وأيد هذا العمل من المنح المقدمة R01DE018138 من المعاهد الوطنية للصحة (PX) وجزئيا من جامعة فرجينيا كومنولث الرئاسية بحوث برنامج الحوافز (PRIP) 144602-3 (PX). نشكر الدكاترة. ليو تشن، Yuetan ضو وانغ شياو جينغ لمساعدة في بناء المسوخ الجينوم واسعة. ونشكر أيضا مرفق الأساسية DNA في جامعة فرجينيا كومنولث لتسلسل الحمض النووي.

1. تصميم التمهيدي <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تم تصميم الاشعال باستخدام البرامج النصية في المنزل استنادا إلى S. الدم تسلسل الجينوم SK36. تم تصميم ثلاث مجموعات من الاشعال، F1/R1، F2/R2، وF3/R3 لتضخيم التسلسل-1 ك المنبع من الجين المستهدف، وترميز الجين APHA-3 الكاناميسين المقاومة (كم ص) البروتين 3 و 1 في تسلسل-KB المصب من الجين المستهدف، على التوالي (الشكل 1). ومن بين هذه الاشعال، فقد تم تصميم R3 باستخدام F1 وePrimer3 في جناح برامج زخرف ( <a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html</a> ) لتضخيم المناطق المحيطة رئيسية أو فرعية للهدف الجينات. تم تصميم الاشعال جين معين، R1 وF3، على أساس 5 &#39;و 3&#39; تسلسل الجين المستهدف. وR1 F3 الاشعال تحتوي على تسلسل محول 25-BP في نهاية ال 5 هم &#39;التي هي مكملة لAPHA-3الجينات. تم تصميم كل درجات الحرارة ذوبان التمهيدي لتكون أقرب ما يمكن إلى 60 ° C لتمكين استخدام زي درجة الحرارة الصلب لجميع ردود الفعل PCR في 96-جيدا الشكل. </li><li style=";text-align:right;direction:rtl"> وقد تم تجميع F1، R1، F3 والاشعال في 96-R3 وحات جيدة تستند إلى أمر الجينات. كل لوحة تحتوي على نوع واحد من الاشعال في ترتيب نفس الجين. تخفيف الاشعال في 96-وحة جيدا التمهيدي تعمل على تركيز النهائي من 10 ميكرومتر لتضخيم PCR باستخدام ماصة الأقنية. </li></ol> 2. عالية الإنتاجية PCR التضخيم والتنقية <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> عالية الإنتاجية لتضخيم 1-KB المنبع أو المصب من S. الهدف الجينات الدم، تجميع خليط كوكتيل PCR على الجليد في أنبوب مخروطي 15-مل تحتوي على 1640 ميكرولتر DDH 2 O، 250 ميكرولتر العازلة 10xHigh الإخلاص PCR، 200 ميكرولتر من 10 ملي dNTP خليط، 100 ميكرولتر من 50 ملي MgSO 4، 100 ميكرولتر من 10 نانوغرام / ميكرولتر S. الدم الحمض النووي الجيني SK36 و 10 ميكرولتر البلاتين طق polyme DNArase عالية الدقة ونقل 23 ميكرولتر من الخليط في كل بئر على 96-PCR باستخدام لوحة جيدا ماصة الأقنية. نقل 1 ميكرولتر من كل F1 وR1 (أو F3 وR3) من 10 ميكرومتر العمل التمهيدي لوحات لوحة PCR باستخدام ماصة الأقنية. ختم لوحة PCR التضخيم وأداء في C ° 94 لل1 دقيقة، و 30 ° C دورات 94 لل30 ثانية و 54 درجة مئوية لمدة 30 ثانية و 68 درجة مئوية لمدة 1.5 دقيقة. </li><li style=";text-align:right;direction:rtl"> إعداد 1٪ agarose هلام يحتوي على إيثيديوم بروميد مع 48 بئرا المناسب الأقنية تحميل ماصة. خلط 4 المنتج PCR ميكرولتر مع 1 ميكرولتر من العازلة تحميل 5xDNA على 96-وحة جيدا وتحميل العينات في هلام الاغاروز باستخدام ماصة الأقنية 10-ميكرولتر. تشغيل الكهربائي في V 135 لل30 دقيقة. دراسة النطاق على