gondii, the method of Quantitative Trait Locus (QTL) mapping using a Whole Genome Sequence (WGS) -based genetic map and the method of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 -based gene editing. The approach of QTL mapping allows one to test if there is a correlation between a genomic region(s) and a phenotype. Two datasets are required to run a QTL scan, a genetic map based on the progeny of a recombinant cross and a quantifiable phenotype assessed in each of the progeny of that cross. These datasets are then formatted to be compatible with R/qtl software that generates a QTL scan to identify significant loci correlated with the phenotype. Although this can greatly narrow the search window of possible candidates, QTLs span regions containing a number of genes from which the causal gene needs to be identified. Having WGS of the progeny was critical to identify the causal drug resistance mutation at the gene level. Once identified, the candidate mutation can be verified by genetic manipulation of drug sensitive parasites. The most facile and efficient method to genetically modify T. gondii is the CRISPR/Cas9 system. This system comprised of just 2 components both encoded on a single plasmid, a single guide RNA (gRNA) containing a 20 bp sequence complementary to the genomic target and the Cas9 endonuclease that generates a double-strand DNA break (DSB) at the target, repair of which allows for insertion or deletion of sequences around the break site. This article provides detailed protocols to use CRISPR/Cas9 based genome editing tools to verify the gene responsible for sinefungin resistance and to construct transgenic parasites.

QTL Mapping and CRISPR/Cas9 Editing to Identify a Drug Resistance Gene in Toxoplasma gondii

Details are presented on how QTL mapping with a whole genome sequence based genetic map can be used to identify a drug resistance gene in Toxoplasma gondii and how this can be verified with the CRISPR/Cas9 system that efficiently edits a genomic target, in this case the drug resistance gene.

Scientific knowledge is intrinsically linked to available technologies and methods. This article will present two methods that allowed for the ...

Sequential Salt Extractions for the Analysis of Bulk Chromatin Binding Properties of Chromatin Modifying Complexes

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous nature of most mammalian chromatin-modifying complexes. In order to overcome these hurdles, we have adapted a sequential salt extraction (SSE) assay for evaluating the relative binding affinities of chromatin-bound complexes. This easy and straightforward assay can be used by non-experts to evaluate the relative difference in binding affinity of two related complexes, the changes in affinity of a complex when a subunit is lost or an individual domain is inactivated, and the change in binding affinity after alterations to the chromatin landscape. By sequentially re-suspending bulk chromatin in increasing amounts of salt, we are able to profile the elution of a particular protein from chromatin. Using these profiles, we are able to determine how alterations in a chromatin-modifying complex or alterations to the chromatin environment affect binding interactions. Coupling SSE with other in vitro and in vivo assays, we can determine the roles of individual domains and proteins on the functionality of a complex in a variety of chromatin environments.

Sequential salt extraction of chromatin bound proteins is a useful tool for determining the binding properties of large protein complexes. This method can be employed to evaluate the role of individual subunits or domains in the overall affinity of a protein complex to bulk chromatin.

Elucidation of the binding properties of chromatin-targeting proteins can be very challenging due to the complex nature of chromatin and the heterogeneous ...

Generating Transgenic Plants with Single-copy Insertions Using BIBAC-GW Binary Vector

When generating transgenic plants, generally the objective is to have stable expression of a transgene. This requires a single, intact integration of the transgene, as multi-copy integrations are often subjected to gene silencing. The Gateway-compatible binary vector based on bacterial artificial chromosomes (pBIBAC-GW), like other pBIBAC derivatives, allows the insertion of single-copy transgenes with high efficiency. As an improvement to the original pBIBAC, a Gateway cassette has been cloned into pBIBAC-GW, so that the sequences of interest can now be easily incorporated into the vector transfer DNA (T-DNA) by Gateway cloning. Commonly, the transformation with pBIBAC-GW results in an efficiency of 0.2&#8211;0.5%, whereby half of the transgenics carry an intact single-copy integration of the T-DNA. The pBIBAC-GW vectors are available with resistance to Glufosinate-ammonium or DsRed fluorescence in seed coats for selection in plants, and with resistance to kanamycin as a selection in bacteria. Here, a series of protocols is presented that guide the reader through the process of generating transgenic plants using pBIBAC-GW: starting from recombining the sequences of interest into the pBIBAC-GW vector of choice, to plant transformation with Agrobacterium, selection of the transgenics, and testing the plants for intactness and copy number of the inserts using DNA blotting. Attention is given to designing a DNA blotting strategy to recognize single- and multi-copy integrations at single and multiple loci.

Using a pBIBAC-GW binary vector makes generating transgenic plants with intact single-copy insertions, an easy process. Here, a series of protocols is presented that guide the reader through the process of generating transgenic Arabidopsis plants, and testing the plants for intactness and copy number of the inserts.

When generating transgenic plants, generally the objective is to have stable expression of a transgene. This requires a single, intact integration of the ...

