نشكر الدكتور يوكو Nabeshima في جامعة كيوتو للتعليم لها على تقنية التشريح والسيدة آكي Miyakawa فوجيتا الصحة في الجامعة للحصول على دعم لها الفيلم. وأيد هذا العمل عن طريق برنامج للترويج للدراسات الأساسية في العلوم الصحية التابع للمعهد الوطني للابتكار الطبية الحيوية ، على منحة في والمساعدات للأبحاث العلمية في المجالات ذات الأولوية ، التكاملية أبحاث الدماغ (شيان) -- من وزارة التربية في اليابان ، والتي منحة في والمعونة من قمة اليابانية للعلوم والتكنولوجيا وكالة.

تشريح الحصين التلفيف المسنن <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ماوس في تخدير عميق ، تشريح الدماغ بدقة من خارج الجمجمة ووضعه في الفوسفات مخزنة المالحة الجليد الباردة (PBS). </li><li style=";text-align:right;direction:rtl"> في طبق بتري تحتوي على الجليد الباردة PBS ، وقطع الدماغ على طول الشق الطولي للمخ باستخدام سكين الجراحية ، وقطع المناطق الخلفية لامدا (الدماغ المتوسط ​​، الدماغ المؤخر ، والمخيخ). </li><li style=";text-align:right;direction:rtl"> مكان نصف الكرة المخية الجانب الإنسي صعودا و، وذلك باستخدام ملقط ، وإزالة بعناية الدماغ البيني (المهاد وتحت المهاد) تحت مجهر تشريح. وسوف يعرض هذا الجانب الإنسي من الحصين ، والسماح للتصور من التلفيف المسنن. التلفيف المسنن تكون مميزة من قرن آمون بواسطة الفجوات بينهما. سوف إصابة الحصين أو المنطقة المحيطة بها جعل الأمر أكثر صعوبة لعزل التلفيف المسنن. </li><li style=";text-align:right;direction:rtl"> إدراج حادة إبرة طرف (على سبيل المثال ، 27 قياس إبرة) في كل جانب من التلفيف المسنن (حدود التلفيف المسنن والهورن آمون ؛ الشكل 1) ، وحرك الإبر سطحيا على طول محور الحاجز والزمانية الحصين لعزل التلفيف المسنن. </li><li style=";text-align:right;direction:rtl"> التقط التلفيف المسنن معزولة باستخدام إبرة أو ملقط ووضعها في أنبوب العينة. ويمكن بالتالي استخدام الأنسجة التي تم الحصول عليها التلفيف المسنن العينة على الفور الحصول على أي فحص أو تخزينه في الفريزر العميقة لاستخدامها لاحقا. </li><li style=";text-align:right;direction:rtl"> عزل التلفيف المسنن من نصف الكرة المخية الأخرى التي تستخدم نفس الأسلوب. </li></ol> الكمية في الوقت الحقيقي PCR تم عزل التلفيف المسنن باستخدام الأسلوب المذكورة أعلاه ، وكان تشريح الحصين المتبقية على النحو عينة قرن آمون في البرية من نوع من الفئران. وأجريت في الوقت الحقيقي PCR بيتا من أكتين ، TDO2 ، DSP ، وMrg1b Tyro3 مع التلفيف المسنن وعينات الهورن آمون كما هو موضح سابقا 1. واستخدمت أجهزة الاشعال 5&#39; - CTGGCGAGATCACGATGACG و5&#39; AAGCTACGCTGTTGTCTAACC مقابل Mrg1b وGCCTCCAAATTGCCCGTCA و5&#39; CCAGCACTGGTACATGAGATCA مقابل Tyro3. تحليل ميكروأري وقد أجريت تجارب على الفئران البرية ميكروأري من نوع الفئران الذكور ومتخالف للشكل الإسوي ألفا من الكالسيوم / كالمودولين بروتين كيناز التي تعتمد على الثاني (ألفا كناس CaMKII + / -- الفئران) كما هو موضح سابقا 1. باختصار ، كان تهجين الحمض النووي الريبي معزولة عن الحصين كليا أو التلفيف المسنن من الفئران البرية من نوع ومتحولة مع مجموعة جينوم الفأر 2.0 430 (Affymetrix ، سانتا كلارا ، كاليفورنيا) ، وتفحص كل GeneChip من قبل الماسح GeneChip Affymetrix 3000 (GCS3000) . تم تنفيذ GeneChip التحليل مع تحليل ميكروأري جناح الإصدار 5.0.

<ol>
	<li>Yamasaki, N., Maekawa, M., Kobayashi, K., Kajii, Y., Maeda, J., Soma, M., Takao, K., Tanda, K., Ohira, K., Toyama, K., Kanzaki, K., Fukunaga, K., Sudo, Y., Ichinose, H., Ikeda, M., Iwata, N., Ozaki, N., Suzuki, H., Higuchi, M., Suhara, T., Yuasa, S., Miyakawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-CaMKII+deficiency+causes+immature+dentate+gyrus,+a+novel+candidate+endophenotype+of+psychiatric+disorders.">Alpha-CaMKII deficiency causes immature dentate gyrus, a novel candidate endophenotype of psychiatric disorders.</a> Mol. Brain. 1, 6-6 (2008).</li><li>Insausti, A. M., Megias, M., Crespo, D., Cruz-Orive, L. M., Dierssen, M., Vallina, I. F., Insausti, R., Florez, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hippocampal+volume+and+neuronal+number+in+Ts65Dn+mice:+a+murine+model+of+Down+syndrome.">Hippocampal volume and neuronal number in Ts65Dn mice: a murine model of Down syndrome.</a> Neurosci. Lett. 253, 175-175 (1998).</li><li>Redwine, J. M., Kosofsky, B., Jacobs, R. E., Games, D., Reilly, J. F., Morrison, J. H., Young, W. G., Bloom, F. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dentate+gyrus+volume+is+reduced+before+onset+of+plaque+formation+in+PDAPP+mice:+a+magnetic+resonance+microscopy+and+stereologic+analysis.">Dentate gyrus volume is reduced before onset of plaque formation in PDAPP mice: a magnetic resonance microscopy and stereologic analysis.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 1381-1381 (2003).</li><li>Lein, E. S., Zhao, X., Gage, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+a+molecular+atlas+of+the+hippocampus+using+DNA+microarrays+and+high-throughput+in+situ+hybridization.">Defining a molecular atlas of the hippocampus using DNA microarrays and high-throughput in situ hybridization.</a> J. Neurosci. 24, 3879-3879 (2004).</li><li>Matsuo, N., Yamasaki, N., Ohira, K., Takao, K., Toyama, K., Eguchi, M., Yamaguchi, S., Miyakawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+activity+changes+underlying+the+working+memory+deficit+in+alpha-CaMKII+heterozygous+knockout+mice.">Neural activity changes underlying the working memory deficit in alpha-CaMKII heterozygous knockout mice.</a> Front. Behav. Neurosci. 3, 20-20 (2009).</li><li>Franklin, K. B. J., Paxinos, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Mouse Brain in Stereotaxic Coordinates. , (1997).</li></ol>

