Questo lavoro è stato sostenuto dalle concessioni R01DE018138 dal National Institutes of Health (PX) e, in parte, dal Programma Virginia Commonwealth Research presidenziale Incentive University (PRIP) 144602-3 (PX). Ringraziamo Drs. Lei Chen, Yuetan Dou e Xiaojing Wang per l&#39;assistenza con la costruzione di mutanti genoma di larghezza. Ringraziamo anche il Core Facility DNA della Virginia Commonwealth University per il sequenziamento del DNA.

1. Primer design <ol><li> Primer sono progettati utilizzando script in casa in base alla S. sanguinis SK36 genoma sequenza. Tre serie di primer, F1/R1, F2/R2 e F3/R3 sono progettati per l&#39;amplificazione del-1 kb di sequenza a monte del gene target, l&#39;APHA-3 encoding gene per la resistenza alla kanamicina (Km r) e la proteina 3 1 -kb sequenza a valle del gene bersaglio, rispettivamente (Figura 1). Tra questi primer, F1 e R3 sono progettati utilizzando ePrimer3 nel EMBOSS insieme di programmi ( <a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html</a> ) per amplificare regioni fiancheggianti monte oa valle del target gene. Primer gene specifico, R1 e F3, sono progettati in base al 5 &#39;e 3&#39; sequenze del gene bersaglio. Primer R1 ed F3 contengono 25 coppie di basi sequenze adattatore alla fine il loro 5 &#39;che sono complementari al APHA-3gene. Le temperature di fusione di ciascun primer sono stati progettati per essere il più vicino possibile a 60 ° C per consentire l&#39;uso di una temperatura di ricottura uniforme per tutte le reazioni di PCR in formato a 96 pozzetti. </li><li> F1, R1, R3 F3 e primer sono sintetizzati in piastre a 96 pozzetti basato su un ordine gene. Ciascuna piastra contiene un tipo di primer nell&#39;ordine stesso gene. Diluire i primer in piastra a 96 pozzetti fondo lavorando ad una concentrazione finale di 10 pM per l&#39;amplificazione PCR usando una pipetta multicanale. </li></ol> 2. High-throughput amplificazione PCR e purificazione <ol><li> Per amplificare elevato throughput 1-kb a monte oa valle del bersaglio S. geni sanguinis, assemblare una miscela cocktail PCR in ghiaccio in 15 ml tubo conico contenente 1640 microlitri DDH 2 O, 250 microlitri 10xHigh Fidelity PCR Buffer, 200 ml di miscela di mm 10 dNTP, 100 pl di 50 mM MgSO4, 100 pl di 10 ng / mL S. sanguinis SK36 DNA genomico e 10 microlitri Platinum Taq DNA polimerasirase alta fedeltà e trasferimento 23 microlitri della miscela in ciascun pozzetto di piastra a 96 pozzetti PCR usando una pipetta multicanale. Trasferire 1 ml di ciascuna F1 e R1 (o F3 e R3) da 10 pM di lavoro piastre di primer alla piastra PCR usando pipetta multicanale. Sigillare la piastra PCR ed eseguire amplificazione a 94 ° C per 1 min, e 30 cicli di 94 ° C per 30 sec, 54 ° C per 30 sec e 68 ° C per 1,5 min. </li><li> Preparare 1% gel contenente bromuro di etidio con 48 carico multicanale raccordo pipetta pozzi. Miscelare 4 microlitri prodotto PCR con 1 ml di tampone di caricamento 5xDNA sulla piastra a 96 pozzetti e caricare i campioni su gel di agarosio utilizzando un 10-microlitri pipetta multicanale. Eseguire elettroforesi a 135 V per 30 minuti. Esaminare la banda su gel con documentazione UVP e sistema di analisi. </li><li> Purificare il prodotto PCR da 96 PureLink kit di purificazione PCR utilizzando centrifugazione secondo le istruzioni del produttore. Per eluizione del DNA, aggiungere 40 microlitri sterile DDH 2 O al pozzo del binding piastra. </li><li> Scegliere a caso diversi amplificati purificati sulla piastra di esaminare le concentrazioni di DNA mediante spettrofotometro NanoDrop. Regolare la concentrazione di ampliconi su piastra a ~ 10 ng / mL. </li><li> Un plasmide contenente cassette chilometri r viene digerito con EcoR I come template PCR. Il plasmide digerito viene purificato per QIAquick kit di purificazione PCR e il DNA plasmide lineare viene regolata alla concentrazione finale di 10 ng di DNA / pl. Montare 25 miscela microlitri per amplicone km cassetta r compresi 16,4 microlitri DDH 2 O, 2,5 microlitri 10xHigh Fidelity PCR Buffer, 2 ml di miscela di mm 10 dNTP, 1 ml di 50 mM Mg SO 4, 1 ml di 10 pM F2, 1 ml di 10 pM R2, 1 ml DNA plasmidico lineare e 0,1 microlitri fedeltà Platinum Taq DNA polimerasi alta. Effettuare amplificazione PCR a 94 ° C per 1 min, e 30 cicli di 94 ° C per 30 sec, 55 ° C per 30 sec e 