جل الوثائق تحت نظام UVP والتحليل. </li><li style=";text-align:right;direction:rtl"> تنقية المنتجات PCR بنسبة 96 PureLink عدة تنقية PCR باستخدام الطرد المركزي وفقا لتعليمات الشركة المصنعة. ليبلغ حجمه DNA، اضافة 40 ميكرولتر معقمة [ده 2 O إلى البئر لبinding وحة. </li><li style=";text-align:right;direction:rtl"> اختيار عشوائي عدة amplicons تنقيته على لوحة لفحص الحمض النووي باستخدام تركيزات الطيف NanoDrop. ضبط تركيز amplicons على لوحة ل~ 10 نانوغرام / ميكرولتر. </li><li style=";text-align:right;direction:rtl"> يتم هضم البلازميد التي تحتوي على راديو كاسيت ص كلم باستخدام EcoR I كقالب PCR. يتم تنقيته من البلازميد يهضم من قبل عدة QIAquick تنقية PCR ويتم ضبط DNA البلازميد إلى خطي تركيز DNA النهائية 10 نانوغرام / ميكرولتر. تجميع 25 ميكرولتر مزيج لAMPLICON كم كاسيت R بما في ذلك 16.4 ميكرولتر O 2 DDH، 2.5 ميكرولتر العازلة PCR 10xHigh الإخلاص، 2 ميكرولتر من 10 ملي dNTP خليط، 1 ميكرولتر من المغنيسيوم 50 مم SO 4، 1 ميكرولتر من 10 ميكرومتر F2، 1 ميكرولتر من 10 ميكرومتر R2، 1 ميكرولتر الحمض النووي البلازميد و 0.1 ميكرولتر الخطية DNA بوليميراز طق البلاتين الإخلاص عالية. PCR التضخيم في أداء ° C 94 لل1 دقيقة، و 30 ° C دورات 94 لل30 ثانية و 55 درجة مئوية لمدة 30 ثانية و 68 درجة مئوية لمدة 1 دقيقة. دراسة المنتج من قبل PCR الكهربائي للهلام الاغاروز على 1٪. برازلا الجزء الأكبر من الكاسيت كم AMPLICON R من 10 فرد PCR المنقى من عدة QIAquick تنقية PCR. ضبط تركيز AMPLICON إلى 10 نانوغرام / ميكرولتر. </li><li style=";text-align:right;direction:rtl"> للحصول على الخطية النهائية AMPLICON PCR المؤتلف، يتم الجمع بين 3 amplicons PCR مع كل ميكرولتر 1 (بكميات متساوية تقريبا، الرحى) في لوحة PCR بئر واحد كقالب PCR. يضاف المكونات الأخرى بما في ذلك 14.4 ميكرولتر PCR O 2 DDH، 2.5 ميكرولتر العازلة PCR 10xHigh الإخلاص، 2 ميكرولتر من 10 ملي dNTP خليط، 1 ميكرولتر من المغنيسيوم 50 مم SO 4، 1 ميكرولتر من F1 ميكرومتر 10، 1 ميكرولتر من 10 ميكرومتر R3، 0.1 ميكروليتر DNA بوليميراز طق البلاتين عالية الدقة. PCR التضخيم يتم تنفيذ في C ° 94 لل2 دقيقة و 30 دورات من 94 درجة مئوية لمدة 30 ثانية C ° 55 لمدة 30 ثانية و 68 ° C لحوالي 3.5 دقيقة، و 68 درجة مئوية لمدة أخيرا 4 دقائق. </li><li style=";text-align:right;direction:rtl"> دراسة amplicons PCR على هلام الاغاروز. تنقية وتحديد amplicons PCR على النحو المبين أعلاه. تجميد معاد amplicons PCR في -20 ° C. </li></ol> 3. كومأكفاء خلايا إعداد <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> ويتم إعداد مرق تود هيويت، ودرجة الحموضة المعدل إلى 7.6 باستخدام هيدروكسيد الصوديوم 10 N، يسخن حتى يغلي ثم يبرد إلى درجة حرارة الغرفة وتعقيمها باستخدام 0،22 ميكرون تصفية البوليسترين 4. إضافة 300 ميكرولتر للحرارة المعطل مصل الحصان (تركيز النهائي إلى 2.5٪) إلى 11.7 مل مرق هيويت تود في أنبوب مل 15-المخروطية لتعويض TH + HS المتوسط. TH + HS قسامة المتوسطة في 2 مل و 10 