Agradecemos al Dr. Yoko Nabeshima en la Universidad de Kyoto para su instrucción en la técnica de disección y la Sra. Aki Miyakawa en Fujita de la Salud de la Universidad por su apoyo a la película. Este trabajo fue apoyado por el Programa de Promoción de Estudios Fundamentales en Ciencias de la Salud del Instituto Nacional de la innovación biomédica, una subvención-en-Ayudas a la Investigación Científica en las áreas prioritarias-Integrativa Investigación Cerebral (Shien) - de MEXT en Japón, y por un subsidio en ayuda de la cresta de la Agencia Japonesa de Ciencia y Tecnología.

La disección del giro dentado del hipocampo <ol><li> En un ratón profundamente anestesiados, cuidadosamente diseccionar el cerebro fuera del cráneo y lo coloca en helado de buffer fosfato salino (PBS). </li><li> En una placa de Petri que contiene helado de PBS, cortar el cerebro a lo largo de la fisura longitudinal del cerebro utilizando un bisturí, y le cortó las regiones posteriores a la lambda (mesencéfalo, rombencéfalo, y el cerebelo). </li><li> Coloque el lado medial del hemisferio cerebral y, con las pinzas, retire con cuidado el diencéfalo (tálamo e hipotálamo) bajo un microscopio de disección. Esto expondrá el lado medial del hipocampo, lo que permite la visualización de la circunvolución dentada. El giro dentado se distingue de asta de Ammon por los espacios entre ellos. La lesión del hipocampo o alrededores hará que sea más difícil aislar el giro dentado. </li><li> Inserte un fuerte de punta de aguja (por ejemplo, de calibre 27 agujas) en cada lado de la circunvolución dentada (límites de la circunvolución dentada y asta de Ammon; Figura 1) y deslice las agujas superficialmente en el eje septo-temporal del hipocampo para aislar el giro dentado. </li><li> Recoger el giro dentado aisladas con una aguja o con pinzas y colocarlo en un tubo de muestra. La muestra así obtenida dentado tejido giro se puede utilizar de inmediato para cualquier ensayo o almacenada en un congelador para su uso posterior. </li><li> Aislar el giro dentado del otro hemisferio cerebral con el mismo método. </li></ol> Cuantitativas PCR en tiempo real El giro dentado se aisló utilizando el método antes mencionado y el hipocampo restantes se disecó a cabo como muestra el cuerno de Ammon de ratones de tipo salvaje. PCR en tiempo real de la beta-actina, TDO2, DSP, Mrg1b y Tyro3 se realizaron con el giro dentado y las muestras de Ammon cuerno como se describió anteriormente 1. 5&#39;-5 &#39;y CTGGCGAGATCACGATGACG AAGCTACGCTGTTGTCTAACC-fueron utilizados para Mrg1b y GCCTCCAAATTGCCCGTCA y 5&#39;-CCAGCACTGGTACATGAGATCA para Tyro3. El análisis de microarrays Experimentos de microarrays se realizaron con hombres ratones de tipo salvaje y ratones heterocigotos para la isoforma alfa de calcio / calmodulina dependiente de la proteína quinasa II (CaMKII-alfa + / - ratones) como se describió anteriormente 1. En pocas palabras, el ARN aislado de la totalidad o hipocampo circunvolución dentada de los ratones de tipo salvaje y mutante se hibridó con una matriz del genoma del ratón 430 2.0 (Affymetrix, Santa Clara, CA), y cada GeneChip fue escaneada por un escáner Affymetrix GeneChip 3000 (GCS3000) . GeneChip análisis se realizó con el análisis de microarrays Suite versión 5.0.

<ol>
	<li>Yamasaki, N., Maekawa, M., Kobayashi, K., Kajii, Y., Maeda, J., Soma, M., Takao, K., Tanda, K., Ohira, K., Toyama, K., Kanzaki, K., Fukunaga, K., Sudo, Y., Ichinose, H., Ikeda, M., Iwata, N., Ozaki, N., Suzuki, H., Higuchi, M., Suhara, T., Yuasa, S., Miyakawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alpha-CaMKII+deficiency+causes+immature+dentate+gyrus,+a+novel+candidate+endophenotype+of+psychiatric+disorders.">Alpha-CaMKII deficiency causes immature dentate gyrus, a novel candidate endophenotype of psychiatric disorders.</a> Mol. Brain. 1, 6-6 (2008).</li><li>Insausti, A. M., Megias, M., Crespo, D., Cruz-Orive, L. M., Dierssen, M., Vallina, I. F., Insausti, R., Florez, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hippocampal+volume+and+neuronal+number+in+Ts65Dn+mice:+a+murine+model+of+Down+syndrome.">Hippocampal volume and neuronal number in Ts65Dn mice: a murine model of Down syndrome.</a> Neurosci. Lett. 253, 175-175 (1998).</li><li>Redwine, J. M., Kosofsky, B., Jacobs, R. E., Games, D., Reilly, J. F., Morrison, J. H., Young, W. G., Bloom, F. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dentate+gyrus+volume+is+reduced+before+onset+of+plaque+formation+in+PDAPP+mice:+a+magnetic+resonance+microscopy+and+stereologic+analysis.">Dentate gyrus volume is reduced before onset of plaque formation in PDAPP mice: a magnetic resonance microscopy and stereologic analysis.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 1381-1381 (2003).</li><li>Lein, E. S., Zhao, X., Gage, F. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+a+molecular+atlas+of+the+hippocampus+using+DNA+microarrays+and+high-throughput+in+situ+hybridization.">Defining a molecular atlas of the hippocampus using DNA microarrays and high-throughput in situ hybridization.</a> J. Neurosci. 24, 3879-3879 (2004).</li><li>Matsuo, N., Yamasaki, N., Ohira, K., Takao, K., Toyama, K., Eguchi, M., Yamaguchi, S., Miyakawa, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neural+activity+changes+underlying+the+working+memory+deficit+in+alpha-CaMKII+heterozygous+knockout+mice.">Neural activity changes underlying the working memory deficit in alpha-CaMKII heterozygous knockout mice.</a> Front. Behav. Neurosci. 3, 20-20 (2009).</li><li>Franklin, K. B. J., Paxinos, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The Mouse Brain in Stereotaxic Coordinates. , (1997).</li></ol>

Los experimentos con animales se realizaron de acuerdo con el Instituto Nacional de la Guía de Salud para el Cuidado y Uso de Animales de Laboratorio, y aprobado por el cuidado de los animales y el uso comisión de Salud de la Universidad Fujita.