68 ° C per 1 min. Esaminare il prodotto di PCR mediante elettroforesi su gel di agarosio all&#39;1%. Poola maggior parte della cassetta degli ampliconi km r da 10 individuali PCR purificato dal kit QIAquick purificazione PCR. Regolare la concentrazione amplicone a 10 ng / mL. </li><li> Per ottenere il lineare finale amplicone PCR ricombinante, tre ampliconi PCR vengono combinati tra microlitri 1 (in quantità circa pari-molare) in una piastra PCR così come templato PCR. Altri componenti della PCR è aggiunto anche 14,4 microlitri DDH 2 O, 2,5 microlitri 10xHigh Fidelity PCR Buffer, 2 ml di miscela di mm 10 dNTP, 1 ml di 50 mM Mg SO 4, 1 ml di 10 mM F1, 1 ml di 10 microM R3, 0,1 microlitri Platinum Taq DNA polimerasi ad alta fedeltà. Amplificazione PCR viene eseguita a 94 ° C per 2 min, 30 cicli di 94 ° C per 30 sec a 55 ° C per 30 sec e 68 ° C per 3,5 min, ed infine 68 ° C per 4 min. </li><li> Esaminare gli ampliconi della PCR su gel di agarosio. Purificare e quantificare gli ampliconi della PCR come descritto sopra. Congelare gli ampliconi della PCR ricombinati a -20 ° C. </li></ol> 3. Comcompetente Celle Preparazione <ol><li> Todd Hewitt Broth è preparato, pH regolato a 7,6 con NaOH 10 N, riscaldato a ebollizione e poi raffreddata a temperatura ambiente e sterilizzato usando polistirene 0,22 micron filtro 4. Aggiungere 300 microlitri inattivato al calore cavallo sieri (concentrazione finale di 2,5%) a 11,7 ml di brodo Todd Hewitt in 15 ml tubo conico per compensare TH + HS media. Aliquotare TH + HS medie in 2 ml e 10 ml in provette. </li><li> Inoculare 5 l di brodo S. sanguinis SK36 congelati a -80 ° C in 2 ml di terreno TH + HS e incubare la coltura durante la notte con capping ermeticamente a 37 ° C, accompagnata da pre-incubando il 10 ml-TH + tubo HS. </li><li> Dopo una notte, trasferire 50 microlitri cultura in 10 ml TH + HS e incubare la provetta a 37 ° C per 3 ore (corrispondente a OD 660 di 0,07-0,08), immediatamente utilizzando per la trasformazione. </li></ol> 4. Trasformazione cellulare e selezione antibiotica <ol><li> Aggiungere 2 ml di 70 ng S. sanguinis SK36 compeTence peptide stimolante (CSP) e 2 microlitri lineare amplicone PCR ricombinante (~ 50 ng) per provette Eppendorf a 96-well blocco e li pre-riscaldare a 37 ° C. Trasferire 330 ml di 3 ore-incubato SK36 cultura in ogni provetta. Incubare a 37 ° C per 1 ora. Sostituire il DNA con sterile DDH 2 O come controllo. </li><li> Posizionare il blocco di ghiaccio e la diffusione 100 pl di ogni trasformazione in Brain Heart Infusion (BHI) piastra di agar con 500 mg / ml di kanamicina. Incubare le piastre a 37 ° C per 2 d in condizioni microaerobiche. </li></ol> 5. Conferma Mutant e stoccaggio <ol><li> Per ciascun mutante di sostituzione, casualmente prendere due singole colonie, inoculare la colonia in 5 ml BHI contenente 500 ug / ml di kanamicina e incubare l&#39;inoculo microaerobically notte a 37 ° C. Crioconservare ciascuna cultura in 30% glicerolo a -80 ° C </li><li> Per esaminare se il mutante contenente la sostituzione del gene previsto, eseguire colonia PCR per ciascun mutante con F1 e R3primer in piastra a 96 pozzetti PCR. Circa 1-microlitri dalla coltura durante la notte colonia individuale viene usato come stampo di DNA in 25 microlitri PCR-amplificazione reazione. PCR viene eseguita a 94 ° C per 5 min, 35 cicli di 94 ° C per 30 sec, 55 ° C per 30 sec e 68 ° C per 3,5 min, ed infine 68 ° C per 4 min. </li><li> Per identificare con precisione a doppia banda mutanti o contaminante ampliconi PCR, esame della PCR mediante elettroforesi per 4 ore su&gt; 12 cm al 2% su gel di agarosio con colorazione con etidio bromuro. In questa condizione elettroforesi su gel di agarosio, le ampliconi con ≥ 100 bp differenza sono stati chiaramente identificati. Quando le bande risultanti dalla amplificazione della cassetta r chilometri e di tipo selvatico gene sono anticipati per differire di &lt;100 bp, viene utilizzato un primer T1 interna per determinare se un gene di tipo selvatico può essere rilevato mediante PCR. </li><li> Ad ulteriore conferma l&#39;eliminazione, gli ampliconi sono purificati da PureLink 96 kit di purificazione PCR e sequenziati utilizzando il primer P1 chesi lega alla cassetta r chilometri. Mantieni solo mutanti corrette confermate mediante sequenziamento. </li></ol>