Simultaneous Video-EEG-ECG Monitoring to Identify Neurocardiac Dysfunction in Mouse Models of Epilepsy

In epilepsy, seizures can evoke cardiac rhythm disturbances such as heart rate changes, conduction blocks, asystoles, and arrhythmias, which can potentially increase risk of sudden unexpected death in epilepsy (SUDEP). Electroencephalography (EEG) and electrocardiography (ECG) are widely used clinical diagnostic tools to monitor for abnormal brain and cardiac rhythms in patients. Here, a technique to simultaneously record video, EEG, and ECG in mice to measure behavior, brain, and cardiac activities, respectively, is described. The technique described herein utilizes a tethered (i.e., wired) recording configuration in which the implanted electrode on the head of the mouse is hard-wired to the recording equipment. Compared to wireless telemetry recording systems, the tethered arrangement possesses several technical advantages such as a greater possible number of channels for recording EEG or other biopotentials; lower electrode costs; and greater frequency bandwidth (i.e., sampling rate) of recordings. The basics of this technique can also be easily modified to accommodate recording other biosignals, such as electromyography (EMG) or plethysmography for assessment of muscle and respiratory activity, respectively. In addition to describing how to perform the EEG-ECG recordings, we also detail methods to quantify the resulting data for seizures, EEG spectral power, cardiac function, and heart rate variability, which we demonstrate in an example experiment using a mouse with epilepsy due to Kcna1 gene deletion. Video-EEG-ECG monitoring in mouse models of epilepsy or other neurological disease provides a powerful tool to identify dysfunction at the level of the brain, heart, or brain-heart interactions.

Here, we present a protocol to record brain and heart bio signals in mice using simultaneous video, electroencephalography (EEG), and electrocardiography (ECG). We also describe methods to analyze the resulting EEG-ECG recordings for seizures, EEG spectral power, cardiac function, and heart rate variability.

In epilepsy, seizures can evoke cardiac rhythm disturbances such as heart rate changes, conduction blocks, asystoles, and arrhythmias, which can ...

RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA

Long non-coding RNA (lncRNA), which are sequences of more than 200 nucleotides without a defined reading frame, belong to the regulatory non-coding RNA&#39;s family. Although their biological functions remain largely unknown, the number of these lncRNAs has steadily increased and it is now estimated that humans may have more than 10,000 such transcripts. Some of these are known to be involved in important regulatory pathways of gene expression which take place at the transcriptional level, but also at different steps of RNA co- and post-transcriptional maturation. In the latter cases, RNAs that are targeted by the lncRNA have to be identified. That&#39;s the reason why it is useful to develop a method enabling the identification of RNAs associated directly or indirectly with a lncRNA of interest.
This protocol, which was inspired by previously published protocols allowing the isolation of a lncRNA together with its associated chromatin sequences, was adapted to permit the isolation of associated RNAs. We determined that two steps are critical for the efficiency of this protocol. The first is the design of specific anti-sense DNA oligonucleotide probes able to hybridize to the lncRNA of interest. To this end, the lncRNA secondary structure was predicted by bioinformatics and anti-sense oligonucleotide probes were designed with a strong affinity for regions that display a low probability of internal base pairing. The second crucial step of the procedure relies on the fixative conditions of the tissue or cultured cells that have to preserve the network between all molecular partners. Coupled with high throughput RNA sequencing, this RNA pull-down protocol can provide the whole RNA interactome of a lncRNA of interest.

This RNA pull-down method allows identifying the RNA targets of a long non-coding RNA (lncRNA). Based on the hybridization of home-made, designed anti-sense DNA oligonucleotide probes specific to this lncRNA in an appropriately fixed tissue or cell line, it efficiently allows the capture of all RNA targets of the lncRNA.

Long non-coding RNA (lncRNA), which are sequences of more than 200 nucleotides without a defined reading frame, belong to the regulatory non-coding ...

Enhanced Yeast One-hybrid Screens To Identify Transcription Factor Binding To Human DNA Sequences

Identifying the sets of transcription factors (TFs) that regulate each human gene is a daunting task that requires integrating numerous experimental and computational approaches. One such method is the yeast one-hybrid (Y1H) assay, in which interactions between TFs and DNA regions are tested in the milieu of the yeast nucleus using reporter genes. Y1H assays involve two components: a &#8216;DNA-bait&#8217; (e.g., promoters, enhancers, silencers, etc.) and a &#8216;TF-prey,&#8217; which can be screened for reporter gene activation. Most published protocols for performing Y1H screens are based on transforming TF-prey libraries or arrays into DNA-bait yeast strains. Here, we describe a pipeline, called enhanced Y1H (eY1H) assays, where TF-DNA interactions are interrogated by mating DNA-bait strains with an arrayed collection of TF-prey strains using a high density array (HDA) robotic platform that allows screening in a 1,536 colony format. This allows for a dramatic increase in throughput (60 DNA-bait sequences against &#62;1,000 TFs takes two weeks per researcher) and reproducibility. We illustrate the different types of expected results by testing human promoter sequences against an array of 1,086 human TFs, as well as examples of issues that can arise during screens and how to troubleshoot them.