وأجريت التجارب على الحيوانات وفقا للمعهد الوطني للصحة دليل لرعاية واستخدام الحيوانات المختبرية ، والتي وافقت عليها لجنة رعاية الحيوانات واستخدامها في جامعة فوجيتا الصحة.

التلفيف المسنن تحتل ما يقرب من 25 ٪ إلى 30 ٪ من حجم 2،3 تشكيل الحصين. انها تركيبة فريدة الخلية وتلعب أدوارا حاسمة في وظائف الدماغ المختلفة. ولذلك ، وتقنيات لعزل التلفيف المسنن مفيدة لتحليل الأحداث التي تحدث على وجه التحديد في هذه المنطقة. هنا ، وأثبتنا لإجراء تشريح بكفاءة التلفيف المسنن من الحصين الماوس الكبار وأكد دقة هذه التقنية. الأول ، كشفت دراسة نسيجية أن تم فصل التلفيف المسنن دون التلوث مناطق أخرى (الشكل 1) ، تشير إلى أنه يمكن إعداد عينة نقية التلفيف المسنن. الثانية ، وأكد لنا ان يتم تشريح الأنسجة التلفيف المسنن عن طريق إجراء PCR الوقت الحقيقي للجينات التلفيف المسنن محددة ، TDO2 وحزب اليسار الديمقراطى ، وقرن آمون الجينات المخصب ، وMrg1b Tyro3 4 (الشكل 2). عبارات مرنا من TDO2 (ع = 0.000023 ، ن ل= 4 و 4 على التوالي) ، وحزب اليسار الديمقراطى (ع = 0.0000030 ، ن ل= 4 و 4 على التوالي) تم الكشف في العينات التلفيف المسنن عند مستويات أعلى من الواضح ، في حين Mrg1b (ع = 0.000080 ، ن = 4 وو 4 على التوالي) وTyro3 (ع = 0.00017 ؛ ن = 4 وو 4 على التوالي) كانت أقل المستويات ، من تلك الموجودة في عينات من قرن آمون. ولم مستويات التعبير بيتا أكتين لا تختلف في هذه العينات (ع = 0.11 ، ن = في 4 و 4 على التوالي). وبالتالي ، فإننا يمكن أن تحقق ما إذا كان أو لم تشريح دقيق التلفيف المسنن بها إجراء مثل بسيط في الوقت الحقيقي التجارب PCR. قارنا الثالثة ، لتقييم مدى فائدة هذه الطريقة تشريح ، ومستوى التعبير مرنا الحصين مع ذلك كله من التلفيف المسنن. كله الحصين والتلفيف المسنن تم الحصول عليها من النوع البري (ن و= 9 و 4 على التوالي) ، وألفا كناس CaMKII + / -- تمت معالجة الفئران (= ن في 18 و 4 على التوالي) للتحليل [ميكروأري ، وبالنسبة لجميع الجينات وسجل ، وأمثالها تم احتساب التغيير عن طريق قسمة قيمة متحولة من قيمة من النوع البري. أشارت النتائج إلى أن تم الكشف عن التغييرات في التعبير مرنا ، وخصوصا من التلفيف المسنن جزيئات محددة مثل حزب اليسار الديمقراطى وTDO2 ، مع ما يصل الى زيادة بنسبة 5 أضعاف في الحساسية في عينات التلفيف المسنن مقارنة عينات الحصين كامل (الجدول 1). أثبتنا سابقا أن ألفا كناس CaMKII + / -- معرض السلوكيات الفئران يتصل باضطرابات نفسية الإنسان ، مثل العجز في الذاكرة العاملة ، والإيقاع دون اليوماوي مبالغا فيه 1،5. علاوة على ذلك ، ميزات المورفولوجي والكهربية للخلايا العصبية في التلفيف المسنن فئرانا معدلة وراثيا تشبه لافت للنظر لتلك الخلايا العصبية غير ناضجة التلفيف المسنن لدى القوارض العادية ، مشيرا إلى أن هذه الخلايا العصبية في الفئران الطافرة تفشل في تطوير إلى النضج 1. وغير ناضجة التعبير التلفيف وهبوطا التنظيم ، المسنن من حزب اليسار الديمقراطى وTDO2 مرنا في ألفا كناس CaMKII + / -- الفئران تتفق مع الحقائق التي يمكن استخدامها DSP وTDO2 كعلامات من الخلايا الحبيبية ناضجة في التلفيف المسنن (أوهيرا وآخرون ، غير منشورة. البيانات). أخذت معا ، ويمكن هذا الأسلوب تشريح مريحة ودقيقة تستخدم موثوق للدراسات ركزت على التلفيف المسنن. التلفيف المسنن الأنسجة التي تم الحصول عليها باستخدام هذه الطريقة تنطبق على أنواع أخرى من التحليلات أيضا ، بما في ذلك تحليلات بيولوجيا الخلية والبروتين. <img src="/files/ftp_upload/1543/1543fig1.jpg" alt="الشكل 1" /> الشكل 1. التحقق من التلفيف المسنن ومعزولة عن طريق دراسة نسيجية. تمت معالجة قسم من الدماغ الإكليلي بعد عزل التلفيف المسنن لتلطيخ نيسل (اللوحة اليمنى) ، والرسم التخطيطي مقتبس من مخ الفأر atlas6 يمثل تقريبا على نفس المستوى من المقطع هو موضح في اللوحة اليمنى (اللوحة اليمنى). تشير الأسهم لتوجيهات إبرة معلومات سرية. مقياس بار ، 1 ملم. <img src="/files/ftp_upload/1543/1543fig2.jpg" alt="الشكل 2" /> الشكل 2. التحقق من التلفيف المسنن لعزلها في الوقت الحقيقي PCR. تم تجهيز التلفيف المسنن والهورن عمون ليالي تم الحصول عليها من الفئران البرية من نوع أربعة لPCR الوقت الحقيقي من بيتا أكتين ، TDO2 ، DSP ، وMrg1b Tyro3. وتعرض نتائج كوسيلة ± SEM. على التحليل الإحصائي ، تم توظيف الطلاب ق ر الاختبار ، وتتبع القيم P : بيتا أكتين ، ع = 0.11 ؛ TDO2 ، ع = 0.000023 (** 1) ؛ DSP ، ع = 0.0000030 (** 2) ؛ Mrg1b ، ع = 0.000080 (** 3) ، وTyro3 ، ع = 0.00017 (** 4). الجدول 1. . ميكروأري تحليل كامل الحصين والتلفيف المسنن الجينات وأعرب تفاضلي في التلفيف المسنن والحصين كامل ألفا كناس CaMKII + / -- تم تحديد الفئران عن طريق حساب التغيير أضعاف من تلك التي رصدت في البرية من نوع الفئران. وقد تم تحليل البيانات من أجل الدلالة الإحصائية باستخدام اختبار الطالب ر ق بين نوع البرية وألفا كناس CaMKII + / -- الفئران. بين الجينات التي عرضت التعبير ع &lt;0.05 فيالتلفيف المسنن من + / ألفا كناس CaMKII -- الفئران مقارنة بما كان عليه من الفئران من النوع البري ، يتم سرد أهم 50 الجينات. علما أن عدد العينات لالتلفيف المسنن هي اقل بكثير من تلك التي لالحصين كله. AffyID ، Affymetrix التحقيق المعرف ؛ CKII ، ألفا كناس CaMKII + / -- الفئران ؛ WT والبرية من نوع الفئران. <table border="1" style=";text-align:right;direction:rtl"><tbody><tr><td></td><td></td><td></td><td></td><td colspan="2"> التلفيف المسنن (ع &lt;0.05) WT : ن = 4 ، CKII + / -- : ن = 4 </td><td></td><td colspan="2"> كله الحصين WT : ن = 9 ، CKII + / -- : ن = 18 </td></tr><tr><td> الجين المسمى </td><td> بنوك الجينات </td><td> AffyID </td><td></td><td> تغيير أضعاف </td><td> ع القيمة </td><td></td><td> تغيير أضعاف </td><td> ع القيمة </td></tr><tr><td> desmoplakin </td><td> AV297961 </td><td> 1435494_s_at </td><td></td><td> 0.011018913 </td><td> 7.02694E - 06 </td><td></td><td> 0.037021003 </td><td> 1.86126E - 13 </td></tr><tr><td> desmoplakin </td><td> AV297961 </td><td> 1435493_at </td><td></td><td> 0.014369734 </td><td> 7.86747E - 06 </td><td></td><td> 0.04232106 </td><td> 1.00579E - 12 </td></tr><tr><td> التربتوفان 2،3 - دي أكسيجيناز </td><td> AI098840 </td><td> 1419093_at </td><td></td><td> 0.020986484 </td><td> 5.23546E - 09 </td><td></td><td> 0.101037776 </td><td> 4.14823E - 13 </td></tr><tr><td> nephronectin </td><td> AA223007 </td><td> 1452106_at </td><td></td><td> 0.075479901 </td><td> 1.05191E - 08 </td><td></td><td> 0.234001154 </td><td> 1.66301E - 15 </td></tr><tr><td> nephronectin </td><td> AA223007 </td><td> 1452107_s_at </td><td></td><td> 0.079457767 </td><td> 1.40433E - 07 </td><td></td><td> 0.177974715 </td><td> 3.9758E - 12 </td></tr><tr><td> الافراج عن مستقبلات هرمون الثيروتروبين </td><td> M59811 </td><td> 1449571_at </td><td></td><td> 0.103105815 </td><td> 0.003093796 </td><td></td><td> 0.801412732 </td><td> 0.283994361 </td></tr><tr><td> ryanodine مستقبلات 1 ، الهيكل العظمي والعضلات </td><td> X83932 </td><td> 1427306_at </td><td></td><td> 0.104825517 </td><td> 3.38513E - 07 </td><td></td><td> 0.650685017 </td><td> 0.000308462 </td></tr><tr><td> جاهل الحلزون الحلزون الحلقة 1 </td><td> NM_010916 </td><td> 1419533_at </td><td></td><td> 9.431896 </td><td> 6.7979E - 06 </td><td></td><td> 4.078815314 </td><td> 5.27E - 11 </td></tr><tr><td> كوبين من أفراد العائلة التاسع </td><td> BB274531 </td><td> 1454653_at </td><td></td><td> 9.159157 </td><td> 7.99492E - 06 </td><td></td><td> 1.797304153 </td><td> 0.000296375 </td></tr><tr><td> doublecortin مثل كيناز 3 </td><td> BB326709 </td><td> 1436532_at </td><td></td><td> 0.109336662 </td><td> 1.95278E - 07 </td><td></td><td> 0.56697229 </td><td> 2.62633E - 08 </td></tr><tr><td> calpain 3 </td><td> AF127766 </td><td> 1426043_a_at </td><td></td><td> 0.111269769 </td><td> 8.07053E - 06 </td><td></td><td> 0.370956608 </td><td> 2.04421E - 14 </td></tr><tr><td> الكبار جسم المخطط الذكور ، بتبريد [كدنا] بالطول المخصب المكتبة ، استنساخ : C030023B07 المنتوج : تصنيفه ، وتسلسل إدراج كامل </td><td> BB357628 </td><td> 1460043_at </td><td></td><td> 0.118712341 </td><td> 6.16926E - 07 </td><td></td><td> 0.682339204 </td><td> 2.33001E - 06 </td></tr><tr><td> الكولاجين والكالسيوم EGF ملزمة المجالات 1 </td><td> AV264768 </td><td> 1437385_at </td><td></td><td> 0.124043978 </td><td> 3.65669E - 05 </td><td></td><td> 0.488394112 </td><td> 4.05538E - 06 </td></tr><tr><td> بيتا اميلويد (A4) السلائف بروتين ملزمة ، والأسرة ، وعضو 2 بروتين ملزمة </td><td> AK013520 </td><td> 1431946_a_at </td><td></td><td> 7.7986307 </td><td> 1.2098E - 06 </td><td></td><td> 2.099164713 </td><td> 1.67047E - 06 </td></tr><tr><td> calbindin - 28K </td><td> BB177770 </td><td> 1456934_at </td><td></td><td> 0.130255444 </td><td> 3.32186E - 06 </td><td></td><td> 0.572605751 </td><td> 1.99157E - 10 </td></tr><tr><td> كتب الموضع </td><td> AV328597 </td><td> 1443322_at </td><td></td><td> 0.133290835 </td><td> 5.43583E - 06 </td><td></td><td> 0.562767164 </td><td> 7.56544E - 06 </td></tr><tr><td> neuropeptide Y مستقبلات Y2 </td><td> NM_008731 </td><td> 1417489_at </td><td></td><td> 0.135319609 </td><td> 0.000113407 </td><td></td><td> 0.781498474 </td><td> 0.00394504 </td></tr><tr><td> رأس عنصر البروتين استجابة ملزمة 1 </td><td> BE197381 </td><td> 1428657_at </td><td></td><td> 0.138235114 </td><td> 7.93691E - 07 </td><td></td><td> 0.651220705 </td><td> 2.94209E - 05 </td></tr><tr><td> الدبقية خط خلية عصبية المستمدة عائلة مستقبلات ألفا عامل 2 </td><td> BB284482 </td><td> 1433716_x_at </td><td></td><td> 0.139062563 </td><td> 2.35371E - 06 </td><td></td><td> 0.669544709 </td><td> 0.000214146 </td></tr><tr><td> preproenkephalin 1 </td><td> M13227 </td><td> 1427038_at </td><td></td><td> 6.9850435 </td><td> 2.39074E - 08 </td><td></td><td> 1.766018828 </td><td> 0.000250501 </td></tr><tr><td> بتبريد الجين 1810010H24 [كدنا] </td><td> BI729991 </td><td> 1428809_at </td><td></td><td> 6.8658915 </td><td> 1.88516E - 05 </td><td></td><td> 2.77573142 </td><td> 6.81865E - 09 </td></tr><tr><td> ryanodine مستقبلات 1 ، الهيكل العظمي والعضلات </td><td> BG793713 </td><td> 1457347_at </td><td></td><td> 0.151364292 </td><td> 3.35612E - 05 </td><td></td><td> 0.503144617 </td><td> 4.32907E - 05 </td></tr><tr><td> protocadherin 21 </td><td> NM_130878 </td><td> 1418304_at </td><td></td><td> 0.152671849 </td><td> 8.57783E - 06 </td><td></td><td> 0.670714726 </td><td> 1.56309E - 05 </td></tr><tr><td> cornichon homolog 3 (ذبابة الفاكهة) </td><td> NM_028408 </td><td> 1419517_at </td><td></td><td> 0.153724144 </td><td> 8.90755E - 06 </td><td></td><td> 0.95780695 </td><td> 0.661055608 </td></tr><tr><td> الهراكيرى طريقة يابانية فى الانتحار ، BCL2 التفاعل البروتين (يحتوي فقط BH3 المجال) </td><td> BQ175572 </td><td> 1439854_at </td><td></td><td> 0.154284407 </td><td> 2.0118E - 05 </td><td></td><td> 0.56516812 </td><td> 4.86925E - 09 </td></tr><tr><td> الكربوهيدرات (N - acetylgalactosamine 4-0) ناقلة السلفات 9 </td><td> AK017407 </td><td> 1431897_at </td><td></td><td> 0.155238951 </td><td> 5.37423E - 06 </td><td></td><td> 1.14910007 </td><td> 0.215637733 </td></tr><tr><td> calpain 3 </td><td> AI323605 </td><td> 1433681_x_at </td><td></td><td> 0.160871988 </td><td> 1.07655E - 05 </td><td></td><td> 0.477164757 </td><td> 1.33753E - 11 </td></tr><tr><td> الاصبع الزنك ، وتحتوي على 5 المجال CCHC </td><td> BQ126004 </td><td> 1437355_at </td><td></td><td> 0.161812078 </td><td> 3.08262E - 06 </td><td></td><td> 0.421252632 </td><td> 0.01152969 </td></tr><tr><td> loricrin </td><td> NM_008508 </td><td> 1448745_s_at </td><td></td><td> 0.165129967 </td><td> 1.86362E - 05 </td><td></td><td> 0.639733409 </td><td> 0.000729772 </td></tr><tr><td> spondin 1 ، (F - spondin) خارج الخلية البروتين المصفوفة </td><td> BC020531 </td><td> 1451342_at </td><td></td><td> 0.168035879 </td><td> 6.67867E - 07 </td><td></td><td> 0.821042412 </td><td> 0.023650765 </td></tr><tr><td> [كدنا] بتبريد A930035E12 الجين </td><td> AV348640 </td><td> 1429906_at </td><td></td><td> 5.9086795 </td><td> 1.747E - 07 </td><td></td><td> 1.470383201 </td><td> 0.104085454 </td></tr></tbody><tbody><tr><td> BB247294 بتبريد كامل طول المخصب ، 7 أيام الوليد استنساخ [كدنا] المخيخ العضلة المصحف A730018G18 3 &#39;، تسلسل مرنا. </td><td> BB247294 </td><td> 1447907_x_at </td><td></td><td> 5.9047494 </td><td> 1.04931E - 05 </td><td></td><td> 1.968147585 </td><td> 0.00010636 </td></tr><tr><td> سعر الصرف الثابت التي تحتوي على نطاق 3 </td><td> BB099015 </td><td> 1437075_at </td><td></td><td> 5.860216 </td><td> 0.000345581 </td><td></td><td> 2.780297178 </td><td> 1.83072E - 06 </td></tr><tr><td&gt; pentraxin العصبية 2 / / / البروتين افتراضية LOC100044234 </td><td> NM_016789 </td><td> 1420720_at </td><td></td><td> 5.7568517 </td><td> 1.34227E - 06 </td><td></td><td> 2.652516957 </td><td> 0.000206279 </td></tr><tr><td> كتب متواليات </td><td> BG076361 </td><td> 1460101_at </td><td></td><td> 5.657735 </td><td> 2.5015E - 06 </td><td></td><td> 1.296248831 </td><td> 0.22870031 </td></tr><tr><td> spondin 1 ، (F - spondin) خارج الخلية البروتين المصفوفة </td><td> BC020531 </td><td> 1424415_s_at </td><td></td><td> 0.17783576 </td><td> 1.01658E - 06 </td><td></td><td> 0.836181248 </td><td> 0.001380141 </td></tr><tr><td> calbindin - 28K </td><td> BB246032 </td><td> 1448738_at </td><td></td><td> 0.180317904 </td><td> 1.35961E - 05 </td><td></td><td> 0.647334052 </td><td> 4.12268E - 09 </td></tr><tr><td> MARCKS 1 الشبيه </td><td> AV110584 </td><td> 1437226_x_at </td><td></td><td> 0.186235935 </td><td> 1.47067E - 06 </td><td></td><td> 0.499291387 </td><td> 2.34984E - 08 </td></tr><tr><td> matrilin 2 </td><td> BB338441 </td><td> 1455978_a_at </td><td></td><td> 0.187783528 </td><td> 6.19122E - 05 </td><td></td><td> 0.8967688 </td><td> 0.282337853 </td></tr><tr><td> matrilin 2 </td><td> BC005429 </td><td> 1419442_at </td><td></td><td> 0.188195795 </td><td> 0.000105295 </td><td></td><td> 0.915528892 </td><td> 0.35282097 </td></tr><tr><td> spondin 1 ، (F - spondin) خارج الخلية البروتين المصفوفة </td><td> BQ175871 </td><td> 1442613_at </td><td></td><td> 0.189956563 </td><td> 9.41195E - 06 </td><td></td><td> 0.861033222 </td><td> 0.1394266 </td></tr><tr><td> arrestin 3 ، الشبكية </td><td> NM_133205 </td><td> 1450329_a_at </td><td></td><td> 5.2130346 </td><td> 2.90599E - 05 </td><td></td><td> 3.944218329 </td><td> 1.07437E - 07 </td></tr><tr><td> [كدنا] بتبريد A330050F15 الجين </td><td> AV325555 </td><td> 1457558_at </td><td></td><td> 0.19186781 </td><td> 0.000119342 </td><td></td><td> 0.660282035 </td><td> 2.47342E - 05 </td></tr><tr><td> contactin 3 </td><td> BB559510 </td><td> 1438628_x_at </td><td></td><td> 0.194404608 </td><td> 4.08641E - 07 </td><td></td><td> 0.918742591 </td><td> 0.022545297 </td></tr><tr><td> calbindin - 28K </td><td> BB246032 </td><td> 1417504_at </td><td></td><td> 0.196381321 </td><td> 2.24182E - 05 </td><td></td><td> 0.619305124 </td><td> 3.6222E - 06 </td></tr><tr><td> غاسترين الإفراج الببتيد </td><td> BC024515 </td><td> 1424525_at </td><td></td><td> 4.9436426 </td><td> 3.00588E - 05 </td><td></td><td> 2.752845903 </td><td> 5.72954E - 07 </td></tr><tr><td> sortilin ذات الصلة التي تحتوي على مستقبلات المجال VPS10 3 </td><td> AK018111 </td><td> 1425111_at </td><td></td><td> 4.885766 </td><td> 1.03645E - 05 </td><td></td><td> 1.29051599 </td><td> 0.029733649 </td></tr><tr><td> مستقبلات الدوبامين D1A </td><td> BE957273 </td><td> 1455629_at </td><td></td><td> 4.869493 </td><td> 3.77525E - 05 </td><td></td><td> 1.815881979 </td><td> 0.000516498 </td></tr><tr><td> طليعة البروتين كونفيرتاز سبتيليزين / كيكسن اكتب 5 </td><td> BB241731 </td><td> 1437339_s_at </td><td></td><td> 0.210528027 </td><td> 7.83039E - 05 </td><td></td><td> 0.574126078 </td><td> 9.15496E - 05 </td></tr></tbody><tbody><tr><td> مستقبلات انترلوكين 1 ، النوع الأول </td><td> NM_008362 </td><td> 1448950_at </td><td></td><td> 0.210572243 </td><td> 9.64524E - 06 </td><td></td><td> 0.241135352 </td><td> 2.79816E - 08 </td></tr></tbody></table>