مل في أنابيب. </li><li style=";text-align:right;direction:rtl"> تطعيم 5 ميكرولتر من الأسهم S. SK36 الدم المجمدة في C ° -80 إلى 2 مل المتوسطة TH + HS واحتضان الثقافة بين عشية وضحاها مع السد بإحكام عند 37 درجة مئوية، مصحوبة قبل احتضان 10 مل أنبوب HS-TH +. </li><li style=";text-align:right;direction:rtl"> بعد ليلة وضحاها، تحويل 50 ميكرولتر الثقافة في 10 مل + HS TH واحتضان الأنبوب في C ° 37 ساعة لمدة 3 (الموافق OD 660 من 0،07-0،08)، وذلك باستخدام فورا للتحول. </li></ol> 4. تحول الخلايا واختيار المضادات الحيوية <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إضافة 2 ميكرولتر من 70 نانوغرام S. SK36 تعوض الدمالببتيد تينس تحفيز (CSP) و 2 ميكرولتر الخطية المؤتلف PCR AMPLICON (~ 50 نانوغرام) لأنابيب إيبندورف على ما يرام-96 كتلة وقبل الدافئ لهم في 37 ° C. نقل 330 ميكرولتر من 3 SK36 الثقافة HR-المحتضنة في كل أنبوب. احتضان في C ° 37 لمدة 1 ساعة. استبدال DNA مع العقيمة O 2 DDH والسيطرة. </li><li style=";text-align:right;direction:rtl"> وضع كتلة على الجليد وتنتشر 100 ميكرولتر من كل القلب ضخ التحول على الدماغ (BHI) لوحة أجار مع 500 ميكروغرام / مل الكاناميسين. احتضان لوحات في C ° 37 لمدة 2 د في ظل ظروف microaerobic. </li></ol> 5. متحولة تأكيد والتخزين <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> لكل متحولة استبدال، واختيار عشوائي بنسبة 2 المستعمرات الفردية، تطعيم مستعمرة في 5 مل تحتوي على 500 ميكروغرام BHI / مل الكاناميسين واحتضان بين عشية وضحاها microaerobically اللقاح في 37 ° C. Cryopreserve كل ثقافة في الجلسرين 30٪ في -80 ° C </li><li style=";text-align:right;direction:rtl"> لدراسة ما إذا كانت تحتوي على متحولة استبدال الجينات المتوقع، نفذ PCR مستعمرة لكل F1 متحولة باستخدام وR3الاشعال في 96-PCR لوحة جيدا. ويستخدم حوالي 1-ميكرولتر الثقافة بين عشية وضحاها من مستعمرة الفردية DNA كقالب في رد فعل التضخيم PCR-25-ميكرولتر. يتم تنفيذ PCR في C ° 94 لل5 دقائق و 35 دورات من 94 درجة مئوية لمدة 30 ثانية و 55 درجة مئوية لمدة 30 ثانية و 68 ° C لحوالي 3.5 دقيقة، و 68 درجة مئوية لمدة أخيرا 4 دقائق. </li><li style=";text-align:right;direction:rtl"> لتحديد بالضبط المزدوج الفرقة المسوخ أو الملوثات AMPLICON PCR، ودراسة AMPLICON PCR بواسطة الرحلان الكهربائي لمدة 4 ساعة على&gt; 12 سم طويلة الجل الاغاروز 2٪ مع تلطيخ بروميد إيثيديوم. تحت هذا الشرط الكهربائي الاغاروز هلام، وحددت بوضوح أي amplicons مع الفرق ≥ BP 100. عندما يتوقع العصابات الناتجة عن التضخيم من الكاسيت R كم والجين من النوع البري لتختلف باختلاف &lt;100 شركة بريتيش بتروليوم، يتم استخدام التمهيدي T1 الداخلية لتحديد ما إذا كان يمكن الكشف عن الجين من النوع البري بواسطة PCR. </li><li style=";text-align:right;direction:rtl"> لمزيد من تأكيد الحذف، وتنقيته من amplicons بنسبة 96 PureLink عدة تنقية PCR وباستخدام تسلسل التمهيدي الذي P1بربط كاسيت ص كيلومتر. إبقاء المسوخ الصحيح الوحيد أكده التسلسل. </li></ol>

