우리는 영화에 그녀의 지원을 위해 해부의 기술과 후지타 보건 대학 부인 아키 미야 카와 그녀의지도 교토 대학에서 박사 요코 나베시마 감사합니다. 일본에서 MEXT에서 그리고에 의해 -이 작품은 바이오 메디컬 기술 혁신, 우선 분야 - 통합 뇌 연구 (Shien)에 학술 연구 보조금의 국립 연구소의 건강 과학 기초 연구의 진흥을위한 프로그램에 의해 지원되었다 그랜트 - - 에이드에서 일본의 과학 기술 기관의 크레스트에서.

hippocampal 이가있는 이랑의 해부 <ol><li> 깊은 anesthetized 마우스에서 조심스럽게 두개골의 두뇌를 해부하다 얼음처럼 차가운 인산 버퍼 호수 (PBS)에 넣습니다. </li><li> 얼음처럼 차가운 PBS를 포함하는 페트리 접시에, 수술 칼을 사용하여 뇌를의 종방향 균열 (fissure)을 따라 머리를 잘라, 그리고 람다에 후부의 영역을 (midbrain, hindbrain 및 소뇌) 잘라. </li><li> 대뇌 반구 내측 측면을 놓고, 집게를 사용하여 신중하게 해부 현미경 아래 diencephalon을 (시상과 시상 하부)를 제거하십시오. 이것은 이가있는 이랑의 시각화에 대한 허용, 해마의 중간 측면을 폭로합니다. 이가있는 이랑 그들 사이의 차이에 의해 암몬의 호른에서 구별됩니다. 해마이나 주변 지역으로 부상은 더 어려워 이가있는 이랑을 분리하는 것입니다. </li><li> 이가있는 이랑 (이가있는 이랑과 암몬의 호른 경계, 그림 1)의 각 측면에 날카로운 바늘 끝 (예, 27 게이지 바늘) 삽입 및 분리 해마의 셉토 - 시간적 축을 따라 표면적으로 바늘을 슬라이드 이가있는 이랑. </li><li> 바늘이나 집게를 사용하여 격리 이가있는 이랑을 선택하고 샘플 튜브에 놓으십시오. 따라서 - 얻은 이가있는 이랑 조직 샘플은 어떤 분석을 위해 즉시 사용하거나 나중에 사용하기 위해 깊은 냉동실에 저장할 수 있습니다. </li><li> 같은 방법을 사용하여 다른 대뇌 반구에서 이가있는 이랑을 분리. </li></ol> 정량 실시간 PCR 이가있는 이랑은 위에서 언급한 방법과 나머지 해마가 야생 형 생쥐에서 암몬의 호른 샘플로 밖으로 해부했다를 사용하여 격리되었다. 베타 굴지, TDO2, DSP, Mrg1b 및 Tyro3의 실시간 PCR은 이가있는 이랑과 이전 1에서 설명하는 것처럼 암몬의 나팔 소리 샘플과 함께 수행했다. Primers 5&#39; - CTGGCGAGATCACGATGACG 및 5&#39; - AAGCTACGCTGTTGTCTAACC은 Tyro3에 대한 Mrg1b, 그리고 GCCTCCAAATTGCCCGTCA 및 5&#39; - CCAGCACTGGTACATGAGATCA 사용되었습니다. Microarray 분석 (- 마우스 알파 - CaMKII + /)로 이전 1 설명한 Microarray 실험은 남성 야생 형 마우스 및 칼슘 / calmodulin에 의존 단백질 키나 아제 II의 알파 이소형에 대한 heterozygous 생쥐와 함께 수행했다. 간단히, 야생 타입과 돌연변이 생쥐의 전체 해마 또는 이가있는 이랑으로부터 격리 RNA는 마우스 게놈 430 2.0 배열 (Affymetrix, 산타 클라라, CA)를 hybridized되었고, 각 GeneChip은 Affymetrix GeneChip 스캐너 3000 (GCS3000)로 스캔했습니다 . GeneChip Microarray 분석은 분석 스위트 버전 5.0과 함께 수행했다.

<ol>
	<li>Yamasaki, N., Maekawa, M., Kobayashi, K., Kajii, Y., Maeda, J., Soma, M., Takao, K., Tanda, K., Ohira, K., Toyama, K., Kanzaki, K., Fukunaga, K., Sudo, Y., Ichinose, H., Ikeda, M., Iwata, N., Ozaki, N., Suzuki, H., Higuchi, M., Suhara, T., Yuasa, S., Miyakawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-CaMKII+deficiency+causes+immature+dentate+gyrus,+a+novel+candidate+endophenotype+of+psychiatric+disorders.">Alpha-CaMKII deficiency causes immature dentate gyrus, a novel candidate endophenotype of psychiatric disorders.</a> Mol. Brain. 1, 6-6 (2008).</li><li>Insausti, A. M., Megias, M., Crespo, D., Cruz-Orive, L. M., Dierssen, M., Vallina, I. F., Insausti, R., Florez, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hippocampal+volume+and+neuronal+number+in+Ts65Dn+mice:+a+murine+model+of+Down+syndrome.">Hippocampal volume and neuronal number in Ts65Dn mice: a murine model of Down syndrome.</a> Neurosci. Lett. 253, 175-175 (1998).</li><li>Redwine, J. M., Kosofsky, B., Jacobs, R. E., Games, D., Reilly, J. F., Morrison, J. H., Young, W. G., Bloom, F. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dentate+gyrus+volume+is+reduced+before+onset+of+plaque+formation+in+PDAPP+mice:+a+magnetic+resonance+microscopy+and+stereologic+analysis.">Dentate gyrus volume is reduced before onset of plaque formation in PDAPP mice: a magnetic resonance microscopy and stereologic analysis.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 1381-1381 (2003).</li><li>Lein, E. S., Zhao, X., Gage, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+a+molecular+atlas+of+the+hippocampus+using+DNA+microarrays+and+high-throughput+in+situ+hybridization.">Defining a molecular atlas of the hippocampus using DNA microarrays and high-throughput in situ hybridization.</a> J. Neurosci. 24, 3879-3879 (2004).</li><li>Matsuo, N., Yamasaki, N., Ohira, K., Takao, K., Toyama, K., Eguchi, M., Yamaguchi, S., Miyakawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+activity+changes+underlying+the+working+memory+deficit+in+alpha-CaMKII+heterozygous+knockout+mice.">Neural activity changes underlying the working memory deficit in alpha-CaMKII heterozygous knockout mice.</a> Front. Behav. Neurosci. 3, 20-20 (2009).</li><li>Franklin, K. B. J., Paxinos, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Mouse Brain in Stereotaxic Coordinates. , (1997).</li></ol>

