وأيد هذا العمل من المنح المقدمة R01DE018138 من المعاهد الوطنية للصحة (PX) وجزئيا من جامعة فرجينيا كومنولث الرئاسية بحوث برنامج الحوافز (PRIP) 144602-3 (PX). نشكر الدكاترة. ليو تشن، Yuetan ضو وانغ شياو جينغ لمساعدة في بناء المسوخ الجينوم واسعة. ونشكر أيضا مرفق الأساسية DNA في جامعة فرجينيا كومنولث لتسلسل الحمض النووي.

1. تصميم التمهيدي <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تم تصميم الاشعال باستخدام البرامج النصية في المنزل استنادا إلى S. الدم تسلسل الجينوم SK36. تم تصميم ثلاث مجموعات من الاشعال، F1/R1، F2/R2، وF3/R3 لتضخيم التسلسل-1 ك المنبع من الجين المستهدف، وترميز الجين APHA-3 الكاناميسين المقاومة (كم ص) البروتين 3 و 1 في تسلسل-KB المصب من الجين المستهدف، على التوالي (الشكل 1). ومن بين هذه الاشعال، فقد تم تصميم R3 باستخدام F1 وePrimer3 في جناح برامج زخرف ( <a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html</a> ) لتضخيم المناطق المحيطة رئيسية أو فرعية للهدف الجينات. تم تصميم الاشعال جين معين، R1 وF3، على أساس 5 &#39;و 3&#39; تسلسل الجين المستهدف. وR1 F3 الاشعال تحتوي على تسلسل محول 25-BP في نهاية ال 5 هم &#39;التي هي مكملة لAPHA-3الجينات. تم تصميم كل درجات الحرارة ذوبان التمهيدي لتكون أقرب ما يمكن إلى 60 ° C لتمكين استخدام زي درجة الحرارة الصلب لجميع ردود الفعل PCR في 96-جيدا الشكل. </li><li style=";text-align:right;direction:rtl"> وقد تم تجميع F1، R1، F3 والاشعال في 96-R3 وحات جيدة تستند إلى أمر الجينات. كل لوحة تحتوي على نوع واحد من الاشعال في ترتيب نفس الجين. تخفيف الاشعال في 96-وحة جيدا التمهيدي تعمل على تركيز النهائي من 10 ميكرومتر لتضخيم PCR باستخدام ماصة الأقنية. </li></ol> 2. عالية الإنتاجية PCR التضخيم والتنقية <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> عالية الإنتاجية لتضخيم 1-KB المنبع أو المصب من S. الهدف الجينات الدم، تجميع خليط كوكتيل PCR على الجليد في أنبوب مخروطي 15-مل تحتوي على 1640 ميكرولتر DDH 2 O، 250 ميكرولتر العازلة 10xHigh الإخلاص PCR، 200 ميكرولتر من 10 ملي dNTP خليط، 100 ميكرولتر من 50 ملي MgSO 4، 100 ميكرولتر من 10 نانوغرام / ميكرولتر S. الدم الحمض النووي الجيني SK36 و 10 ميكرولتر البلاتين طق polyme DNArase عالية الدقة ونقل 23 ميكرولتر من الخليط في كل بئر على 96-PCR باستخدام لوحة جيدا ماصة الأقنية. نقل 1 ميكرولتر من كل F1 وR1 (أو F3 وR3) من 10 ميكرومتر العمل التمهيدي لوحات لوحة PCR باستخدام ماصة الأقنية. ختم لوحة PCR التضخيم وأداء في C ° 94 لل1 دقيقة، و 30 ° C دورات 94 لل30 ثانية و 54 درجة مئوية لمدة 30 ثانية و 68 درجة مئوية لمدة 1.5 دقيقة. </li><li style=";text-align:right;direction:rtl"> إعداد 1٪ agarose هلام يحتوي على إيثيديوم بروميد مع 48 بئرا المناسب الأقنية تحميل ماصة. خلط 4 المنتج PCR ميكرولتر مع 1 ميكرولتر من العازلة تحميل 5xDNA على 96-وحة جيدا وتحميل العينات في هلام الاغاروز باستخدام ماصة الأقنية 10-ميكرولتر. تشغيل الكهربائي في V 135 لل30 دقيقة. دراسة النطاق على