El giro dentado ocupa aproximadamente el 25% al 30% del volumen de la formación del hipocampo 2,3. Tiene una composición única célula y juega un papel crucial en funciones cerebrales diferentes. Por lo tanto, las técnicas para aislar el giro dentado son útiles para analizar los acontecimientos que se producen específicamente en esta región. En este caso, hemos demostrado un procedimiento para analizar de manera eficiente el giro dentado del hipocampo de ratones adultos y confirmó la precisión de la técnica. En primer lugar, el estudio histológico reveló que el giro dentado se separaron sin la contaminación de otras regiones (Figura 1), lo que indica que una muestra pura giro dentado se pueden preparar. En segundo lugar, confirmó que el tejido disecado es el giro dentado mediante la realización de PCR en tiempo real de dentado específico giro-genes, TDO2 y DSP, y los genes de Ammon cuerno enriquecido, Mrg1b y Tyro3 4 (Figura 2). Las expresiones de ARNm de TDO2 (p = 0,000023; n es = 4 y 4, respectivamente) y DSP (p = 0,0000030; n es = 4 y 4, respectivamente) en las muestras de giro dentado se detectaron en los niveles, obviamente, mayor, mientras que Mrg1b (p = 0.000080; n es = 4 y 4, respectivamente) y Tyro3 (p = 0,00017; = 4 y 4, respectivamente) n fueron los niveles más bajos, que en las muestras de cuerno de Ammon. Beta-actina niveles de expresión no fue diferente en estas muestras (p = 0,11, n = 4 y de 4, respectivamente). Por lo tanto, podríamos comprobar si el giro dentado se disecó con precisión a cabo mediante la realización de tan simples en tiempo real los experimentos de PCR. En tercer lugar, para evaluar la utilidad de este método de disección, se comparó el nivel de expresión del ARNm del hipocampo conjunto con la del giro dentado. Hipocampo conjunto y el giro dentado obtenida de tipo salvaje (= 9 y 4, N, respectivamente) y la alfa-CaMKII + / - ratones (n = de 18 y 4, respectivamente) fueron procesados ​​para análisis de microarrays, y para todos los genes anotados, el doble cambio se calcula dividiendo el valor de mutantes por el valor de tipo salvaje. Los resultados indicaron que los cambios en la expresión del ARNm, en especial de giro dentado específico de moléculas como el DSP y TDO2, se detectaron con un aumento de hasta 5 veces en la sensibilidad en las muestras de giro dentado en comparación con el conjunto de muestras del hipocampo (Tabla 1). Hemos demostrado que la alfa-CaMKII + / - ratones exhiben comportamientos humanos relacionados con trastornos psiquiátricos, tales como déficit de memoria de trabajo y un ritmo exagerado infradianos 1,5. Además, las características morfológicas y electrofisiológicas de las neuronas en el giro dentado ratones mutantes son sorprendentemente similares a los de las neuronas inmaduras giro dentado en los roedores normales, lo que indica que las neuronas en estos ratones mutantes no se desarrollan hasta la madurez 1. La expresión inmadura dentado giro y regulan a la baja de DSP y TDO2 mRNA en alpha-CaMKII + / - ratones son consistentes con la conclusión de que Dsp y TDO2 pueden ser utilizados como marcadores de células granulares maduras en el giro dentado (Ohira et al, inédito. de datos). En conjunto, esta técnica de disección cómodo y preciso puede ser confiable para estudios se centraron en el giro dentado. Tejido giro dentado obtenidos mediante este método es aplicable a otros tipos de análisis, así, como los análisis de biología celular y la proteómica. <img src="/files/ftp_upload/1543/1543fig1.jpg" alt="la figura 1" /> Figura 1. Verificación de la circunvolución dentada aislados por el estudio histológico. Una sección coronal del cerebro después de aislar giro dentado se procesó para la tinción de Nissl (izquierda), y un esquema adaptado del cerebro de ratón atlas6 representa aproximadamente el mismo nivel de la sección se muestra en el panel de la izquierda (panel derecho). Las flechas indican la dirección de la inserción de la aguja de punta. Barra de escala, de 1 mm. <img src="/files/ftp_upload/1543/1543fig2.jpg" alt="la figura 2" /> Figura 2. Verificación de la circunvolución dentada aislado por PCR en tiempo real. La circunvolución dentada y el cuerno de Ammon s obtenidos a partir de cuatro ratones de tipo salvaje fueron procesados ​​por PCR en tiempo real de la beta-actina, TDO2, DSP, Mrg1b y Tyro3. Los resultados se presentan como media ± SEM. Para el análisis estadístico, t de Student s fue empleado, y los valores de p seguir son: beta-actina, p = 0,11; TDO2, p = 0.000023 (** 1), DSP, p = 0.0000030 (** 2); Mrg1b, p = 0.000080 (** 3), y Tyro3, ​​p = 0,00017 (** 4). Tabla 1. . Análisis de microarrays de todo el hipocampo y el giro dentado genes expresados ​​diferencialmente en el giro dentado del hipocampo y el conjunto de la alfa-CaMKII + / - ratones se determinó mediante el cálculo de las veces el cambio de la detectada en ratones de tipo salvaje. Los datos fueron analizados para la significación estadística mediante la prueba t de Student s entre la naturaleza y tipo alpha-CaMKII + / - ratones. Entre los genes cuya expresión exhibida p &lt;0,05 enla circunvolución dentada de alpha-CaMKII + / - ratones en comparación con la de ratones de tipo salvaje, los 50 genes se enumeran. Tenga en cuenta que el número de muestras para el giro dentado son mucho menores que las de todo el