동물 실험 관리 및 실험실 동물의 사용에 대한 건강 가이드의 국립 연구소에 따라 수행하고, 후지타 보건 대학에서 동물 보호 및 사용위원회의 승인되었습니다.

이가있는 이랑이 hippocampal 형성 2,3의 볼륨의 약 25 % 30 % 차지하고 있습니다. 그것은 독특한 세포 구성을 가지고 있으며 다양한 뇌 기능에 중요한 역할을 담당합니다. 따라서 이가있는 이랑을 분리하는 기술은이 지역에서 특히 발생하는 이벤트를 분석하는 데 유용합니다. 여기, 우리는 효율적으로 성인 마우스 해마에서 이가있는 이랑을 해부하다하는 절차를 시연하고 기술의 정밀도를 확인했습니다. 첫째, histologic 연구는 이가있는 이랑이 순수한 이가있는 이랑 샘플을 준비할 수 나타내는 다른 지역에 의해 오염 (그림 1)하지 않고 분리된 것으로 나타났다. 둘째, 우리는 해부 조직 이가있는 이랑 특정 유전자, TDO2 및 DSP, 그리고 암몬의 경적 농축 유전자, Mrg1b 및 Tyro3 4 (그림 2)의 실시간 PCR을 실시하여 이가있는 이랑되어있는 것으로 확인되었습니다. TDO2의 mRNA 표현 (P = 0.000023; N의 = 4, 4, 각각)와 DSP (P = 0.0000030; N의 각각 = 4 4) 이가있는 이랑 샘플의는 분명 높은 수준에서 발견되었습니다 반면 Mrg1b (P = 0.000080; N의 = 4, 4, 각각)와 Tyro3 (P = 0.00017; N의 각각 = 4 4) 암몬의 호른 샘플에서보다 낮은 수준되었습니다. (; N의 = 4, 4, 각각 P = 0.11) 베타 굴지의 표현 수준이 샘플에서는 다를하지 않았다. 따라서, 우리는 이가있는 이랑이 정확하게 같은 간단한 실시간 PCR 실험을 실시 의해 해부되었다 여부를 확인 수 있습니다. 이 절개 방법의 유용성을 평가하기 위해, 셋째, 우리는 이가있는 이랑의와 전체 해마의 mRNA 발현 수준을 비교했다. 생쥐 (각각 N의 = 18 4) microarray 분석을위한 처리했고, 모든 유전자 득점 들어, 접이식 - 야생 형 (N의 = 9, 4, 각각)와 알파 - CaMKII + /이 얻은 전체 해마와 이가있는 이랑 변경 사항은 야생 형 값에 의해 돌연변이 가치를 나누어 계산했습니다. 결과는 특히 DSP 및 TDO2 같은 이가있는 이랑 특정 분자의 mRNA 표현의 변화가, 전체 hippocampal 샘플 (표 1)에 비해 이가있는 이랑 샘플의 감도에 5 배 증가와 발견 있다고 지적했다. 쥐 전시 행동과 같은 작업 메모리 결손과 과장 infradian 리듬 1.5 인간 정신 장애에 관한 - 우리는 이전에 알파 - CaMKII + / 그 보여주었다. 또한 돌연변이 생쥐에있는 이가있는 이랑의 뉴런의 morphologic 및 electrophysiologic 기능은 이러한 돌연변이 생쥐의 뉴런은 만기 1 개발에 실패했음을 나타냅니다 정상적인 설치류에 미숙한 이가있는 이랑의 뉴런의 것과 놀랍도록 닮아있다. 미숙 이가있는 이랑 아래 - 규제 DSP의 표현과 알파 - CaMKII의 TDO2 mRNA는 + / - 생쥐는 DSP와 TDO2는 이가있는 이랑 (오히라 외의 성숙 과립 세포의 마커로 사용될 수있다는 발견과 일치 있으며, 게시되지 않은. 데이터). 함께 촬영이 편리하고 정확한 해부 기술은 안정적으로 이가있는 이랑에 초점을 맞춘 연구에 사용될 수 있습니다. 이 방법을 사용하여 얻은 이가있는 이랑 조직 및 세포 생물학 proteomic 분석을 포함한 분석뿐만 아니라 다른 유형의에 적용됩니다. <img src="/files/ftp_upload/1543/1543fig1.jpg" alt="그림 1" /> 그림 1. histologic 연구에 의해 격리 이가있는 이랑을 확인한다. 이가있는 이랑을 분리 후 뇌의 코로나 섹션 Nissl 얼룩 (왼쪽 패널)의 처리, 그리고 마우스 뇌 atlas6에서 적응 도식 그림은 왼쪽 패널 (오른쪽 패널)에 표시된 섹션의 거의 동일한 수준을 나타냅니다했다. 화살표는 바늘 팁 삽입의 방향을 나타냅니다. 스케일 바, 1mm. <img src="/files/ftp_upload/1543/1543fig2.jpg" alt="그림 2" /> 그림 2. 실시간 PCR에 의해 격리 이가있는 이랑을 확인한다. 네 야생 형 생쥐에서 얻은 이가있는 이랑과 암몬의 나팔 소리는 실시간으로 베타 - 굴지의 PCR, TDO2, DSP, Mrg1b 및 Tyro3에 대한 처리되었습니다. 결과는 ± SEM을 수단으로 제공됩니다. 통계 분석을 위해, 학생 S T 시험은 채용되었고, P 값은 다음과 같습니다 베타 굴지, P = 0.11; TDO2, P = 0.000023 (** 1), DSP, P = 0.0000030 (** 2) Mrg1b, P = 0.000080 (** 3), 그리고 Tyro3, ​​P = 0.00017 (** 4). 표 1. . 전체 해마와 이가있는 이랑의 Microarray 분석 유전자 differentially 알파 - CaMKII의 이가있는 이랑과 전체 해마로 표현 + / - 생쥐는 야생 형 생쥐에서 발견되는의 접이식 변화를 계산하여 결정됩니다. 생쥐 - 데이터는 야생 유형 및 알파 - CaMKII + / 사이의 학생 S T 테스트를 사용하여 통계적 의의에 대한 분석했다. 유전자 중에는 그의 표현은 &lt;0.05의 P를 전시알파 - CaMKII + /의 이가있는 이랑 - 야생 형 생쥐의 비교 생쥐는 상위 50 개 유전자가 나열되어 있습니다. 이가있는 이랑에 대한 샘플의 숫자가 훨씬 적은 전체 해마에 비해됩니다. AffyID, Affymetrix 프로브 식별자, CKII, 알파 - CaMKII + / - 생쥐, WT, 야생 형 생쥐. <table border="1"><tbody><tr><td></td><td></td><td></td><td></td><td colspan="2"> 이가있는 이랑 (P는 &lt;0.05) WT : N = 4, CKII + / - : N = 4 </td><td></td><td colspan="2"> 전체 해마 WT : N = 9, CKII + / - : N = 18 </td></tr><tr><td> 유전자 제목 </td><td> Genebank </td><td> AffyID </td><td></td><td> 폴드 변경 </td><td> P 값 </td><td></td><td> 폴드 변경 </td><td> P 값 </td></tr><tr><td> desmoplakin </td><td> AV297961 </td><td> 1435494_s_at </td><td></td><td> 0.011018913 </td><td> 7.02694E - 06 </td><td></td><td> 0.037021003 </td><td> 1.86126E - 13 </td></tr><tr><td> desmoplakin </td><td> AV297961 </td><td> 1435493_at </td><td></td><td> 0.014369734 </td><td> 7.86747E - 06 </td><td></td><td> 0.04232106 </td><td> 1.00579E - 12 </td></tr><tr><td> 트립토판 2,3 - dioxygenase </td><td> AI098840 </td><td> 1419093_at </td><td></td><td> 0.020986484 </td><td> 5.23546E - 09 </td><td></td><td> 0.101037776 </td><td> 4.14823E - 13 </td></tr><tr><td> nephronectin </td><td> AA223007 </td><td> 1452106_at </td><td></td><td> 0.075479901 </td><td> 1.05191E - 08 </td><td></td><td> 0.234001154 </td><td> 1.66301E - 15 </td></tr><tr><td> nephronectin </td><td> AA223007 </td><td> 1452107_s_at </td><td></td><td> 0.079457767 </td><td> 1.40433E - 07 </td><td></td><td> 0.177974715 </td><td> 3.9758E - 12 </td></tr><tr><td> thyrotropin이 호르몬 수용체를 발표 </td><td> M59811 </td><td> 1449571_at </td><td></td><td> 0.103105815 </td><td> 0.003093796 </td><td></td><td> 0.801412732 </td><td> 0.283994361 </td></tr><tr><td> ryanodine 수용체 