جل الوثائق تحت نظام UVP والتحليل. </li><li style=";text-align:right;direction:rtl"> تنقية المنتجات PCR بنسبة 96 PureLink عدة تنقية PCR باستخدام الطرد المركزي وفقا لتعليمات الشركة المصنعة. ليبلغ حجمه DNA، اضافة 40 ميكرولتر معقمة [ده 2 O إلى البئر لبinding وحة. </li><li style=";text-align:right;direction:rtl"> اختيار عشوائي عدة amplicons تنقيته على لوحة لفحص الحمض النووي باستخدام تركيزات الطيف NanoDrop. ضبط تركيز amplicons على لوحة ل~ 10 نانوغرام / ميكرولتر. </li><li style=";text-align:right;direction:rtl"> يتم هضم البلازميد التي تحتوي على راديو كاسيت ص كلم باستخدام EcoR I كقالب PCR. يتم تنقيته من البلازميد يهضم من قبل عدة QIAquick تنقية PCR ويتم ضبط DNA البلازميد إلى خطي تركيز DNA النهائية 10 نانوغرام / ميكرولتر. تجميع 25 ميكرولتر مزيج لAMPLICON كم كاسيت R بما في ذلك 16.4 ميكرولتر O 2 DDH، 2.5 ميكرولتر العازلة PCR 10xHigh الإخلاص، 2 ميكرولتر من 10 ملي dNTP خليط، 1 ميكرولتر من المغنيسيوم 50 مم SO 4، 1 ميكرولتر من 10 ميكرومتر F2، 1 ميكرولتر من 10 ميكرومتر R2، 1 ميكرولتر الحمض النووي البلازميد و 0.1 ميكرولتر الخطية DNA بوليميراز طق البلاتين الإخلاص عالية. PCR التضخيم في أداء ° C 94 لل1 دقيقة، و 30 ° C دورات 94 لل30 ثانية و 55 درجة مئوية لمدة 30 ثانية و 68 درجة مئوية لمدة 1 دقيقة. دراسة المنتج من قبل PCR الكهربائي للهلام الاغاروز على 1٪. برازلا الجزء الأكبر من الكاسيت كم AMPLICON R من 10 فرد PCR المنقى من عدة QIAquick تنقية PCR. ضبط تركيز AMPLICON إلى 10 نانوغرام / ميكرولتر. </li><li style=";text-align:right;direction:rtl"> للحصول على الخطية النهائية AMPLICON PCR المؤتلف، يتم الجمع بين 3 amplicons PCR مع كل ميكرولتر 1 (بكميات متساوية تقريبا، الرحى) في لوحة PCR بئر واحد كقالب PCR. يضاف المكونات الأخرى بما في ذلك 14.4 ميكرولتر PCR O 2 DDH، 2.5 ميكرولتر العازلة PCR 10xHigh الإخلاص، 2 ميكرولتر من 10 ملي dNTP خليط، 1 ميكرولتر من المغنيسيوم 50 مم SO 4، 1 ميكرولتر من F1 ميكرومتر 10، 1 ميكرولتر من 10 ميكرومتر R3، 0.1 ميكروليتر DNA بوليميراز طق البلاتين عالية الدقة. PCR التضخيم يتم تنفيذ في C ° 94 لل2 دقيقة و 30 دورات من 94 درجة مئوية لمدة 30 ثانية C ° 55 لمدة 30 ثانية و 68 ° C لحوالي 3.5 دقيقة، و 68 درجة مئوية لمدة أخيرا 4 دقائق. </li><li style=";text-align:right;direction:rtl"> دراسة amplicons PCR على هلام الاغاروز. تنقية وتحديد amplicons PCR على النحو المبين أعلاه. تجميد معاد amplicons PCR في -20 ° C. </li></ol> 3. كومأكفاء خلايا إعداد <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ويتم إعداد مرق تود هيويت، ودرجة الحموضة المعدل إلى 7.6 باستخدام هيدروكسيد الصوديوم 10 N، يسخن حتى يغلي ثم يبرد إلى درجة حرارة الغرفة وتعقيمها باستخدام 0،22 ميكرون تصفية البوليسترين 4. إضافة 300 ميكرولتر للحرارة المعطل مصل الحصان (تركيز النهائي إلى 2.5٪) إلى 11.7 مل مرق هيويت تود في أنبوب مل 15-المخروطية لتعويض TH + HS المتوسط. TH + HS قسامة المتوسطة في 2 مل و 10 