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

Nessun conflitto di interessi dichiarati.

Per ridurre al minimo i possibili effetti polari della sostituzione di un gene esogeno gene mirata con antibiotici sui geni vicini, due passi vengono presi mentre innesco iniziale di progettazione. Per la maggior parte dei geni eliminati, il primer R1 e F3 sono progettati per eliminare la regione codificante da 6 bp dopo il codone di inizio di 30 bp prima del codone di stop. Gli ultimi 30 paia di basi sono conservati per proteggere potenziale sito di legame ribosomiale utilizzato dal gene adiacente valle. La regione tra...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; Nomi</strong</td&gt;<td<strong&gt; Azienda</strong</td&gt;<td<strong&gt; Catalogo #</strong</td&gt;<td<strong&gt; Commenti (opzionale)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; Primer F2</td&gt;<td&gt; Integrated DNA Technologies</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<td&gt; Primer R2</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<td&gt; Primer F2P</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<td&gt; Primer P1</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<td&gt; Primer P2</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; Primer 5 &#39;end_R1_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; Primer 5 &#39;end_F3_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; Primer 5 &#39;end_R1p_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; Sequenza: NH2-DLRGVPNPWGWIFGR-COOH</td&gt;</tr&gt;<tr&gt;<td&gt; DNA polimerasi</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; 11304-102</td&gt;<td&gt; Platinum Taq DNA polimerasi ad alta fedeltà</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; New England Biolabs Inc</td&gt;<td&gt; R0101S</td&gt;<td&gt; Con enzimi di restrizione</td&gt;</tr&gt;<tr&gt;<td&gt; Agar</td&gt;<td&gt; Bioanalytical americana</td&gt;<td&gt; AB01185</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Agarosio</td&gt;<td&gt; Promega</td&gt;<td&gt; V3125</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 237500</td&gt;<td&gt; Cervello Infusion Cuore</td&gt;</tr&gt;<tr&gt;<td&gt; Siero di cavallo</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; SH3007403</td&gt;<td&gt; Siero di cavallo</td&gt;</tr&gt;<tr&gt;<td&gt; Km</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; BP906-5</td&gt;<td&gt; Kanamicina</td&gt;</tr&gt;<tr&gt;<td&gt; TH brodo</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 249240</td&gt;<td&gt; Brodo Todd Hewitt</td&gt;</tr&gt;<tr&gt;<td&gt; PureLink 96</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; K310096</td&gt;<td&gt; PureLink 96 kit di purificazione PCR</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; Qiagen</td&gt;<td&gt; 28106</td&gt;<td&gt; QIAquick PCR Purification Kit</td&gt;</tr&gt;<tr&gt;<td&gt; Filtro</td&gt;<td&gt; Corning</td&gt;<td&gt; 431117</td&gt;<td&gt; 0,22 micron filtro polistirolo</td&gt;</tr&gt;<tr&gt;<td&gt; Sistema Anoxomat</td&gt;<td&gt; Mart Microbiologia bv</td&gt;<td&gt; Anoxomat Mark II</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Centrifuga da banco</td&gt;<td&gt; Thermo Scientific</td&gt;<td&gt; 75004377</td&gt;<td&gt; Sorvall leggenda RT plus micropiastra rotore</td&gt;</tr&gt;<tr&gt;<td&gt; Gel Documentazione</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc-It 