1, 골격근 </td><td> X83932 </td><td> 1427306_at </td><td></td><td> 0.104825517 </td><td> 3.38513E - 07 </td><td></td><td> 0.650685017 </td><td> 0.000308462 </td></tr><tr><td> 무지한 나선형 루프 나선 일 </td><td> NM_010916 </td><td> 1419533_at </td><td></td><td> 9.431896 </td><td> 6.7979E - 06 </td><td></td><td> 4.078815314 </td><td> 5.27E - 11 </td></tr><tr><td> copine 가족 구성원 IX </td><td> BB274531 </td><td> 1454653_at </td><td></td><td> 9.159157 </td><td> 7.99492E - 06 </td><td></td><td> 1.797304153 </td><td> 0.000296375 </td></tr><tr><td> doublecortin 같은 키나제 3 </td><td> BB326709 </td><td> 1436532_at </td><td></td><td> 0.109336662 </td><td> 1.95278E - 07 </td><td></td><td> 0.56697229 </td><td> 2.62633E - 08 </td></tr><tr><td> calpain 3 </td><td> AF127766 </td><td> 1426043_a_at </td><td></td><td> 0.111269769 </td><td> 8.07053E - 06 </td><td></td><td> 0.370956608 </td><td> 2.04421E - 14 </td></tr><tr><td> 성인 남성 코퍼스의 striatum cDNA, RIKEN 전체 길이 풍부한 라이브러리, 클론 : C030023B07 제품 : unclassifiable 전체 삽입 순서 </td><td> BB357628 </td><td> 1460043_at </td><td></td><td> 0.118712341 </td><td> 6.16926E - 07 </td><td></td><td> 0.682339204 </td><td> 2.33001E - 06 </td></tr><tr><td> 콜라겐 및 칼슘 결합 EGF가 1 도메인 </td><td> AV264768 </td><td> 1437385_at </td><td></td><td> 0.124043978 </td><td> 3.65669E - 05 </td><td></td><td> 0.488394112 </td><td> 4.05538E - 06 </td></tr><tr><td> 아밀로이드 베타 (A4) 전구체 단백질 바인딩, 가족, 회원이 결합 단백질 </td><td> AK013520 </td><td> 1431946_a_at </td><td></td><td> 7.7986307 </td><td> 1.2098E - 06 </td><td></td><td> 2.099164713 </td><td> 1.67047E - 06 </td></tr><tr><td> calbindin - 28K </td><td> BB177770 </td><td> 1456934_at </td><td></td><td> 0.130255444 </td><td> 3.32186E - 06 </td><td></td><td> 0.572605751 </td><td> 1.99157E - 10 </td></tr><tr><td> 베꼈는데 로커스 </td><td> AV328597 </td><td> 1443322_at </td><td></td><td> 0.133290835 </td><td> 5.43583E - 06 </td><td></td><td> 0.562767164 </td><td> 7.56544E - 06 </td></tr><tr><td> neuropeptide Y 수용체 Y2 </td><td> NM_008731 </td><td> 1417489_at </td><td></td><td> 0.135319609 </td><td> 0.000113407 </td><td></td><td> 0.781498474 </td><td> 0.00394504 </td></tr><tr><td> RAS 반응 요소 결합 단백질 1 </td><td> BE197381 </td><td> 1428657_at </td><td></td><td> 0.138235114 </td><td> 7.93691E - 07 </td><td></td><td> 0.651220705 </td><td> 2.94209E - 05 </td></tr><tr><td> glial 세포 라인 neurotrophic 요인 가족 수용체에게 알파 2 파생 </td><td> BB284482 </td><td> 1433716_x_at </td><td></td><td> 0.1390​​62563 </td><td> 2.35371E - 06 </td><td></td><td> 0.669544709 </td><td> 0.000214146 </td></tr><tr><td> preproenkephalin 1 </td><td> M13227 </td><td> 1427038_at </td><td></td><td> 6.9850435 </td><td> 2.39074E - 08 </td><td></td><td> 1.766018828 </td><td> 0.000250501 </td></tr><tr><td> RIKEN cDNA 유전자 1810010H24 </td><td> BI729991 </td><td> 1428809_at </td><td></td><td> 6.8658915 </td><td> 1.88516E - 05 </td><td></td><td> 2.77573142 </td><td> 6.81865E - 09 </td></tr><tr><td> ryanodine 수용체 1, 골격근 </td><td> BG793713 </td><td> 1457347_at </td><td></td><td> 0.151364292 </td><td> 3.35612E - 05 </td><td></td><td> 0.503144617 </td><td> 4.32907E - 05 </td></tr><tr><td> protocadherin 21 </td><td> NM_130878 </td><td> 1418304_at </td><td></td><td> 0.152671849 </td><td> 8.57783E - 06 </td><td></td><td> 0.670714726 </td><td> 1.56309E - 05 </td></tr><tr><td> cornichon의 상동체 3 (Drosophila) </td><td> NM_028408 </td><td> 1419517_at </td><td></td><td> 0.153724144 </td><td> 8.90755E - 06 </td><td></td><td> 0.95780695 </td><td> 0.661055608 </td></tr><tr><td> harakiri, BCL2 상호 작용하는 단백질 (단 BH3 도메인을 포함) </td><td> BQ175572 </td><td> 1439854_at </td><td></td><td> 0.154284407 </td><td> 2.0118E - 05 </td><td></td><td> 0.56516812 </td><td> 4.86925E - 09 </td></tr><tr><td> 탄수화물 (N - acetylgalactosamine 4-0) sulfotransferase 9 </td><td> AK017407 </td><td> 1431897_at </td><td></td><td> 0.155238951 </td><td> 5.37423E - 06 </td><td></td><td> 1.14910007 </td><td> 0.215637733 </td></tr><tr><td> calpain 3 </td><td> AI323605 </td><td> 1433681_x_at </td><td></td><td> 0.160871988 </td><td> 1.07655E - 05 </td><td></td><td> 0.477164757 </td><td> 1.33753E - 11 </td></tr><tr><td> 아연 손가락, 5를 포함 CCHC 도메인 </td><td> BQ126004 </td><td> 1437355_at </td><td></td><td> 0.161812078 </td><td> 3.08262E - 06 </td><td></td><td> 0.421252632 </td><td> 0.01152969 </td></tr><tr><td> loricrin </td><td> NM_008508 </td><td> 1448745_s_at </td><td></td><td> 0.165129967 </td><td> 1.86362E - 05 </td><td></td><td> 0.639733409 </td><td> 0.000729772 </td></tr><tr><td> spondin 1 (F - spondin) 세포외 기질 단백질 </td><td> BC020531 </td><td> 1451342_at </td><td></td><td> 0.168035879 </td><td> 6.67867E - 07 </td><td></td><td> 0.821042412 </td><td> 0.023650765 </td></tr><tr><td> RIKEN cDNA 유전자 A930035E12 </td><td> AV348640 </td><td> 1429906_at </td><td></td><td> 5.9086795 </td><td> 1.747E - 07 </td><td></td><td> 1.470383201 </td><td> 0.104085454 </td></tr></tbody><tbody><tr><td> BB247294 RIKEN 전체 길이 풍부한 7 일 neonate 소뇌 뮤스 musculus cDNA 클론 A730018G18 3 &#39;mRNA 순서. </td><td> BB247294 </td><td> 1447907_x_at </td><td></td><td> 5.9047494 </td><td> 1.04931E - 05 </td><td></td><td> 1.968147585 </td><td> 0.00010636 </td></tr><tr><td> 잠겼어 도메인 3을 포함하는 </td><td> BB099015 </td><td> 1437075_at </td><td></td><td> 5.860216 </td><td> 0.000345581 </td><td></td><td> 2.780297178 </td><td> 1.83072E - 06 </td></tr><tr><td&gt;의 연결 pentraxin 2 / / / 가상의 단백질 LOC100044234 </td><td> NM_016789 </td><td> 1420720_at </td><td></td><td> 5.7568517 </td><td> 1.34227E - 06 </td><td></td><td> 2.652516957 </td><td> 0.000206279 </td></tr><tr><td> 베꼈는데 시퀀스 </td><td> BG076361 </td><td> 1460101_at </td><td></td><td> 5.657735 </td><td> 2.5015E - 06 </td><td></td><td> 1.296248831 </td><td> 0.22870031 </td></tr><tr><td> spondin 1 (F - spondin) 세포외 기질 단백질 </td><td> BC020531 </td><td> 1424415_s_at </td><td></td><td> 0.17783576 </td><td> 1.01658E - 06 </td><td></td><td> 0.836181248 </td><td> 0.001380141 </td></tr><tr><td> calbindin - 28K </td><td> BB246032 </td><td> 1448738_at </td><td></td><td> 0.180317904 </td><td> 1.35961E - 05 </td><td></td><td> 0.647334052 </td><td> 4.12268E - 09 </td></tr><tr><td> 1 MARCKS 같은 </td><td> AV110584 </td><td> 1437226_x_at </td><td></td><td> 0.186235935 </td><td> 1.47067E - 06 </td><td></td><td> 0.499291387 </td><td> 2.34984E - 08 </td></tr><tr><td> matrilin 2 </td><td> BB338441 </td><td> 1455978_a_at </td><td></td><td> 0.187783528 </td><td> 6.19122E - 05 </td><td></td><td> 0.8967688 </td><td> 0.282337853 </td></tr><tr><td> matrilin 2 </td><td> BC005429 </td><td> 1419442_at </td><td></td><td> 0.188195795 </td><td> 0.000105295 </td><td></td><td> 0.915528892 </td><td> 0.35282097 </td></tr><tr><td> spondin 1 (F - spondin) 세포외 기질 단백질 </td><td> BQ175871 </td><td> 1442613_at </td><td></td><td> 0.189956563 </td><td> 9.41195E - 06 </td><td></td><td> 0.861033222 </td><td> 0.1394266 </td></tr><tr><td> arrestin 3, 망막 </td><td> NM_133205 </td><td> 1450329_a_at </td><td></td><td> 5.2130346 </td><td> 2.90599E - 05 </td><td></td><td> 3.944218329 </td><td> 1.07437E - 07 </td></tr><tr><td> RIKEN cDNA 유전자 A330050F15 </td><td> AV325555 </td><td> 1457558_at </td><td></td><td> 0.19186781 </td><td> 0.000119342 </td><td></td><td> 0.660282035 </td><td> 2.47342E - 05 </td></tr><tr><td> contactin 3 </td><td> BB559510 </td><td> 1438628_x_at </td><td></td><td> 0.194404608 </td><td> 4.08641E - 07 </td><td></td><td> 0.918742591 </td><td> 0.022545297 </td></tr><tr><td> calbindin - 28K </td><td> BB246032 </td><td> 1417504_at </td><td></td><td> 0.196381321 </td><td> 2.24182E - 05 </td><td></td><td> 0.619305124 </td><td> 3.6222E - 06 </td></tr><tr><td> gastrin는 펩타이드를 방출 </td><td> BC024515 </td><td> 1424525_at </td><td></td><td> 4.9436426 </td><td> 3.00588E - 05 </td><td></td><td> 2.752845903 </td><td> 5.72954E - 07 </td></tr><tr><td> 수용체 3 포함 sortilin 관련 VPS10 도메인 </td><td> AK018111 </td><td> 1425111_at </td><td></td><td> 4.885766 </td><td> 1.03645E - 05 </td><td></td><td> 1.29051599 </td><td> 0.029733649 </td></tr><tr><td> 도파민 수용체 D1A </td><td> BE957273 </td><td> 1455629_at </td><td></td><td> 4.869493 </td><td> 3.77525E - 05 </td><td></td><td> 1.815881979 </td><td> 0.000516498 </td></tr><tr><td> proprotein convertase subtilisin / kexin 타입 5 </td><td> BB241731 </td><td> 1437339_s_at </td><td></td><td> 0.210528027 </td><td> 7.83039E - 05 </td><td></td><td> 0.574126078 </td><td> 9.15496E - 05 </td></tr></tbody><tbody><tr><td> 인터루킨 1 수용체, 나는을 입력 </td><td> NM_008362 </td><td> 1448950_at </td><td></td><td> 0.210572243 </td><td> 9.64524E - 06 </td><td></td><td> 0.241135352 </td><td> 2.79816E - 08 </td></tr></tbody></table>