dissection of hippocampal dentate gyrus from adult mouse

قرن آمون هو واحد من أكثر المناطق درس على نطاق واسع في الدماغ بسبب دورها وظيفية هامة في معالجة الذاكرة والتعلم ، في الخلية العصبية اللدونة ملحوظا ، ومشاركتها في الصرع ، والأمراض العصبية والاضطرابات النفسية. تتألف الحصين من المناطق المتميزة ، ويتم توصيل التلفيف المسنن ، الذي يضم أساسا الخلايا العصبية الحبيبية ، وقرن آمون ، الذي يضم العصبونات الهرمية أساسا ، وكلا المنطقتين الدوائر التشريحية والوظيفية. يتم التعبير بشكل انتقائي mRNAs مختلفة كثيرة ، والبروتينات في التلفيف المسنن ، والتلفيف المسنن هو موقع من الخلايا العصبية للبالغين ، وهذا هو ، تتولد باستمرار خلايا عصبية جديدة في التلفيف المسنن والكبار. التحقيق مرنا والبروتين تعبيرا محددا للالتلفيف المسنن ، وغالبا ما يستخدم الليزر microdissection الالتقاط. هذا الأسلوب لديه بعض القيود ، ومع ذلك ، مثل الحاجة إلى أجهزة خاصة وإجراءات التعامل مع تعقيدا. في هذا البروتوكول الفيديو المسجلة ، ونحن يبرهن على وجود تقنية تشريح لإزالة التلفيف المسنن من الماوس الكبار تحت stereomicroscope. عينات التلفيف المسنن المعدة باستخدام هذه التقنية هي مناسبة لأية مقايسة ، بما في ذلك البروتين ، transcriptomic ، وخلية التحليل البيولوجيا. اكدنا ان تشريح الأنسجة هو التلفيف المسنن عن طريق إجراء PCR الوقت الحقيقي للجينات محددة المسنن التلفيف ، التربتوفان 2،3 - دي أكسيجيناز (TDO2) وdesmoplakin (DSP) ، وقرن آمون الجينات المخصب ميس المتصلة 1B الجين (Mrg1b ) وTYRO3 التيروزين كيناز البروتين 3 (Tyro3). تم الكشف عن التعبيرات ومرنا من TDO2 DSP في العينات التلفيف المسنن عند مستويات أعلى من الواضح ، في حين Mrg1b Tyro3 وكانت أدنى المستويات ، من تلك الموجودة في عينات من قرن آمون. للتدليل على الاستفادة من هذا الأسلوب ، أجرينا تحليل الحمض النووي ميكروأري باستخدام عينات من الحصين كله والتلفيف المسنن. أظهرت الفئران ، و0،037 0.10 أضعاف مقارنة التغييرات التي من نوع الفئران البرية ، على التوالي -- التعبير مرنا من TDO2 وحزب اليسار الديمقراطى ، والتي يتم التعبير عنها بشكل انتقائي في التلفيف المسنن ، في قرن آمون كامل + / ألفا كناس CaMKII. التلفيف المسنن لفي عزلة ، ومع ذلك ، عرضت هذه التعبيرات 0.011 و 0.021 أضعاف مقارنة التغييرات التي من نوع الفئران البرية ، مما يدل على أن التغيرات في التعبير الجيني التلفيف المسنن يمكن الكشف بقدر أكبر من الحساسية. أخذت معا ، ويمكن هذا الأسلوب تشريح مريحة ودقيقة تستخدم موثوق للدراسات ركزت على التلفيف المسنن.

Watch this Scientific Journal Video about Dissection of Hippocampal Dentate Gyrus from Adult Mouse at JoVE.com

Dissection of Hippocampal Dentate Gyrus from Adult Mouse

وأظهر تشريح تقنية لإزالة التلفيف المسنن من الماوس الكبار تحت stereomicroscope في هذا البروتوكول الفيديو المسجلة.

تشريح التلفيف المسنن من الحصين ماوس الكبار

The hippocampus is one of the most widely studied areas in the brain because of its important functional role in memory processing and learning, its ...

dissection-of-hippocampal-dentate-gyrus-from-adult-mouse

Research

JoVE Journal

Biology

82.2K Views.  Japan Science and Technology Agency, Core Research for Evolutionary Science and Technology (CREST). وأظهر تشريح تقنية لإزالة التلفيف المسنن من الماوس الكبار تحت stereomicroscope في هذا البروتوكول الفيديو المسجلة.

Video: Dissection of Hippocampal Dentate Gyrus from Adult Mouse

Dissection of 6.5 dpc Mouse Embryos

Analysis of gene expression patterns during early stages of mammalian embryonic development can provide important clues about gene function, cell-cell interaction and signaling mechanisms that guide embryonic patterning. However, dissection of the mouse embryo from the decidua shortly after implantation can be a challenging procedure, and detailed step-by-step documentation of this process is lacking.

Here we demonstrate how post-implantation (6.5 dpc) embryos are isolated by first dissecting the uterus of a pregnant mouse (detection of the vaginal plug was designated day 0.5 poist coitum) and subsequently dissecting the embryo from maternal decidua. The dissection of Reichert's membrane is described as well as the removal of the ectoplacental cone.

Isolation of postimplantation-stage embryos allows one to study gene patterning and analyze cell-lineage decision making processes during embryonic development, but proper dissection of the early embryo can be challenging. This protocol describes a method for isolating early primitive-streak-stage embryos (~6.5 days post coitum [dpc]).

تشريح 6.5 أجنة الفئران DPC

Analysis of gene expression patterns during early stages of mammalian embryonic development can provide important clues about gene function, cell-cell ...

Dissection of Organs from the Adult Zebrafish

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental analysis of the embryo and larva is extensive and the morphology has been well documented, descriptions of adult zebrafish anatomy and studies of development of the adult structures and organs, together with techniques for working with adults are lacking. The organs of the larva undergo significant changes in their overall structure, morphology, and anatomical location during the larval to adult transition.  Externally, the transparent larva develops its characteristic adult striped pigment pattern and paired pelvic fins, while internally, the organs undergo massive growth and remodeling.  In addition, the bipotential gonad primordium develops into either testis or ovary.  This protocol identifies many of the organs of the adult and demonstrates methods for dissection of the brain, gonads, gastrointestinal system, heart, and kidney of the adult zebrafish. The dissected organs can be used for in situ hybridization, immunohistochemistry, histology, RNA extraction, protein analysis, and other molecular techniques.  This protocol will assist in the broadening of studies in the zebrafish to include the remodeling of larval organs, the morphogenesis of organs specific to the adult and other investigations of the adult organ systems.

This protocol describes a procedure for identifying and dissecting organs from the adult zebrafish.

تشريح هيئات من اسماك الزرد الكبار

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental ...

Dissection of Oenocytes from Adult Drosophila melanogaster

In Drosophila melanogaster, as in other insects, a waxy layer on the outer surface of the cuticle, composed primarily of hydrocarbon compounds, provides protection against desiccation and other environmental challenges. Several of these cuticular hydrocarbon (CHC) compounds also function as semiochemical signals, and as such mediate pheromonal communications between members of the same species, or in some instances between different species, and influence behavior. Specialized cells referred to as oenocytes are regarded as the primary site for CHC synthesis. However, relatively little is known regarding the involvement of the oenocytes in the regulation of the biosynthetic, transport, and deposition pathways contributing to CHC output. Given the significant role that CHCs play in several aspects of insect biology, including chemical communication, desiccation resistance, and immunity, it is important to gain a greater understanding of the molecular and genetic regulation of CHC production within these specialized cells. The adult oenocytes of D. melanogaster are located within the abdominal integument, and are metamerically arrayed in ribbon-like clusters radiating along the inner cuticular surface of each abdominal segment. In this video article we demonstrate a dissection technique used for the preparation of oenocytes from adult D. melanogaster. Specifically, we provide a detailed step-by-step demonstration of (1) how to fillet prepare an adult Drosophila abdomen, (2) how to identify the oenocytes and discern them from other tissues, and (3) how to remove intact oenocyte clusters from the abdominal integument. A brief experimental illustration of how this preparation can be used to examine the expression of genes involved in hydrocarbon synthesis is included. The dissected preparation demonstrated herein will allow for the detailed molecular and genetic analysis of oenocyte function in the adult fruit fly.