مل في أنابيب. </li><li style=";text-align:right;direction:rtl"> تطعيم 5 ميكرولتر من الأسهم S. SK36 الدم المجمدة في C ° -80 إلى 2 مل المتوسطة TH + HS واحتضان الثقافة بين عشية وضحاها مع السد بإحكام عند 37 درجة مئوية، مصحوبة قبل احتضان 10 مل أنبوب HS-TH +. </li><li style=";text-align:right;direction:rtl"> بعد ليلة وضحاها، تحويل 50 ميكرولتر الثقافة في 10 مل + HS TH واحتضان الأنبوب في C ° 37 ساعة لمدة 3 (الموافق OD 660 من 0،07-0،08)، وذلك باستخدام فورا للتحول. </li></ol> 4. تحول الخلايا واختيار المضادات الحيوية <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إضافة 2 ميكرولتر من 70 نانوغرام S. SK36 تعوض الدمالببتيد تينس تحفيز (CSP) و 2 ميكرولتر الخطية المؤتلف PCR AMPLICON (~ 50 نانوغرام) لأنابيب إيبندورف على ما يرام-96 كتلة وقبل الدافئ لهم في 37 ° C. نقل 330 ميكرولتر من 3 SK36 الثقافة HR-المحتضنة في كل أنبوب. احتضان في C ° 37 لمدة 1 ساعة. استبدال DNA مع العقيمة O 2 DDH والسيطرة. </li><li style=";text-align:right;direction:rtl"> وضع كتلة على الجليد وتنتشر 100 ميكرولتر من كل القلب ضخ التحول على الدماغ (BHI) لوحة أجار مع 500 ميكروغرام / مل الكاناميسين. احتضان لوحات في C ° 37 لمدة 2 د في ظل ظروف microaerobic. </li></ol> 5. متحولة تأكيد والتخزين <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> لكل متحولة استبدال، واختيار عشوائي بنسبة 2 المستعمرات الفردية، تطعيم مستعمرة في 5 مل تحتوي على 500 ميكروغرام BHI / مل الكاناميسين واحتضان بين عشية وضحاها microaerobically اللقاح في 37 ° C. Cryopreserve كل ثقافة في الجلسرين 30٪ في -80 ° C </li><li style=";text-align:right;direction:rtl"> لدراسة ما إذا كانت تحتوي على متحولة استبدال الجينات المتوقع، نفذ PCR مستعمرة لكل F1 متحولة باستخدام وR3الاشعال في 96-PCR لوحة جيدا. ويستخدم حوالي 1-ميكرولتر الثقافة بين عشية وضحاها من مستعمرة الفردية DNA كقالب في رد فعل التضخيم PCR-25-ميكرولتر. يتم تنفيذ PCR في C ° 94 لل5 دقائق و 35 دورات من 94 درجة مئوية لمدة 30 ثانية و 55 درجة مئوية لمدة 30 ثانية و 68 ° C لحوالي 3.5 دقيقة، و 68 درجة مئوية لمدة أخيرا 4 دقائق. </li><li style=";text-align:right;direction:rtl"> لتحديد بالضبط المزدوج الفرقة المسوخ أو الملوثات AMPLICON PCR، ودراسة AMPLICON PCR بواسطة الرحلان الكهربائي لمدة 4 ساعة على&gt; 12 سم طويلة الجل الاغاروز 2٪ مع تلطيخ بروميد إيثيديوم. تحت هذا الشرط الكهربائي الاغاروز هلام، وحددت بوضوح أي amplicons مع الفرق ≥ BP 100. عندما يتوقع العصابات الناتجة عن التضخيم من الكاسيت R كم والجين من النوع البري لتختلف باختلاف &lt;100 شركة بريتيش بتروليوم، يتم استخدام التمهيدي T1 الداخلية لتحديد ما إذا كان يمكن الكشف عن الجين من النوع البري بواسطة PCR. </li><li style=";text-align:right;direction:rtl"> لمزيد من تأكيد الحذف، وتنقيته من amplicons بنسبة 96 PureLink عدة تنقية PCR وباستخدام تسلسل التمهيدي الذي P1بربط كاسيت ص كيلومتر. إبقاء المسوخ الصحيح الوحيد أكده التسلسل. </li></ol>