Here, we present an enhanced yeast one-hybrid screening protocol to identify the transcription factors (TFs) that can bind to a human DNA region of interest. This method uses a high-throughput screening pipeline that can interrogate the binding of &#62;1,000 TFs in a single experiment.

Identifying the sets of transcription factors (TFs) that regulate each human gene is a daunting task that requires integrating numerous experimental and ...

Exploring Sequence Space to Identify Binding Sites for Regulatory RNA-Binding Proteins

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational steps are used to regulate specific genes. Sequence-specific nucleic acid-binding proteins target specific sequences to control spatial or temporal gene expression. The binding sites in nucleic acids are typically characterized by mutational analysis. However, numerous proteins of interest have no known binding site for such characterization. Here we describe an approach to identify previously unknown binding sites for RNA-binding proteins. It involves iterative selection and amplification of sequences starting with a randomized sequence pool. Following several rounds of these steps-transcription, binding, and amplification-the enriched sequences are sequenced to identify a preferred binding site(s). Success of this approach is monitored using in vitro binding assays. Subsequently, in vitro and in vivo functional assays can be used to assess the biological relevance of the selected sequences. This approach allows identification and characterization of a previously unknown binding site(s) for any RNA-binding protein for which an assay to separate protein-bound and unbound RNAs exists.

Sequence specificity is critical for gene regulation. Regulatory proteins that recognize specific sequences are important for gene regulation. Defining functional binding sites for such proteins is a challenging biological problem. An iterative approach for identification of a binding site for an RNA-binding protein is described here and is applicable to all RNA-binding proteins.

Gene regulation plays an important role in all cells. Transcriptional, post-transcriptional (or RNA processing), translational, and post-translational ...

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic screening using chemical mutagens is a useful strategy for mapping mutant phenotypes to genes among Drosophila and other model organisms that share conserved cellular pathways with humans. If the mutated gene of interest is not lethal in early developmental stages of flies, a climbing assay can be conducted to screen for phenotypic indicators of decreased brain functioning, such as low climbing rates. Subsequently, secondary histological analysis of brain tissue can be performed in order to verify the neuroprotective function of the gene by scoring neurodegeneration phenotypes. Gene mapping strategies include meiotic and deficiency mapping that rely on these same assays can be followed by DNA sequencing to identify possible nucleotide changes in the gene of interest.

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

We present a protocol using a forward genetic approach to screen for mutants exhibiting neurodegeneration in Drosophila melanogaster. It incorporates a climbing assay, histology analysis, gene mapping and DNA sequencing to ultimately identify novel genes related to the process of neuroprotection.

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic ...

A Bioinformatics Pipeline to Accurately and Efficiently Analyze the MicroRNA Transcriptomes in Plants

MicroRNAs (miRNAs) are 20- to 24-nucleotide (nt) endogenous small RNAs (sRNAs) extensively existing in plants and animals that play potent roles in regulating gene expression at the post-transcriptional level. Sequencing sRNA libraries by Next Generation Sequencing (NGS) methods has been widely employed to identify and analyze miRNA transcriptomes in the last decade, resulting in a rapid increase of miRNA discovery. However, two major challenges arise in plant miRNA annotation due to increasing depth of sequenced sRNA libraries as well as the size and complexity of plant genomes. First, many other types of sRNAs, in particular, short interfering RNAs (siRNAs) from sRNA libraries, are erroneously annotated as miRNAs by many computational tools. Second, it becomes an extremely time-consuming process for analyzing miRNA transcriptomes in plant species with large and complex genomes. To overcome these challenges, we recently upgraded miRDeep-P (a popular tool for miRNA transcriptome analyses) to miRDeep-P2 (miRDP2 for short) by employing a new filtering strategy, overhauling the scoring algorithm and incorporating newly updated plant miRNA annotation criteria. We tested miRDP2 against sequenced sRNA populations in five representative plants with increasing genomic complexity, including Arabidopsis, rice, tomato, maize and wheat. The results indicate that miRDP2 processed these tasks with very high efficiency. In addition, miRDP2 outperformed other prediction tools regarding sensitivity and accuracy. Taken together, our results demonstrate miRDP2 as a fast and accurate tool for analyzing plant miRNA transcriptomes, therefore a useful tool in helping the community better annotate miRNAs in plants.

A bioinformatics pipeline, namely miRDeep-P2 (miRDP2 for short), with updated plant miRNA criteria and an overhauled algorithm, could accurately and efficiently analyze microRNA transcriptomes in plants, especially for species with complex and large genomes.

MicroRNAs (miRNAs) are 20- to 24-nucleotide (nt) endogenous small RNAs (sRNAs) extensively existing in plants and animals that play potent roles in ...