dissection of hippocampal dentate gyrus from adult mouse

해마 때문에 메모리 처리와 학습의 중요한 기능 역할, 빼어난의 연결을 세포 소성, 그리고 간질에서의 참여, neurodegenerative 질병 및 정신 장애의 두뇌에서 가장 널리 연구 분야 중 하나입니다. 해마는 별개의 영역으로 구성되며 주로 과립 뉴런, 주로 피라미드 뉴런으로 구성되어 암몬의 경적, 그리고 두 영역으로 구성되어 이가있는 이랑이, 해부학 및 기능 회로 모두에 의해 연결되어 있습니다. 여러 mRNAs와 단백질이 선택적으로 이가있는 이랑에 표현하고, 이가있는 이랑 성인 neurogenesis의 사이트입니다되며 즉, 새로운 뉴런이 지속적으로 성인 이가있는 이랑에 생성됩니다. 이가있는 이랑에 특정 mRNA와 단백질 표현을 조사하기 위해, 레이저 캡처 microdissection가 자주 사용됩니다. 이 방법은 특별한 apparatuses 복잡한 처리 절차가 필요로하지만, 몇 가지 제약 사항들이있다. 이 비디오 녹화 프로토콜에서는, 우리는 stereomicroscope 미만 성인 마우스에서 이가있는 이랑을 제거하는 절개 기법을 보여줍니다. 이 기술을 사용하여 준비 이가있는 이랑 샘플 transcriptomic, proteomic, 그리고 세포 생물학 분석 포함한 모든 분석에 대한 적합합니다. 우리는 해부 조직은 실시간 이가있는 이랑 특정 유전자의 PCR, 트립토판 2,3 - dioxygenase (TDO2)와 desmoplakin (DSP), 그리고 암몬의 경적 농축 유전자, Meis 관련 유전자 1B (Mrg1b을 실시하여 이가있는 이랑 확인 )와 TYRO3 단백질 티로신 키나제의 3 (Tyro3). Mrg1b과 Tyro3은 암몬의 호른 샘플에서보다 낮은 수준되었다 반면 이가있는 이랑 샘플에 TDO2 및 DSP의 mRNA 표현은 분명히 더 높은 수준에서 발견되었습니다. 이 방법의 장점을 설명하기 위해, 우리는 전체 해마와 이가있는 이랑의 샘플을 사용하여 DNA microarray 분석을 수행했습니다. 알파 - CaMKII + /의 전체 해마에 이가있는 이랑에 선택적으로 표현 TDO2 및 DSP의 mRNA 표현 - 마우스는 각각 0.037과 야생 형 생쥐의에 비해 0.10 배 변화를 전시. 격리 이가있는 이랑 그러나, 이러한 표현보다 감성과 감지가 가능하다 이가있는 이랑에 유전자 발현의 변화를 보여주는 0.011과 야생 형 생쥐의에 비해 0.021 배 변화를 전시. 함께 촬영이 편리하고 정확한 해부 기술은 안정적으로 이가있는 이랑에 초점을 맞춘 연구에 사용될 수 있습니다.