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

الإعلان عن أي تضارب في المصالح.

للتقليل من الآثار المحتملة القطبية من استبدال جين واحد مع جين المضادات الحيوية المستهدفة الخارجية على الجينات المجاورة، وتتخذ خطوتين بينما التمهيدي الأولي تصميم. بالنسبة لمعظم الجينات حذف، فقد تم تصميم R1 الاشعال وF3 لحذف المنطقة الترميز من 6 BP بعد كودون بدء الغليان ?...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; أسماء</strong</td&gt;<td<strong&gt; شركة</strong</td&gt;<td<strong&gt; كتالوج #</strong</td&gt;<td<strong&gt; التعليقات (اختياري)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي F2</td&gt;<td&gt; تقنيات الحمض النووي المتكاملة</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي R2</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي F2P</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي P1</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي P2</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي 5 &#39;end_R1_seq</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي 5 &#39;end_F3_seq</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي 5 &#39;end_R1p_seq</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; تسلسل: NH2-COOH-DLRGVPNPWGWIFGR</td&gt;</tr&gt;<tr&gt;<td&gt; DNA البلمرة</td&gt;<td&gt; إينفيتروجن</td&gt;<td&gt; 11304-102</td&gt;<td&gt; DNA طق البلاتين البلمرة العالية والولاء</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; شركة نيو انغلاند Biolabs</td&gt;<td&gt; R0101S</td&gt;<td&gt; تقييد انزيم</td&gt;</tr&gt;<tr&gt;<td&gt; آجار</td&gt;<td&gt; Bioanalytical الأمريكية</td&gt;<td&gt; AB01185</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; الاغاروز</td&gt;<td&gt; Promega</td&gt;<td&gt; V3125</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; BD العلوم البيولوجية</td&gt;<td&gt; 237500</td&gt;<td&gt; تسريب الدماغ القلب</td&gt;</tr&gt;<tr&gt;<td&gt; حصان المصل</td&gt;<td&gt; فيشر العلمية</td&gt;<td&gt; SH3007403</td&gt;<td&gt; حصان المصل</td&gt;</tr&gt;<tr&gt;<td&gt; كم</td&gt;<td&gt; فيشر العلمية</td&gt;<td&gt; BP906-5</td&gt;<td&gt; كاناميسين</td&gt;</tr&gt;<tr&gt;<td&gt; TH مرق</td&gt;<td&gt; BD العلوم البيولوجية</td&gt;<td&gt; 249240</td&gt;<td&gt; تود هيويت مرق</td&gt;</tr&gt;<tr&gt;<td&gt; PureLink 96</td&gt;<td&gt; إينفيتروجن</td&gt;<td&gt; K310096</td&gt;<td&gt; PureLink 96 طقم تنقية PCR</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; QIAGEN</td&gt;<td&gt; 28106</td&gt;<td&gt; تنقية PCR QIAquick عدة</td&gt;</tr&gt;<tr&gt;<td&gt; تصفية</td&gt;<td&gt; كورنينج</td&gt;<td&gt; 431117</td&gt;<td&gt; البوليسترين ميكرون تصفية 0،22</td&gt;</tr&gt;<tr&gt;<td&gt; نظام Anoxomat</td&gt;<td&gt; علم الأحياء الدقيقة مارت BV</td&gt;<td&gt; Anoxomat مارك الثاني</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; الفوق الطرد المركزي</td&gt;<td&gt; الحرارية العلمية</td&gt;<td&gt; 75004377</td&gt;<td&gt; الكتب التي أسطورة RT زائد الدوار صفيحة ميكروسكوبية</td&gt;</tr&gt;<tr&gt;<td&gt; جل الوثائق</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc-IT 210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; حاضنة</td&gt;<td&gt; فيشر العلمية</td&gt;<td&gt; 11-690-625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; Labnet في جل XL</td&gt;<td&gt; Labnet</td&gt;<td&gt; E0160</td&gt;<td&gt; Labnet في جل XL</td&gt;</tr&gt;<tr&gt;<td&gt; ميكروسنتريفوج</td&gt;<td&gt; إيبندورف</td&gt;<td&gt; 22621408</td&gt;<td&gt; ميكروسنتريفوج 5415 R</td&gt;</tr&gt;<tr&gt;<tdماصات المتعددة&gt;</td&gt;<td&gt; الحرارية Scientfic</td&gt;<td&gt; 4661040، 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; Cycler الحرارية</td&gt;<td&gt; شركة النظم البيولوجية التطبيقية</td&gt;<td&gt; N805-0200</td&gt;<td&gt; GeneAmp PCR النظام 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