Dissection of Oenocytes from Adult Drosophila melanogaster

In insects, the oenocytes produce cuticular hydrocarbon compounds. These compounds protect against desiccation and facilitate chemical communication. Here we demonstrate a dissection technique used to isolate the oenocytes from adult Drosophila melanogaster, and illustrate how this preparation can be utilized to study genes involved in hydrocarbon synthesis.

تشريح Oenocytes من الكبار ذبابة الفاكهة السوداء البطن</em

In Drosophila melanogaster, as in other insects, a waxy layer on the outer surface of the cuticle, composed primarily of hydrocarbon compounds, provides ...

Dissection of the Adult Zebrafish Kidney

Researchers working in the burgeoning field of adult stem cell biology seek to understand the signals that regulate the behavior and function of stem cells during normal homeostasis and disease states. The understanding of adult stem cells has broad reaching implications for the future of regenerative medicine1. For example, better knowledge about adult stem cell biology can facilitate the design of therapeutic strategies in which organs are triggered to heal themselves or even the creation of methods for growing organs in vitro that can be transplanted into humans1. The zebrafish has become a powerful animal model for the study of vertebrate cell biology2. There has been extensive documentation and analysis of embryonic development in the zebrafish3. Only recently have scientists sought to document adult anatomy and surgical dissection techniques4, as there has been a progressive movement within the zebrafish community to broaden the applications of this research organism to adult studies. For example, there are expanding interests in using zebrafish to investigate the biology of adult stem cell populations and make sophisticated adult models of diseases such as cancer5. Historically, isolation of the zebrafish adult kidney has been instrumental for studying hematopoiesis, as the kidney is the anatomical location of blood cell production in fish6,7. The kidney is composed of nephron functional units found in arborized arrangements, surrounded by hematopoietic tissue that is dispersed throughout the intervening spaces. The hematopoietic component consists of hematopoietic stem cells (HSCs) and their progeny that inhabit the kidney until they terminally differentiate8. In addition, it is now appreciated that a group of renal stem/progenitor cells (RPCs) also inhabit the zebrafish kidney organ and enable both kidney regeneration and growth, as observed in other fish species9-11. In light of this new discovery, the zebrafish kidney is one organ that houses the location of two exciting opportunities for adult stem cell biology studies. It is clear that many outstanding questions could be well served with this experimental system. To encourage expansion of this field, it is beneficial to document detailed methods of visualizing and then isolating the adult zebrafish kidney organ. This protocol details our procedure for dissection of the adult kidney from both unfixed and fixed animals.
Dissection of the kidney organ can be used to isolate and characterize hematopoietic and renal stem cells and their offspring using established techniques such as histology, fluorescence activated cell sorting (FACS)11,12, expression profiling13,14, and transplantation11,15. 
We hope that dissemination of this protocol will provide researchers with the knowledge to implement broader use of zebrafish studies that ultimately can be translated for human application.

The zebrafish kidney is home to both renal and hematopoietic adult stem/progenitor cells, and represents an outstanding opportunity to study these cell types and their progeny in a vertebrate model organism. Here, we demonstrate a detailed dissection procedure that enables the researcher to identify and surgically remove the adult zebrafish kidney, which can be used for applications such as cell isolation, transplantation, and expression studies of kidney and/or blood cell populations.

تشريح الكلى اسماك الزرد الكبار

Researchers working in the burgeoning field of adult stem cell biology seek to understand the signals that regulate the behavior and function of stem ...

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work examining post-embryonic through adult cardiac development has been limited7-10. Examining the changing morphology of the maturing and aging heart are restricted by the lack of techniques available for staging and isolating juvenile and adult hearts. In order to analyze heart development over the fish's lifespan, we dissect zebrafish hearts at numerous stages and photograph them for further analysis11. The morphological features of the heart can easily be quantified and individual hearts can be further analyzed by a host of standard methods. Zebrafish grow at variable rates and maturation correlates better with fish size than age, thus, post-fixation, we photograph and measure fish length as a gauge of fish maturation. This protocol explains two distinct, size dependent dissection techniques for zebrafish, ranging from larvae 3.5mm standard length (SL) with hearts of 100&mu;m ventricle length (VL), to adults, with SL of 30mm and VL 1mm or larger. Larval and adult fish have quite distinct body and organ morphology. Larvae are not only significantly smaller, they have less pigment and each organ is visually very difficult to identify. For this reason, we use distinct dissection techniques.
We used pre-dissection fixation procedures, as we discovered that hearts dissected directly after euthanization have a more variable morphology, with very loose and balloon like atria compared with hearts removed following fixation. The fish fixed prior to dissection, retain in vivo morphology and chamber position (data not shown). In addition, for demonstration purposes, we take advantage of the heart (myocardial) specific GFP transgenic Tg(myl7:GFP)twu34 (12), which allows us to visualize the entire heart and is particularly useful at early stages in development when the cardiac morphology is less distinct from surrounding tissues. Dissection of the heart makes further analysis of the cell and molecular biology underlying heart development and maturation using in situ hybridization, immunohistochemistry, RNA extraction or other analytical methods easier in post-embryonic zebrafish. This protocol will provide a valuable technique for the study of cardiac development maturation and aging.

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

A clear, standardized method for dissection and isolation of the zebrafish heart at multiple developmental stages are described. Annotation and quantification techniques are also discussed.