Watch this Scientific Journal Video about Dissection of Hippocampal Dentate Gyrus from Adult Mouse at JoVE.com

Dissection of Hippocampal Dentate Gyrus from Adult Mouse

stereomicroscope 이하 성인 마우스에서 이가있는 이랑의 제거를위한 해부 기술이 비디오 녹화 프로토콜에서 시연되었다.

성인 마우스 Hippocampal 이가있는 이랑의 해부

The hippocampus is one of the most widely studied areas in the brain because of its important functional role in memory processing and learning, its ...

dissection-of-hippocampal-dentate-gyrus-from-adult-mouse

Research

JoVE Journal

Biology

82.2K 조회수.  Japan Science and Technology Agency, Core Research for Evolutionary Science and Technology (CREST). stereomicroscope 이하 성인 마우스에서 이가있는 이랑의 제거를위한 해부 기술이 비디오 녹화 프로토콜에서 시연되었다.

비디오: Dissection of Hippocampal Dentate Gyrus from Adult Mouse

Dissection of 6.5 dpc Mouse Embryos

Analysis of gene expression patterns during early stages of mammalian embryonic development can provide important clues about gene function, cell-cell interaction and signaling mechanisms that guide embryonic patterning. However, dissection of the mouse embryo from the decidua shortly after implantation can be a challenging procedure, and detailed step-by-step documentation of this process is lacking.

Here we demonstrate how post-implantation (6.5 dpc) embryos are isolated by first dissecting the uterus of a pregnant mouse (detection of the vaginal plug was designated day 0.5 poist coitum) and subsequently dissecting the embryo from maternal decidua. The dissection of Reichert's membrane is described as well as the removal of the ectoplacental cone.

Isolation of postimplantation-stage embryos allows one to study gene patterning and analyze cell-lineage decision making processes during embryonic development, but proper dissection of the early embryo can be challenging. This protocol describes a method for isolating early primitive-streak-stage embryos (~6.5 days post coitum [dpc]).

6.5 DPC 마우스 태아의 해부

Analysis of gene expression patterns during early stages of mammalian embryonic development can provide important clues about gene function, cell-cell ...

연구

생물학

Dissection of Organs from the Adult Zebrafish

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental analysis of the embryo and larva is extensive and the morphology has been well documented, descriptions of adult zebrafish anatomy and studies of development of the adult structures and organs, together with techniques for working with adults are lacking. The organs of the larva undergo significant changes in their overall structure, morphology, and anatomical location during the larval to adult transition.  Externally, the transparent larva develops its characteristic adult striped pigment pattern and paired pelvic fins, while internally, the organs undergo massive growth and remodeling.  In addition, the bipotential gonad primordium develops into either testis or ovary.  This protocol identifies many of the organs of the adult and demonstrates methods for dissection of the brain, gonads, gastrointestinal system, heart, and kidney of the adult zebrafish. The dissected organs can be used for in situ hybridization, immunohistochemistry, histology, RNA extraction, protein analysis, and other molecular techniques.  This protocol will assist in the broadening of studies in the zebrafish to include the remodeling of larval organs, the morphogenesis of organs specific to the adult and other investigations of the adult organ systems.

This protocol describes a procedure for identifying and dissecting organs from the adult zebrafish.

성인 Zebrafish에서 기관의 해부

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental ...

Dissection of Oenocytes from Adult Drosophila melanogaster

In Drosophila melanogaster, as in other insects, a waxy layer on the outer surface of the cuticle, composed primarily of hydrocarbon compounds, provides protection against desiccation and other environmental challenges. Several of these cuticular hydrocarbon (CHC) compounds also function as semiochemical signals, and as such mediate pheromonal communications between members of the same species, or in some instances between different species, and influence behavior. Specialized cells referred to as oenocytes are regarded as the primary site for CHC synthesis. However, relatively little is known regarding the involvement of the oenocytes in the regulation of the biosynthetic, transport, and deposition pathways contributing to CHC output. Given the significant role that CHCs play in several aspects of insect biology, including chemical communication, desiccation resistance, and immunity, it is important to gain a greater understanding of the molecular and genetic regulation of CHC production within these specialized cells. The adult oenocytes of D. melanogaster are located within the abdominal integument, and are metamerically arrayed in ribbon-like clusters radiating along the inner cuticular surface of each abdominal segment. In this video article we demonstrate a dissection technique used for the preparation of oenocytes from adult D. melanogaster. Specifically, we provide a detailed step-by-step demonstration of (1) how to fillet prepare an adult Drosophila abdomen, (2) how to identify the oenocytes and discern them from other tissues, and (3) how to remove intact oenocyte clusters from the abdominal integument. A brief experimental illustration of how this preparation can be used to examine the expression of genes involved in hydrocarbon synthesis is included. The dissected preparation demonstrated herein will allow for the detailed molecular and genetic analysis of oenocyte function in the adult fruit fly.

Dissection of Oenocytes from Adult Drosophila melanogaster

In insects, the oenocytes produce cuticular hydrocarbon compounds. These compounds protect against desiccation and facilitate chemical communication. Here we demonstrate a dissection technique used to isolate the oenocytes from adult Drosophila melanogaster, and illustrate how this preparation can be utilized to study genes involved in hydrocarbon synthesis.

성인에서 Oenocytes의 해부 Drosophila melanogaster</em

In Drosophila melanogaster, as in other insects, a waxy layer on the outer surface of the cuticle, composed primarily of hydrocarbon compounds, provides ...

Dissection of the Adult Zebrafish Kidney

Researchers working in the burgeoning field of adult stem cell biology seek to understand the signals that regulate the behavior and function of stem cells during normal homeostasis and disease states. The understanding of adult stem cells has broad reaching implications for the future of regenerative medicine1. For example, better knowledge about adult stem cell biology can facilitate the design of therapeutic strategies in which organs are triggered to heal themselves or even the creation of methods for growing organs in vitro that can be transplanted into humans1. The zebrafish has become a powerful animal model for the study of vertebrate cell biology2. There has been extensive documentation and analysis of embryonic development in the zebrafish3. Only recently have scientists sought to document adult anatomy and surgical dissection techniques4, as there has been a progressive movement within the zebrafish community to broaden the applications of this research organism to adult studies. For example, there are expanding interests in using zebrafish to investigate the biology of adult stem cell populations and make sophisticated adult models of diseases such as cancer5. Historically, isolation of the zebrafish adult kidney has been instrumental for studying hematopoiesis, as the kidney is the anatomical location of blood cell production in fish6,7. The kidney is composed of nephron functional units found in arborized arrangements, surrounded by hematopoietic tissue that is dispersed throughout the intervening spaces. The hematopoietic component consists of hematopoietic stem cells (HSCs) and their progeny that inhabit the kidney until they terminally differentiate8. In addition, it is now appreciated that a group of renal stem/progenitor cells (RPCs) also inhabit the zebrafish kidney organ and enable both kidney regeneration and growth, as observed in other fish species9-11. In light of this new discovery, the zebrafish kidney is one organ that houses the location of two exciting opportunities for adult stem cell biology studies. It is clear that many outstanding questions could be well served with this experimental system. To encourage expansion of this field, it is beneficial to document detailed methods of visualizing and then isolating the adult zebrafish kidney organ. This protocol details our procedure for dissection of the adult kidney from both unfixed and fixed animals.
Dissection of the kidney organ can be used to isolate and characterize hematopoietic and renal stem cells and their offspring using established techniques such as histology, fluorescence activated cell sorting (FACS)11,12, expression profiling13,14, and transplantation11,15. 
We hope that dissemination of this protocol will provide researchers with the knowledge to implement broader use of zebrafish studies that ultimately can be translated for human application.

The zebrafish kidney is home to both renal and hematopoietic adult stem/progenitor cells, and represents an outstanding opportunity to study these cell types and their progeny in a vertebrate model organism. Here, we demonstrate a detailed dissection procedure that enables the researcher to identify and surgically remove the adult zebrafish kidney, which can be used for applications such as cell isolation, transplantation, and expression studies of kidney and/or blood cell populations.

성인 Zebrafish의 신장의 해부

Researchers working in the burgeoning field of adult stem cell biology seek to understand the signals that regulate the behavior and function of stem ...

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work examining post-embryonic through adult cardiac development has been limited7-10. Examining the changing morphology of the maturing and aging heart are restricted by the lack of techniques available for staging and isolating juvenile and adult hearts. In order to analyze heart development over the fish's lifespan, we dissect zebrafish hearts at numerous stages and photograph them for further analysis11. The morphological features of the heart can easily be quantified and individual hearts can be further analyzed by a host of standard methods. Zebrafish grow at variable rates and maturation correlates better with fish size than age, thus, post-fixation, we photograph and measure fish length as a gauge of fish maturation. This protocol explains two distinct, size dependent dissection techniques for zebrafish, ranging from larvae 3.5mm standard length (SL) with hearts of 100&mu;m ventricle length (VL), to adults, with SL of 30mm and VL 1mm or larger. Larval and adult fish have quite distinct body and organ morphology. Larvae are not only significantly smaller, they have less pigment and each organ is visually very difficult to identify. For this reason, we use distinct dissection techniques.
We used pre-dissection fixation procedures, as we discovered that hearts dissected directly after euthanization have a more variable morphology, with very loose and balloon like atria compared with hearts removed following fixation. The fish fixed prior to dissection, retain in vivo morphology and chamber position (data not shown). In addition, for demonstration purposes, we take advantage of the heart (myocardial) specific GFP transgenic Tg(myl7:GFP)twu34 (12), which allows us to visualize the entire heart and is particularly useful at early stages in development when the cardiac morphology is less distinct from surrounding tissues. Dissection of the heart makes further analysis of the cell and molecular biology underlying heart development and maturation using in situ hybridization, immunohistochemistry, RNA extraction or other analytical methods easier in post-embryonic zebrafish. This protocol will provide a valuable technique for the study of cardiac development maturation and aging.

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

A clear, standardized method for dissection and isolation of the zebrafish heart at multiple developmental stages are described. Annotation and quantification techniques are also discussed.

애벌레의 심장 해부, 소년과 성인 Zebrafish, Danio rerio</em

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

유도 만능의 줄기 세포에서 파생 마우스의 생성

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Isolation and Culture of Primary Mouse Keratinocytes from Neonatal and Adult Mouse Skin

The keratinocyte (KC) is the predominant cell type in the epidermis, the outermost layer of the skin. Epidermal KCs play a critical role in providing skin defense by forming an intact skin barrier against environmental insults, such as UVB irradiation or pathogens, and also by initiating an inflammatory response upon those insults. Here we describe methods to isolate KCs from neonatal mouse skin and from adult mouse tail skin. We also describe culturing conditions using defined growth supplements (dGS) in comparison to chelexed fetal bovine serum (cFBS). Functionally, we show that both neonatal and adult KCs are highly responsive to high calcium-induced terminal differentiation, tight junction formation and stratification. Additionally, cultured adult KCs are susceptible to UVB-triggered cell death and can release large amounts of TNF upon UVB irradiation. Together, the methods described here will be useful to researchers for the setup of in vitro models to study epidermal biology in the neonatal mouse and/or the adult mouse.

Epidermal keratinocytes form a functional skin barrier and are positioned at the front line of host defense against external environmental insults. Here we describe methods for isolation and primary culture of epidermal keratinocytes from neonatal and adult mouse skin, and induction of terminal differentiation and UVB-triggered inflammatory response from keratinocytes.

신생아 및 성인 마우스 피부의 1 차 마우스 각질 세포의 분리 및 배양

The keratinocyte (KC) is the predominant cell type in the epidermis, the outermost layer of the skin. Epidermal KCs play a critical role in providing skin ...

Isolation, Characterization, and Differentiation of Cardiac Stem Cells from the Adult Mouse Heart

Myocardial infarction (MI) is a leading cause of morbidity and mortality around the world. A major goal of regenerative medicine is to replenish the dead myocardium after MI. Although several strategies have been used to regenerate myocardium, stem cell therapy remains a major approach to replenish the dead myocardium of an MI heart. Accumulating evidence suggests the presence of resident cardiac stem cells (CSCs) in the adult heart and their endocrine and/or paracrine effects on cardiac regeneration. However, CSC isolation and their characterization and differentiation toward myocardial cells, especially cardiomyocytes, remains a technical challenge. In the present study, we provided a simple method for the isolation, characterization, and differentiation of CSCs from the adult mouse heart. Here, we describe a density gradient method for the isolation of CSCs, where the heart is digested by a 0.2% collagenase II solution. To characterize the isolated CSCs, we evaluated the expression of CSCs/cardiac markers Sca-1, NKX2-5, and GATA4, and pluripotency/stemness markers OCT4, SOX2, and Nanog. We also determined the proliferation potential of isolated CSCs by culturing them in a Petri dish and assessing the expression of the proliferation marker Ki-67. For evaluating the differentiation potential of CSCs, we selected seven- to ten-days cultured CSCs. We transferred them to a new plate with a cardiomyocyte differentiation medium. They are incubated in a cell culture incubator for 12 days, while the differentiation medium is changed every three days. The differentiated CSCs express cardiomyocyte-specific markers: actinin and troponin I. Thus, CSCs isolated with this protocol have stemness and cardiac markers, and they have a potential for proliferation and differentiation toward cardiomyocyte lineage.

The overall goal of this article is to standardize the protocol for the isolation, characterization, and differentiation of cardiac stem cells (CSCs) from the adult mouse heart. Here, we describe a density gradient centrifugation method to isolate murine CSCs and elaborated methods for CSC culture, proliferation, and differentiation into cardiomyocytes.

절연, 특성, 및 성인 마우스 심장에서 심장 줄기 세포의 분화

Myocardial infarction (MI) is a leading cause of morbidity and mortality around the world. A major goal of regenerative medicine is to replenish the dead ...

Isolation and Culture of Primary Oral Keratinocytes from the Adult Mouse Palate

For years, most studies involving keratinocytes have been conducted using human and mouse skin epidermal keratinocytes. Recently, oral keratinocytes have attracted attention because of their unique function and characteristics. They maintain the homeostasis of the oral epithelium and serve as resources for applications in regenerative therapies. However, in vitro studies that use oral primary keratinocytes from adult mice have been limited due to the lack of an efficient and well-established culture protocol. Here, oral primary keratinocytes were isolated from the palate tissues of adult mice and cultured in a commercial low-calcium medium supplemented with a chelexed-serum. Under these conditions, keratinocytes were maintained in a proliferative or stem cell-like state, and their differentiation was inhibited even after increased passages. Marker expression analysis showed that the cultured oral keratinocytes expressed the basal cell markers p63, K14, and &#945;6-integrin and were negative for the differentiation marker K13 and the fibroblast marker PDGFR&#945;. This method produced viable and culturable cells suitable for downstream applications in the study of oral epithelial stem cell functions in vitro.

The present protocol describes the isolation and culture of oral keratinocytes derived from the adult mouse palate. An evaluation method using immunostaining is also reported.

성인 마우스 입천장에서 1 차 구강 각막 세포의 격리 및 문화

For years, most studies involving keratinocytes have been conducted using human and mouse skin epidermal keratinocytes. Recently, oral keratinocytes have ...

Nuclei Isolation from Adult Mouse Kidney for Single-Nucleus RNA-Sequencing

The kidneys regulate diverse biological processes such as water, electrolyte, and acid-base homeostasis. Physiological functions of the kidney are executed by multiple cell types arranged in a complex architecture across the corticomedullary axis of the organ. Recent advances in single-cell transcriptomics have accelerated the understanding of cell type-specific gene expression in renal physiology and disease. However, enzyme-based tissue dissociation protocols, which are frequently utilized for single-cell RNA-sequencing (scRNA-seq), require mostly fresh (non-archived) tissue, introduce transcriptional stress responses, and favor the selection of abundant cell types of the kidney cortex resulting in an underrepresentation of cells of the medulla.
Here, we present a protocol that avoids these problems. The protocol is based on nuclei isolation at 4 &#176;C from frozen kidney tissue. Nuclei are isolated from a central piece of the mouse kidney comprised of the cortex, outer medulla, and inner medulla. This reduces the overrepresentation of cortical cells typical for whole-kidney samples for the benefit of medullary cells such that data will represent the entire corticomedullary axis at sufficient abundance. The protocol is simple, rapid, and adaptable and provides a step towards the standardization of single-nuclei transcriptomics in kidney research.

Here, we present a protocol to isolate high-quality nuclei from frozen mouse kidneys that improve the representation of medullary kidney cell types and avoids the gene expression artifacts from enzymatic tissue dissociation.