ينقول الطفرات والحذف واحد الجينات طريقتان في تطبيق خروج المغلوب الجينات في الجينوم على نطاق 1،2 البكتيريا. على الرغم من الطفرات ينقول أقل مضيعة للوقت، أقل تكلفة، ولا تحتاج إلى استكمال المعلومات الجينوم، وهناك نوعان نقاط الضعف في هذه الطريقة: (1) إمكانية حدوث طفرات متباينة في مكتبة متحولة مختلطة مكافحة يختار المسوخ مع تقليل المنافسة؛ و (2) إمكانية تعطيل الجين جزئية حيث الجينات لا تفقد وظيفتها بالكامل بعد ادراج ينقول. قد أحادية الجين التحليل حذف التعويض عن العيوب المرتبطة الطفرات ينقول. لتحسين كفاءة الجينوم على نطاق حذف جين واحد، ونحن نحاول اقامة تقنية عالية الإنتاجية للالجينوم على نطاق حذف جين واحد باستخدام الدم العقدية باعتباره النموذج الحي. كل حذف الجينات في بناء S. تم تصميم الجينوم الدم لتشمل 1-KB المنبع من الجينات المستهدفة، الجين APHA-3، ترميز البروتين المقاومة الكانامايسين، و1-KB المصب من الجينات المستهدفة. ثلاث مجموعات من الاشعال F1/R1، F2/R2، وF3/R3، على التوالي، فقد تم تصميم وتجميعها في شكل لوحة 96-PCR-جيدا لالتكبير من تلك المكونات الثلاثة للحذف كل بناء. الاشعال R1 وتحتوي على 25-F3 بي بي متواليات التي هي مكملة لمناطق الجينات-3 APHA في نهاية ال 5 هم &#39;. يتم تنفيذ A التضخيم PCR كبيرة الحجم من الجين-3 APHA مرة واحدة لخلق بنيات كل واحد حذف الجينات. في البداية تم استبعاد المروج من الجينات APHA-3 للتقليل من التأثير المحتمل للكاسيت الكاناميسين القطبية. لإنشاء بنيات حذف الجينات، يتم تنفيذ عالية الإنتاجية PCR التضخيم والتنقية في شكل لوحة 96-أيضا. وسيبذل الخطية AMPLICON PCR لكل المؤتلف حذف الجينات من خلال ردود الفعل PCR 4 عالية الدقة باستخدام البلمرة DNA. وexpon الأوليةential مرحلة نمو S. تستكمل الدم مثقف في مرق تود هيويت مع 2.5٪ يستخدم المصل الحصان المعطل لزيادة الكفاءة لتحويل PCR-المؤتلف يبني. تحت هذا الشرط، وتصل إلى 20٪ من S. يمكن أن تتحول الخلايا الدم ~ 50 نانوغرام باستخدام الحمض النووي. استنادا إلى هذا النهج، في نهاية المطاف تم الحصول على 2048 المسوخ مع احد الجينات الحذف من الجينات في 2270 S. الواردة الدم باستثناء 4 ORFs الجينات بالكامل داخل ORFs أخرى في S. الدم SK36 و 218 الجينات الأساسية المحتملة. هذه التقنية على خلق بنيات حذف الجين هو إنتاجية عالية، ويمكن أن تكون سهلة الاستخدام في الجينوم على نطاق الحذف جين واحد لأي بكتيريا التحويلية.