تشريح القلب في اليرقات ، اسماك الزرد الأحداث والكبار ، دانيو rerio</em

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

جيل من الفئران المستمدة من الخلايا الجذعية المحفزة المستحثة

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Isolation and Culture of Primary Mouse Keratinocytes from Neonatal and Adult Mouse Skin

The keratinocyte (KC) is the predominant cell type in the epidermis, the outermost layer of the skin. Epidermal KCs play a critical role in providing skin defense by forming an intact skin barrier against environmental insults, such as UVB irradiation or pathogens, and also by initiating an inflammatory response upon those insults. Here we describe methods to isolate KCs from neonatal mouse skin and from adult mouse tail skin. We also describe culturing conditions using defined growth supplements (dGS) in comparison to chelexed fetal bovine serum (cFBS). Functionally, we show that both neonatal and adult KCs are highly responsive to high calcium-induced terminal differentiation, tight junction formation and stratification. Additionally, cultured adult KCs are susceptible to UVB-triggered cell death and can release large amounts of TNF upon UVB irradiation. Together, the methods described here will be useful to researchers for the setup of in vitro models to study epidermal biology in the neonatal mouse and/or the adult mouse.

Epidermal keratinocytes form a functional skin barrier and are positioned at the front line of host defense against external environmental insults. Here we describe methods for isolation and primary culture of epidermal keratinocytes from neonatal and adult mouse skin, and induction of terminal differentiation and UVB-triggered inflammatory response from keratinocytes.

عزل وثقافة الكرياتينية الماوس الرئيسية من حديثي الولادة والفأر الكبار الجلد

The keratinocyte (KC) is the predominant cell type in the epidermis, the outermost layer of the skin. Epidermal KCs play a critical role in providing skin ...

Isolation, Characterization, and Differentiation of Cardiac Stem Cells from the Adult Mouse Heart

Myocardial infarction (MI) is a leading cause of morbidity and mortality around the world. A major goal of regenerative medicine is to replenish the dead myocardium after MI. Although several strategies have been used to regenerate myocardium, stem cell therapy remains a major approach to replenish the dead myocardium of an MI heart. Accumulating evidence suggests the presence of resident cardiac stem cells (CSCs) in the adult heart and their endocrine and/or paracrine effects on cardiac regeneration. However, CSC isolation and their characterization and differentiation toward myocardial cells, especially cardiomyocytes, remains a technical challenge. In the present study, we provided a simple method for the isolation, characterization, and differentiation of CSCs from the adult mouse heart. Here, we describe a density gradient method for the isolation of CSCs, where the heart is digested by a 0.2% collagenase II solution. To characterize the isolated CSCs, we evaluated the expression of CSCs/cardiac markers Sca-1, NKX2-5, and GATA4, and pluripotency/stemness markers OCT4, SOX2, and Nanog. We also determined the proliferation potential of isolated CSCs by culturing them in a Petri dish and assessing the expression of the proliferation marker Ki-67. For evaluating the differentiation potential of CSCs, we selected seven- to ten-days cultured CSCs. We transferred them to a new plate with a cardiomyocyte differentiation medium. They are incubated in a cell culture incubator for 12 days, while the differentiation medium is changed every three days. The differentiated CSCs express cardiomyocyte-specific markers: actinin and troponin I. Thus, CSCs isolated with this protocol have stemness and cardiac markers, and they have a potential for proliferation and differentiation toward cardiomyocyte lineage.

The overall goal of this article is to standardize the protocol for the isolation, characterization, and differentiation of cardiac stem cells (CSCs) from the adult mouse heart. Here, we describe a density gradient centrifugation method to isolate murine CSCs and elaborated methods for CSC culture, proliferation, and differentiation into cardiomyocytes.

عزل وتوصيف والتفريق في القلب من الخلايا الجذعية من قلب الماوس الكبار

Myocardial infarction (MI) is a leading cause of morbidity and mortality around the world. A major goal of regenerative medicine is to replenish the dead ...

Isolation and Culture of Primary Oral Keratinocytes from the Adult Mouse Palate

For years, most studies involving keratinocytes have been conducted using human and mouse skin epidermal keratinocytes. Recently, oral keratinocytes have attracted attention because of their unique function and characteristics. They maintain the homeostasis of the oral epithelium and serve as resources for applications in regenerative therapies. However, in vitro studies that use oral primary keratinocytes from adult mice have been limited due to the lack of an efficient and well-established culture protocol. Here, oral primary keratinocytes were isolated from the palate tissues of adult mice and cultured in a commercial low-calcium medium supplemented with a chelexed-serum. Under these conditions, keratinocytes were maintained in a proliferative or stem cell-like state, and their differentiation was inhibited even after increased passages. Marker expression analysis showed that the cultured oral keratinocytes expressed the basal cell markers p63, K14, and &#945;6-integrin and were negative for the differentiation marker K13 and the fibroblast marker PDGFR&#945;. This method produced viable and culturable cells suitable for downstream applications in the study of oral epithelial stem cell functions in vitro.

The present protocol describes the isolation and culture of oral keratinocytes derived from the adult mouse palate. An evaluation method using immunostaining is also reported.

عزل وثقافة الكريات الكيراتينية الفموية الأولية من الحنك الفأري البالغ

For years, most studies involving keratinocytes have been conducted using human and mouse skin epidermal keratinocytes. Recently, oral keratinocytes have ...

Nuclei Isolation from Adult Mouse Kidney for Single-Nucleus RNA-Sequencing

The kidneys regulate diverse biological processes such as water, electrolyte, and acid-base homeostasis. Physiological functions of the kidney are executed by multiple cell types arranged in a complex architecture across the corticomedullary axis of the organ. Recent advances in single-cell transcriptomics have accelerated the understanding of cell type-specific gene expression in renal physiology and disease. However, enzyme-based tissue dissociation protocols, which are frequently utilized for single-cell RNA-sequencing (scRNA-seq), require mostly fresh (non-archived) tissue, introduce transcriptional stress responses, and favor the selection of abundant cell types of the kidney cortex resulting in an underrepresentation of cells of the medulla.
Here, we present a protocol that avoids these problems. The protocol is based on nuclei isolation at 4 &#176;C from frozen kidney tissue. Nuclei are isolated from a central piece of the mouse kidney comprised of the cortex, outer medulla, and inner medulla. This reduces the overrepresentation of cortical cells typical for whole-kidney samples for the benefit of medullary cells such that data will represent the entire corticomedullary axis at sufficient abundance. The protocol is simple, rapid, and adaptable and provides a step towards the standardization of single-nuclei transcriptomics in kidney research.

Here, we present a protocol to isolate high-quality nuclei from frozen mouse kidneys that improve the representation of medullary kidney cell types and avoids the gene expression artifacts from enzymatic tissue dissociation.