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

الإعلان عن أي تضارب في المصالح.

للتقليل من الآثار المحتملة القطبية من استبدال جين واحد مع جين المضادات الحيوية المستهدفة الخارجية على الجينات المجاورة، وتتخذ خطوتين بينما التمهيدي الأولي تصميم. بالنسبة لمعظم الجينات حذف، فقد تم تصميم R1 الاشعال وF3 لحذف المنطقة الترميز من 6 BP بعد كودون بدء الغليان ?...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; أسماء</strong</td&gt;<td<strong&gt; شركة</strong</td&gt;<td<strong&gt; كتالوج #</strong</td&gt;<td<strong&gt; التعليقات (اختياري)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي F2</td&gt;<td&gt; تقنيات الحمض النووي المتكاملة</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي R2</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي F2P</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي P1</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي P2</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي 5 &#39;end_R1_seq</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي 5 &#39;end_F3_seq</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; التمهيدي 5 &#39;end_R1p_seq</td&gt;<td&gt; المرجع نفسه</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; تسلسل: NH2-COOH-DLRGVPNPWGWIFGR</td&gt;</tr&gt;<tr&gt;<td&gt; DNA البلمرة</td&gt;<td&gt; إينفيتروجن</td&gt;<td&gt; 11304-102</td&gt;<td&gt; DNA طق البلاتين البلمرة العالية والولاء</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; شركة نيو انغلاند Biolabs</td&gt;<td&gt; R0101S</td&gt;<td&gt; تقييد انزيم</td&gt;</tr&gt;<tr&gt;<td&gt; آجار</td&gt;<td&gt; Bioanalytical الأمريكية</td&gt;<td&gt; AB01185</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; الاغاروز</td&gt;<td&gt; Promega</td&gt;<td&gt; V3125</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; BD العلوم البيولوجية</td&gt;<td&gt; 237500</td&gt;<td&gt; تسريب الدماغ القلب</td&gt;</tr&gt;<tr&gt;<td&gt; حصان المصل</td&gt;<td&gt; فيشر العلمية</td&gt;<td&gt; SH3007403</td&gt;<td&gt; حصان المصل</td&gt;</tr&gt;<tr&gt;<td&gt; كم</td&gt;<td&gt; فيشر العلمية</td&gt;<td&gt; BP906-5</td&gt;<td&gt; كاناميسين</td&gt;</tr&gt;<tr&gt;<td&gt; TH مرق</td&gt;<td&gt; BD العلوم البيولوجية</td&gt;<td&gt; 249240</td&gt;<td&gt; تود هيويت مرق</td&gt;</tr&gt;<tr&gt;<td&gt; PureLink 96</td&gt;<td&gt; إينفيتروجن</td&gt;<td&gt; K310096</td&gt;<td&gt; PureLink 96 طقم تنقية PCR</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; QIAGEN</td&gt;<td&gt; 28106</td&gt;<td&gt; تنقية PCR QIAquick عدة</td&gt;</tr&gt;<tr&gt;<td&gt; تصفية</td&gt;<td&gt; كورنينج</td&gt;<td&gt; 431117</td&gt;<td&gt; البوليسترين ميكرون تصفية 0،22</td&gt;</tr&gt;<tr&gt;<td&gt; نظام Anoxomat</td&gt;<td&gt; علم الأحياء الدقيقة مارت BV</td&gt;<td&gt; Anoxomat مارك الثاني</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; الفوق الطرد المركزي</td&gt;<td&gt; الحرارية العلمية</td&gt;<td&gt; 75004377</td&gt;<td&gt; الكتب التي أسطورة RT زائد الدوار صفيحة ميكروسكوبية</td&gt;</tr&gt;<tr&gt;<td&gt; جل الوثائق</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc-IT 210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; حاضنة</td&gt;<td&gt; فيشر العلمية</td&gt;<td&gt; 11-690-625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; Labnet في جل XL</td&gt;<td&gt; Labnet</td&gt;<td&gt; E0160</td&gt;<td&gt; Labnet في جل XL</td&gt;</tr&gt;<tr&gt;<td&gt; ميكروسنتريفوج</td&gt;<td&gt; إيبندورف</td&gt;<td&gt; 22621408</td&gt;<td&gt; ميكروسنتريفوج 5415 R</td&gt;</tr&gt;<tr&gt;<tdماصات المتعددة&gt;</td&gt;<td&gt; الحرارية Scientfic</td&gt;<td&gt; 4661040، 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; Cycler الحرارية</td&gt;<td&gt; شركة النظم البيولوجية التطبيقية</td&gt;<td&gt; N805-0200</td&gt;<td&gt; GeneAmp PCR النظام 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

ينقول الطفرات والحذف واحد الجينات طريقتان في تطبيق خروج المغلوب الجينات في الجينوم على نطاق 1،2 البكتيريا. على الرغم من الطفرات ينقول أقل مضيعة للوقت، أقل تكلفة، ولا تحتاج إلى استكمال المعلومات الجينوم، وهناك نوعان نقاط الضعف في هذه الطريقة: (1) إمكانية حدوث طفرات متباينة في مكتبة متحولة مختلطة مكافحة يختار المسوخ مع تقليل المنافسة؛ و (2) إمكانية تعطيل الجين جزئية حيث الجينات لا تفقد وظيفتها بالكامل بعد ادراج ينقول. قد أحادية الجين التحليل حذف التعويض عن العيوب المرتبطة الطفرات ينقول. لتحسين كفاءة الجينوم على نطاق حذف جين واحد، ونحن نحاول اقامة تقنية عالية الإنتاجية للالجينوم على نطاق حذف جين واحد باستخدام الدم العقدية باعتباره النموذج الحي. كل حذف الجينات في بناء S. تم تصميم الجينوم الدم لتشمل 1-KB المنبع من الجينات المستهدفة، الجين APHA-3، ترميز البروتين المقاومة الكانامايسين، و1-KB المصب من الجينات المستهدفة. ثلاث مجموعات من الاشعال F1/R1، F2/R2، وF3/R3، على التوالي، فقد تم تصميم وتجميعها في شكل لوحة 96-PCR-جيدا لالتكبير من تلك المكونات الثلاثة للحذف كل بناء. الاشعال R1 وتحتوي على 25-F3 بي بي متواليات التي هي مكملة لمناطق الجينات-3 APHA في نهاية ال 5 هم &#39;. يتم تنفيذ A التضخيم PCR كبيرة الحجم من الجين-3 APHA مرة واحدة لخلق بنيات كل واحد حذف الجينات. في البداية تم استبعاد المروج من الجينات APHA-3 للتقليل من التأثير المحتمل للكاسيت الكاناميسين القطبية. لإنشاء بنيات حذف الجينات، يتم تنفيذ عالية الإنتاجية PCR التضخيم والتنقية في شكل لوحة 96-أيضا. وسيبذل الخطية AMPLICON PCR لكل المؤتلف حذف الجينات من خلال ردود الفعل PCR 4 عالية الدقة باستخدام البلمرة DNA. وexpon الأوليةential مرحلة نمو S. تستكمل الدم مثقف في مرق تود هيويت مع 2.5٪ يستخدم المصل الحصان المعطل لزيادة الكفاءة لتحويل PCR-المؤتلف يبني. تحت هذا الشرط، وتصل إلى 20٪ من S. يمكن أن تتحول الخلايا الدم ~ 50 نانوغرام باستخدام الحمض النووي. استنادا إلى هذا النهج، في نهاية المطاف تم الحصول على 2048 المسوخ مع احد الجينات الحذف من الجينات في 2270 S. الواردة الدم باستثناء 4 ORFs الجينات بالكامل داخل ORFs أخرى في S. الدم SK36 و 218 الجينات الأساسية المحتملة. هذه التقنية على خلق بنيات حذف الجين هو إنتاجية عالية، ويمكن أن تكون سهلة الاستخدام في الجينوم على نطاق الحذف جين واحد لأي بكتيريا التحويلية.

بعد التضخيم PCR باستخدام بادئات F1 وR1، وF3 وR3، حوالي 1-KB المنبع والمصب لكل S. تم الحصول على الدم في شكل الجينات 96-حسنا، على التوالي (الشكل 2A). لدينا في ظل ظروف PCR وباستخدام البادئات المصممة، تم تضخيم منتج معين من S. الدم في كل الحمض النووي الجيني تفاعل P...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

وقد أنشئت فعال الجينوم على نطاق طفرة جين واحد باستخدام طريقة<em&gt; العقدية الدم</em&gt; كما كائن النموذج. وقد حققت هذه الطريقة من خلال تقارير إتمام المشروعات الإنتاجية العالية المؤتلف والتحولات.

حذوفات الجينات في الجينوم على نطاق<em&gt; العقدية الدم</em&gt; من جانب PCR إنتاجية عالية

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

16.4K Views.  Virginia Commonwealth University. وقد أنشئت فعال الجينوم على نطاق طفرة جين واحد باستخدام طريقة العقدية الدم كما كائن النموذج. وقد حققت هذه الطريقة من خلال تقارير إتمام المشروعات الإنتاجية العالية المؤتلف والتحولات.

Video: Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

الجينوم على نطاق التحليل باستخدام رقاقة لتحديد أهداف محددة الجينات شكل الإسوي

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

الجينوم على نطاق الشاشة لأهداف ميرنا باستخدام معرف الهدف المكتبة MISSION

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. elegans, gene function can be knocked down simply and efficiently by feeding worms with bacteria expressing a dsRNA corresponding to a specific gene 1. While the creation of libraries of RNAi clones covering most of the C. elegans genome 2,3 opened the way for true functional genomic studies (see for example 4-7), most established methods are laborious. Moy and colleagues have developed semi-automated protocols that facilitate genome-wide screens 8. The approach relies on microscopic imaging and image analysis. 
	Here we describe an alternative protocol for a high-throughput genome-wide screen, based on robotic handling of bacterial RNAi clones, quantitative analysis using the COPAS Biosort (Union Biometrica (UBI)), and an integrated software: the MBioLIMS (Laboratory Information Management System from Modul-Bio) a technology that provides increased throughput for data management and sample tracking. The method allows screens to be conducted on solid medium plates. This is particularly important for some studies, such as those addressing host-pathogen interactions in C. elegans, since certain microbes do not efficiently infect worms in liquid culture.
	We show how the method can be used to quantify the importance of genes in anti-fungal innate immunity in C. elegans. In this case, the approach relies on the use of a transgenic strain carrying an epidermal infection-inducible fluorescent reporter gene, with GFP under the control of the promoter of the antimicrobial peptide gene nlp 29 and a red fluorescent reporter that is expressed constitutively in the epidermis. The latter provides an internal control for the functional integrity of the epidermis and nonspecific transgene silencing9. When control worms are infected by the fungus they fluoresce green. Knocking down by RNAi a gene required for nlp 29 expression results in diminished fluorescence after infection. Currently, this protocol allows more than 3,000 RNAi clones to be tested and analyzed per week, opening the possibility of screening the entire genome in less than 2 months.

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

We describe a protocol using C. elegans and RNAi feeding libraries that allows automated measurement of multiple parameters such as fluorescence, size and opacity of individual worms in a population. We give one example of a screen to identify genes involved in anti-fungal innate immunity in C. elegans.

الكمية والآلي عالية الإنتاجية الجينوم على نطاق شاشات رني في C. ايليجانس</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

عملية الوحش الأخضر لتوليد سلالات الخميرة حمل حذوفات متعددة الجينات

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

التنميط الفردية الخلايا الجذعية الجنينية البشرية من خلال الكمي RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often depend on its interactions with other proteins. Here, we describe a protocol for the yeast protein-fragment complementation assay (PCA), a powerful method to detect direct and proximal associations between proteins in living cells. The interaction between two proteins, each fused to a dihydrofolate reductase (DHFR) protein fragment, translates into growth of yeast strains in presence of the drug methotrexate (MTX). Differential fitness, resulting from different amounts of reconstituted DHFR enzyme, can be quantified on high-density colony arrays, allowing to differentiate interacting from non-interacting bait-prey pairs. The high-throughput protocol presented here is performed using a robotic platform that parallelizes mating of bait and prey strains carrying complementary DHFR-fragment fusion proteins and the survival assay on MTX. This protocol allows to systematically test for thousands of protein-protein interactions (PPIs) involving bait proteins of interest and offers several advantages over other PPI detection assays, including the study of proteins expressed from their endogenous promoters without the need for modifying protein localization and for the assembly of complex reporter constructs.

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

Proteins interact with each other and these interactions determine in a large part their functions. Protein interaction partners can be identified at high-throughput in vivo using a yeast fitness assay based on the dihydrofolate reductase protein-fragment complementation assay (DHFR-PCA).

الجينوم على نطاق فحص التفاعلات بين البروتينات التي كتبها البروتين جزء التكملة الفحص (PCA) في الخلايا الحية

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

الإنتاجية العالية للكشف عن المغيرون الكيميائية من الجينات المشاركة ما بعد transcriptionally الخاضعة للرقابة

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic chromosome, synIII1, and one synthetic chromosome arm, synIXR2, have been constructed and their in vivo function validated in the absence of the corresponding wild type chromosomes. An important design feature of Sc2.0 chromosomes is the introduction of PCRTags, which are short, re-coded sequences within open reading frames (ORFs) that enable differentiation of synthetic chromosomes from their wild type counterparts. PCRTag primers anneal selectively to either synthetic or wild type chromosomes and the presence/absence of each type of DNA can be tested using a simple PCR assay. The standard readout of the PCRTag assay is to assess presence/absence of amplicons by agarose gel electrophoresis. However, with an average PCRTag amplicon density of one per 1.5 kb and a genome size of ~12 Mb, the completed Sc2.0 genome will encode roughly 8,000 PCRTags. To improve throughput, we have developed a real time PCR-based detection assay for PCRTag genotyping that we call qPCRTag analysis. The workflow specifies 500 nl reactions in a 1,536 multiwell plate, allowing us to test up to 768 PCRTags with both synthetic and wild type primer pairs in a single experiment.

Designer chromosomes of the Synthetic Yeast Genome project, Sc2.0, can be distinguished from their native counterparts using a PCR-based genotyping assay called PCRTagging, which has a presence/absence endpoint. Here we describe a high-throughput real time PCR detection method for PCRTag genotyping.

تحليل qPCRTag - إنتاجية عالية، في الوقت الحقيقي PCR الفحص لSc2.0 التنميط الجيني

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to dose-limiting toxicity and many adverse side effects. Targeting the genome with sequence-specific small molecules may enable molecules with increased therapeutic index and fewer off-target effects. N-methylpyrrole/N-methylimidazole polyamides are molecules that can be rationally designed to target specific DNA sequences with exquisite precision. And unlike most natural transcription factors, polyamides can bind to methylated and chromatinized DNA without a loss in affinity. The sequence specificity of polyamides has been extensively studied in vitro with cognate site identification (CSI) and with traditional biochemical and biophysical approaches, but the study of polyamide binding to genomic targets in cells remains elusive. Here we report a method, the crosslinking of small molecules to isolate chromatin (COSMIC), that identifies polyamide binding sites across the genome. COSMIC is similar to chromatin immunoprecipitation (ChIP), but differs in two important ways: (1) a photocrosslinker is employed to enable selective, temporally-controlled capture of polyamide binding events, and (2) the biotin affinity handle is used to purify polyamide&#8211;DNA conjugates under semi-denaturing conditions to decrease DNA that is non-covalently bound. COSMIC is a general strategy that can be used to reveal the genome-wide binding events of polyamides and other genome-targeting chemotherapeutic agents.

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Identifying the direct targets of genome-targeting molecules remains a major challenge. To understand how DNA-binding molecules engage the genome, we developed a method that relies on crosslinking of small molecules to isolate chromatin (COSMIC).

على صعيد رسم الخرائط الجينوم من المخدرات-DNA التفاعلات في الخلايا مع COSMIC (يشابك من الجزيئات الصغيرة لعزل لونين)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID وما يليها: رسم خرائط الجينوم على نطاق التفاعلات البروتين DNA بواسطة إنتاجية عالية تسلسل شظايا الحمض النووي ميثليته الأدينين

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...