بعد التضخيم PCR باستخدام بادئات F1 وR1، وF3 وR3، حوالي 1-KB المنبع والمصب لكل S. تم الحصول على الدم في شكل الجينات 96-حسنا، على التوالي (الشكل 2A). لدينا في ظل ظروف PCR وباستخدام البادئات المصممة، تم تضخيم منتج معين من S. الدم في كل الحمض النووي الجيني تفاعل P...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

وقد أنشئت فعال الجينوم على نطاق طفرة جين واحد باستخدام طريقة<em&gt; العقدية الدم</em&gt; كما كائن النموذج. وقد حققت هذه الطريقة من خلال تقارير إتمام المشروعات الإنتاجية العالية المؤتلف والتحولات.

حذوفات الجينات في الجينوم على نطاق<em&gt; العقدية الدم</em&gt; من جانب PCR إنتاجية عالية

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

16.5K Views.  Virginia Commonwealth University. وقد أنشئت فعال الجينوم على نطاق طفرة جين واحد باستخدام طريقة العقدية الدم كما كائن النموذج. وقد حققت هذه الطريقة من خلال تقارير إتمام المشروعات الإنتاجية العالية المؤتلف والتحولات.

Video: Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in which the gene of interest has been disrupted. A gene-disruption DNA construct containing a suitable antibiotic resistance marker gene is useful for the generation of gene-disrupted strains in bacteria. However, conventional construction methods, which require gene cloning steps, involve complex and time-consuming protocols. Here, a relatively facile, rapid, and cost-effective method for targeted gene disruption in Streptococcus mutans is described. The method utilizes a 2-step fusion polymerase chain reaction (PCR) to generate the disruption construct and electroporation for genetic transformation. This method does not require an enzymatic reaction, other than PCR, and additionally offers greater flexibility in terms of the design of the disruption construct. Employment of electroporation facilitates the preparation of competent cells and improves the transformation efficiency. The present method may be adapted for the generation of gene-disrupted strains of various species.

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

جيل تعطيل الجينات العقدية mutans سلالة دون الجيني الاستنساخ

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Genetics

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol for transferring gene deletion mutations from one Escherichia coli strain to another by using generalized transduction with the bacteriophage P1. This method requires that the mutation be selectable (e.g., based on gene disruptions using antibiotic cassette insertions). Such antibiotic cassettes can be mobilized from a donor strain and introduced into a recipient strain of interest to quickly and easily generate a gene deletion mutant. The antibiotic cassette can be designed to include flippase recognition sites that allow the excision of the cassette by a site-specific recombinase to produce a clean knock-out with only a ~100-base-pair-long scar sequence in the genome. We demonstrate the protocol by knocking out the tamA gene encoding an assembly factor involved in autotransporter biogenesis and test the effect of this knock-out on the biogenesis and function of two trimeric autotransporter adhesins. Though gene deletion by P1 transduction has its limitations, the ease and speed of its implementation make it an attractive alternative to other methods of gene deletion.

Producing Gene Deletions in Escherichia coli by P1 Transduction with Excisable Antibiotic Resistance Cassettes

Here we present a protocol for the use of pre-existing antibiotic resistance-cassette deletion constructs as a basis for making deletion mutants in other E. coli strains. Such deletion mutations can be mobilized and inserted into the corresponding locus of a recipient strain using P1 bacteriophage transduction.

إنتاج الجينات الحذف في الإشريكيّة القولونية بتوصيل P1 مع أشرطة الكاسيت المهربة مقاومة المضادات الحيوية

A first approach to study the function of an unknown gene in bacteria is to create a knock-out of this gene. Here, we describe a robust and fast protocol ...

Digital PCR-based Competitive Index for High-throughput Analysis of Fitness in Salmonella

A competitive index is a common method used to assess bacterial fitness and/or virulence. The utility of this approach is exemplified by its ease to perform and its ability to standardize the fitness of many strains to a wild-type organism. The technique is limited, however, by available phenotypic markers and the number of strains that can be assessed simultaneously, creating the need for a great number of replicate experiments. Concurrent with large numbers of experiments, the labor and material costs for quantifying bacteria based on phenotypic markers are not insignificant. To overcome these negative aspects while retaining the positive aspects, we have developed a molecular-based approach to directly quantify microorganisms after engineering genetic markers onto bacterial chromosomes. Unique, 25 base pair DNA barcodes were inserted at an innocuous locus on the chromosome of wild-type and mutant strains of Salmonella. In vitro competition experiments were performed using inocula consisting of pooled strains. Following the competition, the absolute numbers of each strain were quantified using digital PCR and the competitive indices for each strain were calculated from those values. Our data indicate that this approach to quantifying Salmonella is extremely sensitive, accurate, and precise for detecting both highly abundant (high fitness) and rare (low fitness) microorganisms. Additionally, this technique is easily adaptable to nearly any organism with chromosomes capable of modification, as well as to various experimental designs that require absolute quantification of microorganisms.