210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Incubatore</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; 11-690-625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; Labnet di Gel XL</td&gt;<td&gt; Labnet</td&gt;<td&gt; E0160</td&gt;<td&gt; Labnet di Gel XL</td&gt;</tr&gt;<tr&gt;<td&gt; Microcentrifuga</td&gt;<td&gt; Eppendorf</td&gt;<td&gt; 22621408</td&gt;<td&gt; Microcentrifuga 5415 R</td&gt;</tr&gt;<tr&gt;<td&gt; Pipette multicanale</td&gt;<td&gt; Thermo Scientfic</td&gt;<td&gt; 4661040, 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; Termociclatore</td&gt;<td&gt; Applied Biosystems Inc.</td&gt;<td&gt; N805-0200</td&gt;<td&gt; GeneAmp PCR System 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Trasposone mutagenesi e singolo gene delezione sono due metodi applicati nel genoma knockout gene in 1,2 batteri. Sebbene mutagenesi trasposone è meno tempo, meno costosa, e non richiede informazioni genoma completata, vi sono due punti deboli in questo metodo: (1) la possibilità di un mutanti disparati nella libreria misto mutante che contro-seleziona mutanti con concorrenza diminuita; e (2) la possibilità di inattivazione genica parziale in cui i geni non interamente perdono la loro funzione dopo l&#39;inserimento di un trasposone. Singolo gene delezione analisi può compensare gli svantaggi associati con mutagenesi trasposone. Per migliorare l&#39;efficienza del genoma delezione singolo gene, si cerca di stabilire un high-throughput tecnica di genome-wide delezione del gene singolo utilizzando Streptococcus sanguinis come organismo modello. Ogni delezione del gene costruire in S. sanguinis genoma è progettata per comprendere 1-Kb a monte del gene target, l&#39;APHA-3 gene, che codifica per proteine ​​resistenza alla kanamicina, e 1-kb a valle del gene bersaglio. Tre serie di primer F1/R1, F2/R2 e F3/R3, rispettivamente, sono stati progettati e sintetizzati in un formato a 96 pozzetti per piastra PCR amplificazioni di questi tre componenti di ciascuna delezione costruire. Primer R1 e F3 contengono 25-bp sequenze che sono complementari alle regioni del gene-3 APHA a fine loro 5 &#39;. Una grande scala di amplificazione PCR del gene-3 APHA viene eseguita una volta per tutte la creazione di un singolo gene costrutti di delezione. Il promotore del gene APHA-3 è inizialmente escluso per minimizzare il potenziale effetto polare di cassette kanamicina. Per creare i costrutti genici delezione, alta produttività amplificazione PCR e purificazione sono eseguite in un formato a 96 pozzetti piastra. Un lineare amplicone PCR ricombinante per ogni gene delezione sarà composta da quattro reazioni PCR utilizzando alta fedeltà DNA polimerasi. Il expon inizialefase di crescita preferenziale di S. sanguinis coltivati ​​in brodo Todd Hewitt integrato con 2,5% siero di cavallo inattivato viene usato per aumentare la competenza per la trasformazione di PCR-costrutti ricombinanti. In questa condizione, fino al 20% di S. sanguinis cellule possono essere trasformate utilizzando ~ 50 ng di DNA. Sulla base di questo approccio, 2048 mutanti con singolo gene delezione sono stati infine ottenuti dai 2.270 geni in S. sanguinis esclusi quattro ORF del gene contenute interamente all&#39;interno ORF altri S. sanguinis SK36 e 218 potenziali geni essenziali. La tecnica sulla creazione di costrutti di delezione del gene è un throughput elevato e potrebbe essere facile da usare in tutto il genoma gene delezioni singole per i batteri trasformabili.

Dopo l&#39;amplificazione PCR utilizzando primer F1 e R1, R3 e F3 e, di circa 1 kb a monte ea valle di ciascuna S. sanguinis gene sono stati ottenuti in formato a 96 pozzetti, rispettivamente (Figura 2A). Sotto le condizioni di PCR utilizzando primer disegnati e, un prodotto specifico è stato amplificato da S. sanguinis DNA genomico in ciascuna reazione PCR. Questo risultato indicato i primer erano altamente specifico per gli obiettivi di S. sanguinis. Tramite PCR re-amplific...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Un efficiente genoma unico metodo di mutazione del gene è stata stabilita utilizzando<em&gt; Streptococcus sanguinis</em&gt; Come organismo modello. Questo metodo ha ottenuto tramite PCR ad alto throughput ricombinanti e trasformazioni.

Genome-wide gene delezioni in<em&gt; Streptococcus sanguinis</em&gt; Da Throughput PCR ad alta

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

16.5K Views.  Virginia Commonwealth University. Un efficiente genoma unico metodo di mutazione del gene è stata stabilita utilizzando Streptococcus sanguinis Come organismo modello. Questo metodo ha ottenuto tramite PCR ad alto throughput ricombinanti e trasformazioni.

Video: Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Genoma Analisi mediante ChIP per identificare Isoform obiettivi specifici per Gene

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

Ricerca

Biologia

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

Genome-Wide Screen per le destinazioni miRNA utilizzo di target Biblioteca MISSION ID

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. elegans, gene function can be knocked down simply and efficiently by feeding worms with bacteria expressing a dsRNA corresponding to a specific gene 1. While the creation of libraries of RNAi clones covering most of the C. elegans genome 2,3 opened the way for true functional genomic studies (see for example 4-7), most established methods are laborious. Moy and colleagues have developed semi-automated protocols that facilitate genome-wide screens 8. The approach relies on microscopic imaging and image analysis. 
	Here we describe an alternative protocol for a high-throughput genome-wide screen, based on robotic handling of bacterial RNAi clones, quantitative analysis using the COPAS Biosort (Union Biometrica (UBI)), and an integrated software: the MBioLIMS (Laboratory Information Management System from Modul-Bio) a technology that provides increased throughput for data management and sample tracking. The method allows screens to be conducted on solid medium plates. This is particularly important for some studies, such as those addressing host-pathogen interactions in C. elegans, since certain microbes do not efficiently infect worms in liquid culture.
	We show how the method can be used to quantify the importance of genes in anti-fungal innate immunity in C. elegans. In this case, the approach relies on the use of a transgenic strain carrying an epidermal infection-inducible fluorescent reporter gene, with GFP under the control of the promoter of the antimicrobial peptide gene nlp 29 and a red fluorescent reporter that is expressed constitutively in the epidermis. The latter provides an internal control for the functional integrity of the epidermis and nonspecific transgene silencing9. When control worms are infected by the fungus they fluoresce green. Knocking down by RNAi a gene required for nlp 29 expression results in diminished fluorescence after infection. Currently, this protocol allows more than 3,000 RNAi clones to be tested and analyzed per week, opening the possibility of screening the entire genome in less than 2 months.

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

We describe a protocol using C. elegans and RNAi feeding libraries that allows automated measurement of multiple parameters such as fluorescence, size and opacity of individual worms in a population. We give one example of a screen to identify genes involved in anti-fungal innate immunity in C. elegans.

Quantitative e automatica High-throughput Genome-wide Schermi RNAi in C. elegans</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

Il processo di Green Monster per la generazione di ceppi di lieviti trasporto gene delezioni multiple

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Profiling cellule staminali embrionali umane individuale mediante RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often depend on its interactions with other proteins. Here, we describe a protocol for the yeast protein-fragment complementation assay (PCA), a powerful method to detect direct and proximal associations between proteins in living cells. The interaction between two proteins, each fused to a dihydrofolate reductase (DHFR) protein fragment, translates into growth of yeast strains in presence of the drug methotrexate (MTX). Differential fitness, resulting from different amounts of reconstituted DHFR enzyme, can be quantified on high-density colony arrays, allowing to differentiate interacting from non-interacting bait-prey pairs. The high-throughput protocol presented here is performed using a robotic platform that parallelizes mating of bait and prey strains carrying complementary DHFR-fragment fusion proteins and the survival assay on MTX. This protocol allows to systematically test for thousands of protein-protein interactions (PPIs) involving bait proteins of interest and offers several advantages over other PPI detection assays, including the study of proteins expressed from their endogenous promoters without the need for modifying protein localization and for the assembly of complex reporter constructs.

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

Proteins interact with each other and these interactions determine in a large part their functions. Protein interaction partners can be identified at high-throughput in vivo using a yeast fitness assay based on the dihydrofolate reductase protein-fragment complementation assay (DHFR-PCA).

Genome-wide proteina-proteina interazione Screening per Protein-frammento Complementation Assay (PCA) in cellule viventi

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Screening ad alto rendimento per i modulatori chimici di Genes post-trascrizionale regolamentati

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic chromosome, synIII1, and one synthetic chromosome arm, synIXR2, have been constructed and their in vivo function validated in the absence of the corresponding wild type chromosomes. An important design feature of Sc2.0 chromosomes is the introduction of PCRTags, which are short, re-coded sequences within open reading frames (ORFs) that enable differentiation of synthetic chromosomes from their wild type counterparts. PCRTag primers anneal selectively to either synthetic or wild type chromosomes and the presence/absence of each type of DNA can be tested using a simple PCR assay. The standard readout of the PCRTag assay is to assess presence/absence of amplicons by agarose gel electrophoresis. However, with an average PCRTag amplicon density of one per 1.5 kb and a genome size of ~12 Mb, the completed Sc2.0 genome will encode roughly 8,000 PCRTags. To improve throughput, we have developed a real time PCR-based detection assay for PCRTag genotyping that we call qPCRTag analysis. The workflow specifies 500 nl reactions in a 1,536 multiwell plate, allowing us to test up to 768 PCRTags with both synthetic and wild type primer pairs in a single experiment.

Designer chromosomes of the Synthetic Yeast Genome project, Sc2.0, can be distinguished from their native counterparts using a PCR-based genotyping assay called PCRTagging, which has a presence/absence endpoint. Here we describe a high-throughput real time PCR detection method for PCRTag genotyping.

Analisi qPCRTag - A High Throughput, Real Time PCR Assay per Sc2.0 genotipizzazione

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to dose-limiting toxicity and many adverse side effects. Targeting the genome with sequence-specific small molecules may enable molecules with increased therapeutic index and fewer off-target effects. N-methylpyrrole/N-methylimidazole polyamides are molecules that can be rationally designed to target specific DNA sequences with exquisite precision. And unlike most natural transcription factors, polyamides can bind to methylated and chromatinized DNA without a loss in affinity. The sequence specificity of polyamides has been extensively studied in vitro with cognate site identification (CSI) and with traditional biochemical and biophysical approaches, but the study of polyamide binding to genomic targets in cells remains elusive. Here we report a method, the crosslinking of small molecules to isolate chromatin (COSMIC), that identifies polyamide binding sites across the genome. COSMIC is similar to chromatin immunoprecipitation (ChIP), but differs in two important ways: (1) a photocrosslinker is employed to enable selective, temporally-controlled capture of polyamide binding events, and (2) the biotin affinity handle is used to purify polyamide&#8211;DNA conjugates under semi-denaturing conditions to decrease DNA that is non-covalently bound. COSMIC is a general strategy that can be used to reveal the genome-wide binding events of polyamides and other genome-targeting chemotherapeutic agents.

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Identifying the direct targets of genome-targeting molecules remains a major challenge. To understand how DNA-binding molecules engage the genome, we developed a method that relies on crosslinking of small molecules to isolate chromatin (COSMIC).

Mappatura Genome-wide di Drug-DNA interazioni nelle celle con COSMIC (reticolazione di piccole molecole per isolare cromatina)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID-seq: Genome-wide Mappatura delle interazioni proteina-DNA da High Throughput Sequencing di Adenina-metilato frammenti di DNA

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...