hipocampo. AffyID, Affymetrix sonda identificador; CKII, alpha-CaMKII + / - ratones, WT, ratones de tipo salvaje. <table border="1"><tbody><tr><td></td><td></td><td></td><td></td><td colspan="2"> Dentado giro (p &lt;0,05) PESO: n = 4, CKII + / -: n = 4 </td><td></td><td colspan="2"> Hipocampo todo PESO: n = 9, CKII + / -: n = 18 </td></tr><tr><td> Gene Título </td><td> Bancos de germoplasma </td><td> AffyID </td><td></td><td> Veces el cambio </td><td> valor de p </td><td></td><td> Veces el cambio </td><td> valor de p </td></tr><tr><td> desmoplaquina </td><td> AV297961 </td><td> 1435494_s_at </td><td></td><td> 0,011018913 </td><td> 7.02694E-06 </td><td></td><td> 0,037021003 </td><td> 1.86126E-13 </td></tr><tr><td> desmoplaquina </td><td> AV297961 </td><td> 1435493_at </td><td></td><td> 0,014369734 </td><td> 7.86747E-06 </td><td></td><td> 0.04232106 </td><td> 1.00579E-12 </td></tr><tr><td> triptófano 2,3-dioxigenasa </td><td> AI098840 </td><td> 1419093_at </td><td></td><td> 0,020986484 </td><td> 5.23546E-09 </td><td></td><td> 0,101037776 </td><td> 4.14823E-13 </td></tr><tr><td> nephronectin </td><td> AA223007 </td><td> 1452106_at </td><td></td><td> 0,075479901 </td><td> 1.05191E-08 </td><td></td><td> 0,234001154 </td><td> 1.66301E-15 </td></tr><tr><td> nephronectin </td><td> AA223007 </td><td> 1452107_s_at </td><td></td><td> 0,079457767 </td><td> 1.40433E-07 </td><td></td><td> 0,177974715 </td><td> 3.9758E-12 </td></tr><tr><td> liberadora de tirotropina receptor de la hormona </td><td> M59811 </td><td> 1449571_at </td><td></td><td> 0,103105815 </td><td> 0,003093796 </td><td></td><td> 0,801412732 </td><td> 0,283994361 </td></tr><tr><td> rianodina un receptor, el músculo esquelético </td><td> X83932 </td><td> 1427306_at </td><td></td><td> 0,104825517 </td><td> 3.38513E-07 </td><td></td><td> 0,650685017 </td><td> 0,000308462 </td></tr><tr><td> hélice hélice nescient lazo 1 </td><td> NM_010916 </td><td> 1419533_at </td><td></td><td> 9.431896 </td><td> 6.7979E-06 </td><td></td><td> 4,078815314 </td><td> 5.27E-11 </td></tr><tr><td> copine miembro de la familia IX </td><td> BB274531 </td><td> 1454653_at </td><td></td><td> 9.159157 </td><td> 7.99492E-06 </td><td></td><td> 1,797304153 </td><td> 0,000296375 </td></tr><tr><td> doublecortin-quinasa 3 </td><td> BB326709 </td><td> 1436532_at </td><td></td><td> 0,109336662 </td><td> 1.95278E-07 </td><td></td><td> 0.56697229 </td><td> 2.62633E-08 </td></tr><tr><td> calpaína 3 </td><td> AF127766 </td><td> 1426043_a_at </td><td></td><td> 0,111269769 </td><td> 8.07053E-06 </td><td></td><td> 0,370956608 </td><td> 2.04421E-14 </td></tr><tr><td> Estriado adulto de sexo masculino corpus cDNA, RIKEN de larga duración enriquecido la biblioteca, el clon: C030023B07 producto: secuencia inclasificable, inserte completa </td><td> BB357628 </td><td> 1460043_at </td><td></td><td> 0,118712341 </td><td> 6.16926E-07 </td><td></td><td> 0,682339204 </td><td> 2.33001E-06 </td></tr><tr><td> colágeno y calcio dominios EGF de unión 1 </td><td> AV264768 </td><td> 1437385_at </td><td></td><td> 0,124043978 </td><td> 3.65669E-05 </td><td></td><td> 0,488394112 </td><td> 4.05538E-06 </td></tr><tr><td> beta-amiloide (A4) precursor de la proteína de unión, de la familia A, miembro 2 de unión a proteínas </td><td> AK013520 </td><td> 1431946_a_at </td><td></td><td> 7.7986307 </td><td> 1.2098E-06 </td><td></td><td> 2,099164713 </td><td> 1.67047E-06 </td></tr><tr><td> calbindina-28K </td><td> BB177770 </td><td> 1456934_at </td><td></td><td> 0,130255444 </td><td> 3.32186E-06 </td><td></td><td> 0,572605751 </td><td> 1.99157E-10 </td></tr><tr><td> Lugar transcribe </td><td> AV328597 </td><td> 1443322_at </td><td></td><td> 0,133290835 </td><td> 5.43583E-06 </td><td></td><td> 0,562767164 </td><td> 7.56544E-06 </td></tr><tr><td> neuropéptido Y receptor Y2 </td><td> NM_008731 </td><td> 1417489_at </td><td></td><td> 0,135319609 </td><td> 0,000113407 </td><td></td><td> 0,781498474 </td><td> 0.00394504 </td></tr><tr><td> ras de proteínas de unión un elemento de respuesta </td><td> BE197381 </td><td> 1428657_at </td><td></td><td> 0,138235114 </td><td> 7.93691E-07 </td><td></td><td> 0,651220705 </td><td> 2.94209E-05 </td></tr><tr><td> línea de células gliales derivadas del receptor neurotrófico familia del factor alfa 2 </td><td> BB284482 </td><td> 1433716_x_at </td><td></td><td> 0,139062563 </td><td> 2.35371E-06 </td><td></td><td> 0.669544709 </td><td> 0,000214146 </td></tr><tr><td> preproencefalina 1 </td><td> M13227 </td><td> 1427038_at </td><td></td><td> 6.9850435 </td><td> 2.39074E-08 </td><td></td><td> 1,766018828 </td><td> 0,000250501 </td></tr><tr><td> RIKEN 1810010H24 gen de ADNc </td><td> BI729991 </td><td> 1428809_at </td><td></td><td> 6.8658915 </td><td> 1.88516E-05 </td><td></td><td> 2.77573142 </td><td> 6.81865E-09 </td></tr><tr><td> rianodina un receptor, el músculo esquelético </td><td> BG793713 </td><td> 1457347_at </td><td></td><td> 0,151364292 </td><td> 3.35612E-05 </td><td></td><td> 0,503144617 </td><td> 4.32907E-05 </td></tr><tr><td> protocadherin 21 </td><td> NM_130878 </td><td> 1418304_at </td><td></td><td> 0,152671849 </td><td> 8.57783E-06 </td><td></td><td> 0,670714726 </td><td> 1.56309E-05 </td></tr><tr><td> cornichon homólogo 3 (Drosophila) </td><td> NM_028408 </td><td> 1419517_at </td><td></td><td> 0,153724144 </td><td> 8.90755E-06 </td><td></td><td> 0.95780695 </td><td> 0,661055608 </td></tr><tr><td> harakiri, BCL2 interacción de proteínas (contiene sólo BH3 de dominio) </td><td> BQ175572 </td><td> 1439854_at </td><td></td><td> 0,154284407 </td><td> 2.0118E-05 </td><td></td><td> 0.56516812 </td><td> 4.86925E-09 </td></tr><tr><td> hidratos de carbono (N-acetilgalactosamina 4-0) sulfotransferasa 9 </td><td> AK017407 </td><td> 1431897_at </td><td></td><td> 0,155238951 </td><td> 5.37423E-06 </td><td></td><td> 1.14910007 </td><td> 0,215637733 </td></tr><tr><td> calpaína 3 </td><td> AI323605 </td><td> 1433681_x_at </td><td></td><td> 0,160871988 </td><td> 1.07655E-05 </td><td></td><td> 0,477164757 </td><td> 1.33753E-11 </td></tr><tr><td> dedo de zinc, el dominio que contiene 5 CCHC </td><td> BQ126004 </td><td> 1437355_at </td><td></td><td> 0,161812078 </td><td> 3.08262E-06 </td><td></td><td> 0,421252632 </td><td> 0.01152969 </td></tr><tr><td> loricrin </td><td> NM_008508 </td><td> 1448745_s_at </td><td></td><td> 0,165129967 </td><td> 1.86362E-05 </td><td></td><td> 0,639733409 </td><td> 0,000729772 </td></tr><tr><td> Spondin 1, (f-Spondin) proteína de matriz extracelular </td><td> BC020531 </td><td> 1451342_at </td><td></td><td> 0,168035879 </td><td> 6.67867E-07 </td><td></td><td> 0,821042412 </td><td> 0,023650765 </td></tr><tr><td> RIKEN cDNA A930035E12 gen </td><td> AV348640 </td><td> 1429906_at </td><td></td><td> 5.9086795 </td><td> 1.747E-07 </td><td></td><td> 1,470383201 </td><td> 0,104085454 </td></tr></tbody><tbody><tr><td> BB247294 RIKEN de larga duración enriquecido, los 7 días cerebelo neonato Mus musculus clon cDNA A730018G18 3 &#39;, secuencia del ARNm. </td><td> BB247294 </td><td> 1447907_x_at </td><td></td><td> 5.9047494 </td><td> 1.04931E-05 </td><td></td><td> 1,968147585 </td><td> 0.00010636 </td></tr><tr><td> FERM dominio que contiene 3 </td><td> BB099015 </td><td> 1437075_at </td><td></td><td> 5.860216 </td><td> 0,000345581 </td><td></td><td> 2,780297178 </td><td> 1.83072E-06 </td></tr><tr><td&gt; Neuronal pentraxina 2 / / / proteína hipotética LOC100044234 </td><td> NM_016789 </td><td> 1420720_at </td><td></td><td> 5.7568517 </td><td> 1.34227E-06 </td><td></td><td> 2,652516957 </td><td> 0,000206279 </td></tr><tr><td> Secuencias transcritas </td><td> BG076361 </td><td> 1460101_at </td><td></td><td> 5.657735 </td><td> 2.5015E-06 </td><td></td><td> 1,296248831 </td><td> 0.22870031 </td></tr><tr><td> Spondin 1, (f-Spondin) proteína de matriz extracelular </td><td> BC020531 </td><td> 1424415_s_at </td><td></td><td> 0.17783576 </td><td> 1.01658E-06 </td><td></td><td> 0,836181248 </td><td> 0,001380141 </td></tr><tr><td> calbindina-28K </td><td> BB246032 </td><td> 1448738_at </td><td></td><td> 0,180317904 </td><td> 1.35961E-05 </td><td></td><td> 0,647334052 </td><td> 4.12268E-09 </td></tr><tr><td> MARCKS-como un </td><td> AV110584 </td><td> 1437226_x_at </td><td></td><td> 0,186235935 </td><td> 1.47067E-06 </td><td></td><td> 0,499291387 </td><td> 2.34984E-08 </td></tr><tr><td> matrilin 2 </td><td> BB338441 </td><td> 1455978_a_at </td><td></td><td> 0,187783528 </td><td> 6.19122E-05 </td><td></td><td> 0.8967688 </td><td> 0,282337853 </td></tr><tr><td> matrilin 2 </td><td> BC005429 </td><td> 1419442_at </td><td></td><td> 0,188195795 </td><td> 0,000105295 </td><td></td><td> 0,915528892 </td><td> 0.35282097 </td></tr><tr><td> Spondin 1, (f-Spondin) proteína de matriz extracelular </td><td> BQ175871 </td><td> 1442613_at </td><td></td><td> 0,189956563 </td><td> 9.41195E-06 </td><td></td><td> 0,861033222 </td><td> 0.1394266 </td></tr><tr><td> arrestina 3, la retina </td><td> NM_133205 </td><td> 1450329_a_at </td><td></td><td> 5.2130346 </td><td> 2.90599E-05 </td><td></td><td> 3,944218329 </td><td> 1.07437E-07 </td></tr><tr><td> RIKEN cDNA A330050F15 gen </td><td> AV325555 </td><td> 1457558_at </td><td></td><td> 0.19186781 </td><td> 0,000119342 </td><td></td><td> 0,660282035 </td><td> 2.47342E-05 </td></tr><tr><td> contactin 3 </td><td> BB559510 </td><td> 1438628_x_at </td><td></td><td> 0,194404608 </td><td> 4.08641E-07 </td><td></td><td> 0,918742591 </td><td> 0,022545297 </td></tr><tr><td> calbindina-28K </td><td> BB246032 </td><td> 1417504_at </td><td></td><td> 0,196381321 </td><td> 2.24182E-05 </td><td></td><td> 0,619305124 </td><td> 3.6222E-06 </td></tr><tr><td> gastrina péptido liberador de </td><td> BC024515 </td><td> 1424525_at </td><td></td><td> 4.9436426 </td><td> 3.00588E-05 </td><td></td><td> 2,752845903 </td><td> 5.72954E-07 </td></tr><tr><td> sortilin relacionados VPS10 de dominio que contienen receptores de 3 </td><td> AK018111 </td><td> 1425111_at </td><td></td><td> 4.885766 </td><td> 1.03645E-05 </td><td></td><td> 1.29051599 </td><td> 0,029733649 </td></tr><tr><td> los receptores de dopamina D1A </td><td> BE957273 </td><td> 1455629_at </td><td></td><td> 4.869493 </td><td> 3.77525E-05 </td><td></td><td> 1,815881979 </td><td> 0,000516498 </td></tr><tr><td> convertasa subtilisina proproteína / Kexin tipo 5 </td><td> BB241731 </td><td> 1437339_s_at </td><td></td><td> 0,210528027 </td><td> 7.83039E-05 </td><td></td><td> 0,574126078 </td><td> 9.15496E-05 </td></tr></tbody><tbody><tr><td> IL-1 receptor tipo I </td><td> NM_008362 </td><td> 1448950_at </td><td></td><td> 0,210572243 </td><td> 9.64524E-06 </td><td></td><td> 0,241135352 </td><td> 2.79816E-08 </td></tr></tbody></table>

dissection of hippocampal dentate gyrus from adult mouse

El hipocampo es una de las áreas más estudiadas en el cerebro debido a su importante papel funcional en el procesamiento de la memoria y el aprendizaje, su notable plasticidad de las células neuronales, y su participación en la epilepsia, enfermedades neurodegenerativas y trastornos psiquiátricos. El hipocampo se compone de regiones distintas, la circunvolución dentada, que comprende principalmente las neuronas granulares, y asta de Ammon, que comprende principalmente las neuronas piramidales, y las dos regiones están conectados por ambos circuitos anatómicos y funcionales. Muchos diferentes mRNAs y las proteínas se expresan selectivamente en el giro dentado, y el giro dentado es un sitio de la neurogénesis adulta, es decir, las nuevas neuronas son generadas continuamente en el giro dentado adulto. Para investigar la expresión de ARNm y proteínas específicas para el giro dentado, láser captura microdissection se utiliza a menudo. Este método tiene algunas limitaciones, sin embargo, como la necesidad de aparatos especiales y complicados procedimientos de manejo. En este protocolo en vídeo, que muestran una técnica de disección para eliminar el giro dentado de ratón adulto bajo un microscopio estereoscópico. Muestras de giro dentado preparados con esta técnica son adecuados para cualquier ensayo, incluyendo proteómica transcriptómica, y la celda análisis biología. Se confirmó que el tejido disecado es el giro dentado mediante la realización de PCR en tiempo real de la circunvolución dentada de genes específicos, triptófano 2,3-dioxigenasa (TDO2) y desmoplaquina (DSP), y el asta de Ammon genes enriquecido, Meis relacionados 1b gen (Mrg1b ) y TYRO3 proteína tirosina quinasa 3 (Tyro3). Las expresiones de ARNm de TDO2 y DSP en el giro dentado muestras se detectaron en los niveles más altos, obviamente, mientras que Mrg1b y Tyro3 fueron los niveles más bajos, que en las muestras de cuerno de Ammon. Para demostrar la ventaja de este método, se realizó un análisis de microarrays de ADN con muestras de todo el hipocampo y el giro dentado. La expresión de mRNA TDO2 y DSP, que se expresan de forma selectiva en el giro dentado, en el hipocampo conjunto de la alfa-CaMKII + / - ratones, mostraron 0,037 y 0,10 veces los cambios en comparación con la de ratones de tipo salvaje, respectivamente. En el giro dentado aislado, sin embargo, estas expresiones expuestas 0,011 y 0,021 veces los cambios en comparación con la de ratones de tipo salvaje, lo que demuestra que los cambios de expresión génica en el giro dentado se pueden detectar con mayor sensibilidad. En conjunto, esta técnica de disección cómodo y preciso puede ser confiable para estudios se centraron en el giro dentado.

Watch this Scientific Journal Video about Dissection of Hippocampal Dentate Gyrus from Adult Mouse at JoVE.com

Dissection of Hippocampal Dentate Gyrus from Adult Mouse

Una técnica de disección para la eliminación de la circunvolución dentada de ratones adultos bajo un microscopio estereoscópico se demostró en este protocolo de vídeo grabado.

La disección de Gyrus dentado del hipocampo de ratones adultos

The hippocampus is one of the most widely studied areas in the brain because of its important functional role in memory processing and learning, its ...

dissection-of-hippocampal-dentate-gyrus-from-adult-mouse

Research

JoVE Journal

Biology

82.1K vistas.  Japan Science and Technology Agency, Core Research for Evolutionary Science and Technology (CREST). Una técnica de disección para la eliminación de la circunvolución dentada de ratones adultos bajo un microscopio estereoscópico se demostró en este protocolo de vídeo grabado.

Video: Dissection of Hippocampal Dentate Gyrus from Adult Mouse

Dissection of 6.5 dpc Mouse Embryos

Analysis of gene expression patterns during early stages of mammalian embryonic development can provide important clues about gene function, cell-cell interaction and signaling mechanisms that guide embryonic patterning. However, dissection of the mouse embryo from the decidua shortly after implantation can be a challenging procedure, and detailed step-by-step documentation of this process is lacking.

Here we demonstrate how post-implantation (6.5 dpc) embryos are isolated by first dissecting the uterus of a pregnant mouse (detection of the vaginal plug was designated day 0.5 poist coitum) and subsequently dissecting the embryo from maternal decidua. The dissection of Reichert's membrane is described as well as the removal of the ectoplacental cone.

Isolation of postimplantation-stage embryos allows one to study gene patterning and analyze cell-lineage decision making processes during embryonic development, but proper dissection of the early embryo can be challenging. This protocol describes a method for isolating early primitive-streak-stage embryos (~6.5 days post coitum [dpc]).

La disección de embriones de ratón 6,5 dpc

Analysis of gene expression patterns during early stages of mammalian embryonic development can provide important clues about gene function, cell-cell ...

Investigación

Biología

Dissection of Organs from the Adult Zebrafish

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental analysis of the embryo and larva is extensive and the morphology has been well documented, descriptions of adult zebrafish anatomy and studies of development of the adult structures and organs, together with techniques for working with adults are lacking. The organs of the larva undergo significant changes in their overall structure, morphology, and anatomical location during the larval to adult transition.  Externally, the transparent larva develops its characteristic adult striped pigment pattern and paired pelvic fins, while internally, the organs undergo massive growth and remodeling.  In addition, the bipotential gonad primordium develops into either testis or ovary.  This protocol identifies many of the organs of the adult and demonstrates methods for dissection of the brain, gonads, gastrointestinal system, heart, and kidney of the adult zebrafish. The dissected organs can be used for in situ hybridization, immunohistochemistry, histology, RNA extraction, protein analysis, and other molecular techniques.  This protocol will assist in the broadening of studies in the zebrafish to include the remodeling of larval organs, the morphogenesis of organs specific to the adult and other investigations of the adult organ systems.

This protocol describes a procedure for identifying and dissecting organs from the adult zebrafish.

La disección de los órganos del pez cebra adultos

Over the last 20 years, the zebrafish has become a powerful model organism for understanding vertebrate development and disease.  Although experimental ...

Dissection of Oenocytes from Adult Drosophila melanogaster

In Drosophila melanogaster, as in other insects, a waxy layer on the outer surface of the cuticle, composed primarily of hydrocarbon compounds, provides protection against desiccation and other environmental challenges. Several of these cuticular hydrocarbon (CHC) compounds also function as semiochemical signals, and as such mediate pheromonal communications between members of the same species, or in some instances between different species, and influence behavior. Specialized cells referred to as oenocytes are regarded as the primary site for CHC synthesis. However, relatively little is known regarding the involvement of the oenocytes in the regulation of the biosynthetic, transport, and deposition pathways contributing to CHC output. Given the significant role that CHCs play in several aspects of insect biology, including chemical communication, desiccation resistance, and immunity, it is important to gain a greater understanding of the molecular and genetic regulation of CHC production within these specialized cells. The adult oenocytes of D. melanogaster are located within the abdominal integument, and are metamerically arrayed in ribbon-like clusters radiating along the inner cuticular surface of each abdominal segment. In this video article we demonstrate a dissection technique used for the preparation of oenocytes from adult D. melanogaster. Specifically, we provide a detailed step-by-step demonstration of (1) how to fillet prepare an adult Drosophila abdomen, (2) how to identify the oenocytes and discern them from other tissues, and (3) how to remove intact oenocyte clusters from the abdominal integument. A brief experimental illustration of how this preparation can be used to examine the expression of genes involved in hydrocarbon synthesis is included. The dissected preparation demonstrated herein will allow for the detailed molecular and genetic analysis of oenocyte function in the adult fruit fly.

Dissection of Oenocytes from Adult Drosophila melanogaster

In insects, the oenocytes produce cuticular hydrocarbon compounds. These compounds protect against desiccation and facilitate chemical communication. Here we demonstrate a dissection technique used to isolate the oenocytes from adult Drosophila melanogaster, and illustrate how this preparation can be utilized to study genes involved in hydrocarbon synthesis.

La disección de Oenocytes de Adultos Drosophila melanogaster</em

In Drosophila melanogaster, as in other insects, a waxy layer on the outer surface of the cuticle, composed primarily of hydrocarbon compounds, provides ...

Dissection of the Adult Zebrafish Kidney

Researchers working in the burgeoning field of adult stem cell biology seek to understand the signals that regulate the behavior and function of stem cells during normal homeostasis and disease states. The understanding of adult stem cells has broad reaching implications for the future of regenerative medicine1. For example, better knowledge about adult stem cell biology can facilitate the design of therapeutic strategies in which organs are triggered to heal themselves or even the creation of methods for growing organs in vitro that can be transplanted into humans1. The zebrafish has become a powerful animal model for the study of vertebrate cell biology2. There has been extensive documentation and analysis of embryonic development in the zebrafish3. Only recently have scientists sought to document adult anatomy and surgical dissection techniques4, as there has been a progressive movement within the zebrafish community to broaden the applications of this research organism to adult studies. For example, there are expanding interests in using zebrafish to investigate the biology of adult stem cell populations and make sophisticated adult models of diseases such as cancer5. Historically, isolation of the zebrafish adult kidney has been instrumental for studying hematopoiesis, as the kidney is the anatomical location of blood cell production in fish6,7. The kidney is composed of nephron functional units found in arborized arrangements, surrounded by hematopoietic tissue that is dispersed throughout the intervening spaces. The hematopoietic component consists of hematopoietic stem cells (HSCs) and their progeny that inhabit the kidney until they terminally differentiate8. In addition, it is now appreciated that a group of renal stem/progenitor cells (RPCs) also inhabit the zebrafish kidney organ and enable both kidney regeneration and growth, as observed in other fish species9-11. In light of this new discovery, the zebrafish kidney is one organ that houses the location of two exciting opportunities for adult stem cell biology studies. It is clear that many outstanding questions could be well served with this experimental system. To encourage expansion of this field, it is beneficial to document detailed methods of visualizing and then isolating the adult zebrafish kidney organ. This protocol details our procedure for dissection of the adult kidney from both unfixed and fixed animals.
Dissection of the kidney organ can be used to isolate and characterize hematopoietic and renal stem cells and their offspring using established techniques such as histology, fluorescence activated cell sorting (FACS)11,12, expression profiling13,14, and transplantation11,15. 
We hope that dissemination of this protocol will provide researchers with the knowledge to implement broader use of zebrafish studies that ultimately can be translated for human application.

The zebrafish kidney is home to both renal and hematopoietic adult stem/progenitor cells, and represents an outstanding opportunity to study these cell types and their progeny in a vertebrate model organism. Here, we demonstrate a detailed dissection procedure that enables the researcher to identify and surgically remove the adult zebrafish kidney, which can be used for applications such as cell isolation, transplantation, and expression studies of kidney and/or blood cell populations.

La disección del riñón adultos de pez cebra

Researchers working in the burgeoning field of adult stem cell biology seek to understand the signals that regulate the behavior and function of stem ...

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work examining post-embryonic through adult cardiac development has been limited7-10. Examining the changing morphology of the maturing and aging heart are restricted by the lack of techniques available for staging and isolating juvenile and adult hearts. In order to analyze heart development over the fish's lifespan, we dissect zebrafish hearts at numerous stages and photograph them for further analysis11. The morphological features of the heart can easily be quantified and individual hearts can be further analyzed by a host of standard methods. Zebrafish grow at variable rates and maturation correlates better with fish size than age, thus, post-fixation, we photograph and measure fish length as a gauge of fish maturation. This protocol explains two distinct, size dependent dissection techniques for zebrafish, ranging from larvae 3.5mm standard length (SL) with hearts of 100&mu;m ventricle length (VL), to adults, with SL of 30mm and VL 1mm or larger. Larval and adult fish have quite distinct body and organ morphology. Larvae are not only significantly smaller, they have less pigment and each organ is visually very difficult to identify. For this reason, we use distinct dissection techniques.
We used pre-dissection fixation procedures, as we discovered that hearts dissected directly after euthanization have a more variable morphology, with very loose and balloon like atria compared with hearts removed following fixation. The fish fixed prior to dissection, retain in vivo morphology and chamber position (data not shown). In addition, for demonstration purposes, we take advantage of the heart (myocardial) specific GFP transgenic Tg(myl7:GFP)twu34 (12), which allows us to visualize the entire heart and is particularly useful at early stages in development when the cardiac morphology is less distinct from surrounding tissues. Dissection of the heart makes further analysis of the cell and molecular biology underlying heart development and maturation using in situ hybridization, immunohistochemistry, RNA extraction or other analytical methods easier in post-embryonic zebrafish. This protocol will provide a valuable technique for the study of cardiac development maturation and aging.

Heart Dissection in Larval, Juvenile and Adult Zebrafish, Danio rerio

A clear, standardized method for dissection and isolation of the zebrafish heart at multiple developmental stages are described. Annotation and quantification techniques are also discussed.

La disección del corazón en las larvas, juveniles y adultos de pez cebra, Danio rerio</em

Zebrafish have become a beneficial and practical model organism for the study of embryonic heart development (see recent reviews1-6), however, work ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

Generación de ratones derivados de células madre pluripotentes inducidas

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

Isolation and Culture of Dental Epithelial Stem Cells from the Adult Mouse Incisor

Understanding the cellular and molecular mechanisms that underlie tooth regeneration and renewal has become a topic of great interest1-4, and the mouse incisor provides a model for these processes. This remarkable organ grows continuously throughout the animal&#39;s life and generates all the necessary cell types from active pools of adult stem cells housed in the labial (toward the lip) and lingual (toward the tongue) cervical loop (CL) regions. Only the dental stem cells from the labial CL give rise to ameloblasts that generate enamel, the outer covering of teeth, on the labial surface. This asymmetric enamel formation allows abrasion at the incisor tip, and progenitors and stem cells in the proximal incisor ensure that the dental tissues are constantly replenished. The ability to isolate and grow these progenitor or stem cells in vitro allows their expansion and opens doors to numerous experiments not achievable in vivo, such as high throughput testing of potential stem cell regulatory factors. Here, we describe and demonstrate a reliable and consistent method to culture cells from the labial CL of the mouse incisor.

The continuously growing mouse incisor provides a model for studying renewal of dental tissues from dental epithelial stem cells (DESCs). A robust system for consistently and reliably obtaining these cells from the incisor and expanding them in vitro is reported here.

Aislamiento y cultivo de células madre epiteliales dental del adulto Ratón Incisivo

Understanding the cellular and molecular mechanisms that underlie tooth regeneration and renewal has become a topic of great interest1-4, and the mouse ...

Isolation and Culture of Primary Mouse Keratinocytes from Neonatal and Adult Mouse Skin

The keratinocyte (KC) is the predominant cell type in the epidermis, the outermost layer of the skin. Epidermal KCs play a critical role in providing skin defense by forming an intact skin barrier against environmental insults, such as UVB irradiation or pathogens, and also by initiating an inflammatory response upon those insults. Here we describe methods to isolate KCs from neonatal mouse skin and from adult mouse tail skin. We also describe culturing conditions using defined growth supplements (dGS) in comparison to chelexed fetal bovine serum (cFBS). Functionally, we show that both neonatal and adult KCs are highly responsive to high calcium-induced terminal differentiation, tight junction formation and stratification. Additionally, cultured adult KCs are susceptible to UVB-triggered cell death and can release large amounts of TNF upon UVB irradiation. Together, the methods described here will be useful to researchers for the setup of in vitro models to study epidermal biology in the neonatal mouse and/or the adult mouse.

Epidermal keratinocytes form a functional skin barrier and are positioned at the front line of host defense against external environmental insults. Here we describe methods for isolation and primary culture of epidermal keratinocytes from neonatal and adult mouse skin, and induction of terminal differentiation and UVB-triggered inflammatory response from keratinocytes.

Aislamiento y cultivo de queratinocitos de ratón primario de piel de ratón neonatal y adulto

The keratinocyte (KC) is the predominant cell type in the epidermis, the outermost layer of the skin. Epidermal KCs play a critical role in providing skin ...

Isolation of Enteric Glial Cells from the Submucosa and Lamina Propria of the Adult Mouse

The enteric nervous system (ENS) consists of neurons and enteric glial cells (EGCs) that reside within the smooth muscle wall, submucosa and lamina propria. EGCs play important roles in gut homeostasis through the release of various trophic factors and contribute to the integrity of the epithelial barrier. Most studies of primary enteric glial cultures use cells isolated from the myenteric plexus after enzymatic dissociation. Here, a non-enzymatic method to isolate and culture EGCs from the intestinal submucosa and lamina propria is described. After manual removal of the longitudinal muscle layer, EGCs were liberated from the lamina propria and submucosa using sequential HEPES-buffered EDTA incubations followed by incubation in commercially available non-enzymatic cell recovery solution. The EDTA incubations were sufficient to strip most of the epithelial mucosa from the lamina propria, allowing the cell recovery solution to liberate the submucosal EGCs. Any residual lamina propria and smooth muscle was discarded along with the myenteric glia. EGCs were easily identified by their ability to express glial fibrillary acidic protein (GFAP). Only about 50% of the cell suspension contained GFAP+ cells after completing tissue incubations and prior to plating on the poly-D-lysine/laminin substrate. However, after 3 days of culturing the cells in glial cell-derived neurotrophic factor (GDNF)-containing culture media, the cell population adhering to the substrate-coated plates comprised of &#62;95% enteric glia. We created a hybrid mouse line by breeding a hGFAP-Cre mouse to the ROSA-tdTomato reporter line to track the percentage of GFAP+ cells using endogenous cell fluorescence. Thus, non-myenteric enteric glia can be isolated by non-enzymatic methods and cultured for at least 5 days.

Here, we describe the isolation of enteric-glial cells from the intestinal-submucosa using sequential EDTA incubations to chelate divalent cations and then incubation in non-enzymatic cell recovery solution. Plating the resultant cell suspension on poly-D-lysine and laminin results in a highly enriched culture of submucosal glial cells for functional analysis.

Aislamiento de las células gliales entéricas de la Submucosa y la lámina propia del ratón adulto

The enteric nervous system (ENS) consists of neurons and enteric glial cells (EGCs) that reside within the smooth muscle wall, submucosa and lamina ...

Isolation, Characterization, and Differentiation of Cardiac Stem Cells from the Adult Mouse Heart

Myocardial infarction (MI) is a leading cause of morbidity and mortality around the world. A major goal of regenerative medicine is to replenish the dead myocardium after MI. Although several strategies have been used to regenerate myocardium, stem cell therapy remains a major approach to replenish the dead myocardium of an MI heart. Accumulating evidence suggests the presence of resident cardiac stem cells (CSCs) in the adult heart and their endocrine and/or paracrine effects on cardiac regeneration. However, CSC isolation and their characterization and differentiation toward myocardial cells, especially cardiomyocytes, remains a technical challenge. In the present study, we provided a simple method for the isolation, characterization, and differentiation of CSCs from the adult mouse heart. Here, we describe a density gradient method for the isolation of CSCs, where the heart is digested by a 0.2% collagenase II solution. To characterize the isolated CSCs, we evaluated the expression of CSCs/cardiac markers Sca-1, NKX2-5, and GATA4, and pluripotency/stemness markers OCT4, SOX2, and Nanog. We also determined the proliferation potential of isolated CSCs by culturing them in a Petri dish and assessing the expression of the proliferation marker Ki-67. For evaluating the differentiation potential of CSCs, we selected seven- to ten-days cultured CSCs. We transferred them to a new plate with a cardiomyocyte differentiation medium. They are incubated in a cell culture incubator for 12 days, while the differentiation medium is changed every three days. The differentiated CSCs express cardiomyocyte-specific markers: actinin and troponin I. Thus, CSCs isolated with this protocol have stemness and cardiac markers, and they have a potential for proliferation and differentiation toward cardiomyocyte lineage.

The overall goal of this article is to standardize the protocol for the isolation, characterization, and differentiation of cardiac stem cells (CSCs) from the adult mouse heart. Here, we describe a density gradient centrifugation method to isolate murine CSCs and elaborated methods for CSC culture, proliferation, and differentiation into cardiomyocytes.

Aislamiento, caracterización y diferenciación de células cardiacas desde el corazón de ratón adulto

Myocardial infarction (MI) is a leading cause of morbidity and mortality around the world. A major goal of regenerative medicine is to replenish the dead ...