Digital PCR-based Competitive Index for High-throughput Analysis of Fitness in Salmonella

This molecular-based approach for determining bacterial fitness facilitates precise and accurate detection of microorganisms using unique genomic DNA barcodes that are quantified via digital PCR. The protocol describes calculating the competitive index for Salmonella strains; however, the technology is readily adaptable to protocols requiring absolute quantification of any genetically-malleable organism.

مؤشر تنافسي رقمي قائم على PCR لتحليل عالي الإنتاجية للياقة البدنية في السالمونيلا

A competitive index is a common method used to assess bacterial fitness and/or virulence. The utility of this approach is exemplified by its ease to ...

Cell Surface Receptor Identification Using Genome-Scale CRISPR/Cas9 Genetic Screens

Intercellular communication mediated by direct interactions between membrane-embedded cell surface receptors is crucial for the normal development and functioning of multicellular organisms. Detecting these interactions remains technically challenging, however. This manuscript describes a systematic genome-scale CRISPR/Cas9 knockout genetic screening approach that reveals cellular pathways required for specific cell surface recognition events. This assay utilizes recombinant proteins produced in a mammalian protein expression system as avid binding probes to identify interaction partners in a cell-based genetic screen. This method can be used to identify the genes necessary for cell surface interactions detected by recombinant binding probes corresponding to the ectodomains of membrane-embedded receptors. Importantly, given the genome-scale nature of this approach, it also has the advantage of not only identifying the direct receptor but also the cellular components that are required for the presentation of the receptor at the cell surface, thereby providing valuable insights into the biology of the receptor.

This manuscript describes a genome-scale cell-based screening approach to identify extracellular receptor-ligand interactions.

التعرف على مستقبلات سطح الخلية باستخدام شاشات CRISPR/Cas9 الجينية على مقياس الجينوم

Intercellular communication mediated by direct interactions between membrane-embedded cell surface receptors is crucial for the normal development and ...

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, therefore, suitable to be used for routine purposes. For best resolution, data evaluation and data management, a miniaturized electrophoresis system is required. Together with such an electrophoresis system and the in-house developed software (freely available here) assignment of the pattern of bands to a genotype is standardized and straight forward. DNA extraction is simple (boiling prep), setting-up of the reactions is easy and they can be run on any standard PCR machine. PCR cycling is common except prolonged ramping and elongation times. Compared to spa typing and Multi Locus Sequence Typing (MLST), RS-PCR does not require DNA sequencing what simplifies the analysis considerably and allows a high throughput. Furthermore, the resolution for bovine strains of S. aureus is at least as good as spa typing and better than MLST or pulsed-field gel electrophoresis (PFGE). The RS-PCR data base includes presently a total of 141 genotypes and variants. The method is highly associated with the virulence gene pattern, contagiosity and pathogenicity of S. aureus strains involved in bovine mastitis. S. aureus genotype B (GTB) is contagious and causes herds problems causing large costs in the Switzerland and other European countries. All the other genotypes observed in Switzerland infect individual cows and quarters. Genotyping by RS-PCR allows the reliable prediction of the epidemiological and the pathogenic potential of S. aureus involved in bovine intramammary infection (IMI), two key factors for clinical veterinary medicine. Because of these beneficial properties together with moderate costs and a high sample throughput the goal of this publication is to give a detailed, step-by-step protocol for easily establishing and running RS-PCR for genotyping S. aureus in other laboratories.

Genotyping of Staphylococcus aureus by Ribosomal Spacer PCR RS-PCR

Here, ribosomal spacer PCR (RS-PCR) is used together with a miniaturized electrophoresis system as a fast and high resolution method for genotyping S. aureus at moderate costs allowing a high throughput.

التنميط الجيني ل<em&gt; المكورات العنقودية الذهبية</em&gt; من جانب خاص بالريبوسوم فاصل PCR (RS-PCR)

The ribosomal spacer PCR (RS-PCR) is a highly resolving and robust genotyping method for S. aureus that allows a high throughput at moderate costs and is, ...

Immunology and Infection

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Systematic, large-scale synthetic genetic (gene-gene or epistasis) interaction screens can be used to explore genetic redundancy and pathway cross-talk. Here, we describe a high-throughput quantitative synthetic genetic array screening technology, termed eSGA that we developed for elucidating epistatic relationships and exploring genetic interaction networks in Escherichia coli.

رسم خرائط الشبكات الوظيفية البكتيرية والممرات في<em&gt; كولاي</em&gt; استخدام المصفوفات الوراثية الاصطناعية

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

عملية الوحش الأخضر لتوليد سلالات الخميرة حمل حذوفات متعددة الجينات

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Purification of a High Molecular Mass Protein in Streptococcus mutans

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has been disrupted. Loss of function following gene disruption is subsequently restored by exogenous addition of the product of the disrupted gene. This helps to determine the function of the gene. A method previously described involves generating a gtfC gene-disrupted Streptococcus mutans strain. Here, an undemanding method is described for purifying the gtfC gene product from the newly generated S. mutans strain following the gene disruption. It involves the addition of a polyhistidine-coding sequence at the 3&#8242; end of the gene of interest, which allows simple purification of the gene product using immobilized metal affinity chromatography. No enzymatic reactions other than PCR are required for the genetic modification in this method. The restoration of the gene product by exogenous addition after gene disruption is an efficient method for determining gene function, which may also be adapted to different species.

Purification of a High Molecular Mass Protein in Streptococcus mutans

Described here is a simple method for the purification of a gene product in Streptococcus mutans. This technique may be advantageous in the purification of proteins, especially membrane proteins and high molecular mass proteins, and can be used with various other bacterial species.

تنقية بروتين كتلة جزيئية عالية في موتان العقدية

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

جيل من المتحولين في الإطار الجينات الحذف في الزائفة الزنجاريه واختبار لتوهين ضراوة في نموذج الماوس بسيطه من العدوى

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...

Generation of Null Mutants to Elucidate the Role of Bacterial Glycosyltransferases in Bacterial Motility

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans constitute a strain-specific barcode. The associated glycans show higher diversity in sugar composition and structure than those of eukaryotes and are important in bacterial-host recognition processes and interaction with the environment. In pathogenic bacteria, glycoproteins have been involved in different stages of the infectious process, and glycan modifications can interfere with specific functions of glycoproteins. However, despite the advances made in the understanding of glycan composition, structure, and biosynthesis pathways, understanding of the role of glycoproteins in pathogenicity or interaction with the environment remains very limited. Furthermore, in some bacteria, the enzymes required for protein glycosylation are shared with other polysaccharide biosynthetic pathways, such as lipopolysaccharide and capsule biosynthetic pathways. The functional importance of glycosylation has been elucidated in several bacteria through mutation of specific genes thought to be involved in the glycosylation process and the study of its impact on the expression of the target glycoprotein and the modifying glycan. Mesophilic Aeromonas have a single and O-glycosylated polar flagellum. Flagellar glycans show diversity in carbohydrate composition and chain length between Aeromonas strains. However, all strains analyzed to date show a pseudaminic acid derivative as the linking sugar that modifies serine or threonine residues. The pseudaminic acid derivative is required for polar flagella assembly, and its loss has an impact on adhesion, biofilm formation, and colonization. The protocol detailed in this article describes how the construction of null mutants can be used to understand the involvement of genes or genome regions containing putative glycosyltransferases in the biosynthesis of a flagellar glycan. This includes the potential to understand the function of the glycosyltransferases involved and the role of the glycan. This will be achieved by comparing the glycan deficient mutant to the wild-type strain.

Here, we describe the construction of null mutants of Aeromonas in specific glycosyltransferases or regions containing glycosyltransferases, the motility assays, and flagella purification performed to establish the involvement and function of their encoded enzymes in the biosynthesis of a glycan, as well as the role of this glycan in bacterial pathogenesis.

توليد الطفرات الخالية لتوضيح دور الجليكوسيل ترانسفيراز البكتيري في الحركة البكتيرية

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans ...