Diese Arbeit wurde durch Zuschüsse R01DE018138 von den National Institutes of Health (PX) und zum Teil unterstützt durch Virginia Commonwealth University Presidential Forschung Incentive Program (PRIP) 144602-3 (PX). Wir danken Drs. Lei Chen, Yuetan Dou und Xiaojing Wang für die Unterstützung mit dem Bau der genomweiten Mutanten. Wir danken auch dem DNA Core Facility an der Virginia Commonwealth University für die DNA-Sequenzierung.

Ein. Primer Design <ol><li> Grundierungen werden unter Verwendung im Haus der Script basiert auf der S. sanguinis SK36 Genomsequenz. Drei Sätze von Primern, F1/R1, F2/R2 und F3/R3 sind zur Amplifikation des 1-kb stromaufwärts Sequenz des Ziel-Gens, das aphA-3 kodierenden Gens Kanamycinresistenz (Km r) Protein 3 und der 1 ausgelegt -kb stromabwärts Sequenz des Zielgens, bzw. (Abbildung 1). Unter dieser Primer sind F1 und R3 entwickelt mit ePrimer3 im EMBOSS Suite von Programmen ( <a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html</a> ) an flankierenden Regionen stromaufwärts oder stromabwärts zu verstärken des Ziels Gen. Genspezifischen Primern, R1 und F3, werden basierend auf der 5 &#39;und 3&#39;-Sequenzen des Zielgens gestalten. R1 und F3 Primer enthalten 25-bp-Adapter-Sequenzen an ihrem 5&#39;-Ende, die komplementär zu dem aphA-3 sindGen. Die Schmelztemperaturen von jedem Primer wurden entwickelt, um so nah wie möglich auf 60 ° C um die Verwendung eines einheitlichen Glühtemperatur für alle PCR-Reaktionen in 96-Well-Format zu ermöglichen. </li><li> F1, R1, R3 und F3 Primer werden in 96-Well-Platten auf ein Gen Reihenfolge basierend synthetisiert. Jede Platte enthält eine Art von Primer im gleichen Gen sortiert. Verdünnt den Primer in 96-Well-Platte arbeitet Primer zu einer Endkonzentration von 10 uM zur PCR-Amplifikation unter Verwendung einer Mehrkanalpipette. </li></ol> 2. High-throughput PCR-Amplifikation und Reinigung <ol><li> Mit hohem Durchsatz amplifizieren 1-kb stromaufwärts oder stromabwärts des Ziels S. sanguinis Gene, montieren ein PCR-Cocktail Mischung auf Eis in einem 15-ml konischen Röhrchen mit 1640 ul ddH 2 O, 250 ul 10xHigh Fidelity PCR Buffer, 200 ul 10 mM dNTP-Gemisch, 100 ul 50 mM MgSO 4, 100 ul 10 ng / ul S. sanguinis SK36 genomische DNA und 10 ul Platinum Taq DNA polymerase High Fidelity und Transfer 23 ul des Gemisches in jedes Well auf 96-well PCR-Platte mit einer Mehrkanalpipette. Übertragen 1 ul jeder F1 und R1 (oder F3 und R3) aus den 10 uM arbeiten Primer Platten der PCR-Platte mit Mehrkanalpipette. Abzudichten und die PCR-Platte durchzuführen Amplifikation bei 94 ° C für 1 min und 30 Zyklen von 94 ° C für 30 sec, 54 ° C für 30 sec und 68 ° C für 1,5 min. </li><li> Bereiten 1% Agarosegel mit Ethidiumbromid mit 48 Kavitäten Montage Mehrkanalpipette loading. Mix 4 ul PCR-Produkt mit 1 ul 5xDNA Ladepuffer auf 96-Well-Platte und laden Sie die Proben auf Agarosegel unter Verwendung eines 10-ul Mehrkanalpipette. Führen Elektrophorese bei 135 V für 30 min. Untersuchen Sie das Band auf Gel unter UVP Dokumentation und Analyse-System. </li><li> Reinigen die PCR-Produkte durch PureLink 96 PCR Purification Kit unter Verwendung von Zentrifugation nach der Anleitung des Herstellers. Zum Eluieren DNA, fügen Sie 40 ul sterilem ddH 2 O zum Wohl des binding Platte. </li><li> Zufallsprinzip auswählen mehreren gereinigten Amplifikate auf der Platte, um die DNA-Konzentrationen mit NanoDrop Spektralphotometer prüfen. Die Konzentration der Amplikons auf Platte zu ~ 10 ng / ul. </li><li> Ein Plasmid enthaltenden Km r Kassette mit EcoR I verdaut als PCR-Template. Die verdaute Plasmid wird durch QIAquick PCR Purification Kit gereinigt und das lineare Plasmid-DNA wird auf DNA-Endkonzentration 10 ng / ul eingestellt. Montieren Sie 25 ul Mischung Kilometer r Kassette Amplikon einschließlich 16,4 ul ddH 2 O, 2,5 ul 10xHigh Fidelity PCR Buffer, 2 ul 10 mM dNTP-Gemisch, 1 ul 50 mM Mg SO 4, 1 ul 10 uM F2, 1 ul 10 uM R2, 1 ul lineare Plasmid-DNA und 0,1 ul Platinum Taq DNA Polymerase High Fidelity. Eine PCR-Amplifikation bei 94 ° C für 1 min und 30 Zyklen von 94 ° C für 30 sec, 55 ° C für 30 sec und 68 ° C für 1 min. Untersuchen des PCR-Produkts durch Gelelektrophorese an 1% Agarose. Poola Großteil des Km r Kassette Amplikon aus 10 einzelnen PCR gereinigte von QIAquick-PCR. Passen Sie die Amplikon-Konzentration auf 10 ng / ul. </li><li> Um die endgültige lineare rekombinante PCR Amplikon erhalten, werden drei PCR Amplikons mit je 1 ul (in fast gleich-molaren Mengen) in ein PCR-Platte sowie die PCR-Vorlage kombiniert. Andere PCR-Komponenten, einschließlich 14,4 ul ddH 2 O, 2,5 ul 10xHigh Fidelity PCR Buffer, 2 ul 10 mM dNTP-Gemisch, 1 ul 50 mM Mg SO 4, 1 ul 10 uM F1, 1 ul 10 uM R3, 0,1 ul Platinum Taq DNA Polymerase High Fidelity. PCR-Amplifikation bei 94 ° C für 2 min, 30 Zyklen von 94 ° C für 30 sec 55 ° C durchgeführt für 30 sec und 68 ° C für 3,5 min und schließlich 68 ° C für 4 min. </li><li> Untersuchen Sie die PCR Amplifikate im Agarosegel. Läutern und Quantifizierung der PCR-Amplikons wie oben beschrieben. Einfrieren der rekombinierten PCR Amplikons bei -20 ° C. </li></ol> 3. Comzuständigen Cells Vorbereitung <ol><li> Todd-Hewitt-Bouillon hergestellt wird, auf 7,6 eingestellten pH-Wert mit 10 N NaOH, erhitzt zum Sieden und kühlt dann auf Raumtemperatur und sterilisiert unter Verwendung 0,22 um Polystyrol-Filter 4. Fügen Sie 300 ul hitzeinaktiviertem Pferdeseren (Endkonzentration 2,5%) auf 11,7 ml Todd Hewitt Broth in 15-ml konischen Röhrchen, um Make-up TH + HS Medium. Aliquot TH + HS Medium in 2 ml und 10 ml in Tuben. </li><li> Beimpfen 5 ul Lager S. sanguinis SK36 bei -80 ° C in 2 ml TH + HS Medium eingefroren und inkubiere die Kultur über Nacht mit Capping fest bei 37 ° C, durch Vorinkubieren der 10 ml-TH + HS Rohr begleitet. </li><li> Nachdem über Nacht übertragen 50 ul Kultur in 10 ml TH + HS und inkubieren des Rohres bei 37 ° C für 3 Stunden (entspricht OD 660 von 0,07 bis 0,08), sofort mit der Transformation. </li></ol> 4. Zelltransformation und Antibiotika-Selektion <ol><li> Add 2 ul 70 ng S. sanguinis SK36 Kompetenztenz stimulierende Peptid (CSP) und 2 ul linearen rekombinanten PCR Amplikon (~ 50 ng) in Eppendorf-Röhrchen auf 96-Well-Block und Pre-warm sie bei 37 ° C. Übertragen 330 ul 3 hr-inkubierten SK36 Kultur in jedes Röhrchen. Bei 37 ° C für 1 Stunde. Ersetzen DNA mit sterilem ddH 2 O als Kontrolle. </li><li> Legen Sie den Block auf Eis und verteilt 100 ul jeder Transformation auf Hirn-Herz-Infusion (BHI)-Agar-Platte mit 500 ug / ml Kanamycin. Die Inkubation erfolgt bei 37 ° C für 2 d unter mikroaeroben Bedingungen. </li></ol> 5. Mutant Bestätigung und Lagerung <ol><li> Für jeden Ersatz Mutante, zufällig abholen 2 einzelnen Kolonien, impfen die Kolonie in 5 ml BHI mit 500 ug / ml Kanamycin und inkubieren das Inokulum mikroaerob über Nacht bei 37 ° C. Kryokonservierung jede Kultur in 30% Glycerin bei -80 ° C </li><li> Um zu untersuchen, ob die Mutante, die die erwartete Gen-Ersatz, führen Kolonie-PCR für jede Mutante mit F1 und R3Primer in 96-well PCR-Platte. Etwa 1 ul-Übernachtkultur von einzelnen Kolonie wird als DNA-Matrize in 25 ul-PCR-Amplifikationsreaktion verwendet. PCR wird bei 94 ° C für 5 min, 35 Zyklen von 94 ° C für 30 sec, 55 ° C für 30 Sekunden durchgeführt und 68 ° C für 3,5 min und schließlich 68 ° C für 4 min. </li><li> Zur genauen Bestimmung Doppelbandpresse Mutanten oder Verunreinigung PCR Amplikon, prüft die PCR-Amplicon durch Elektrophorese für 4 h auf&gt; 12 cm lang 2% Agarosegel mit Ethidiumbromid. Unter diesem Agarosegelelektrophorese Zustand, wurden alle Amplikons mit ≥ 100 bp Unterschied eindeutig identifiziert. Wenn Bands aus Amplifikation der Km r Kassette und dem Wildtyp-Gen werden voraussichtlich durch &lt;100 bp, ein interner T1 Primer verwendet, um festzustellen, ob eine Wildtyp-Gens durch PCR nachgewiesen werden kann unterschiedlich sein. </li><li> Zur weiteren bestätigen Sie den Löschvorgang werden die Fragmente durch PureLink 96 PCR Purification Kit gereinigt und sequenziert mit dem P1-Primer,bindet an das Km r Kassette. Halten einzig richtige Mutanten durch Sequenzierung bestätigt. </li></ol>

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

Keine Interessenskonflikte erklärt.

Um die möglichen polaren Effekte der Ersatz eines Zielgens mit exogenen Antibiotika-Gen auf benachbarten Genen zu minimieren, sind zwei Schritte gemacht, während erste Primer entwerfen. Für die meisten der Gene gelöscht werden der Primer R1 und F3 entworfen, um die codierende Region von 6 bp nach dem Startcodon und 30 bp vor dem Stopcodon löschen. Die letzten 30 Basenpaare zurückgehalten werden, um potenzielle ribosomale Bindungsstelle durch das benachbarte, nachgeschaltete Gen verwendet schützen. Das verbliebene...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; Namen</strong</td&gt;<td<strong&gt; Unternehmen</strong</td&gt;<td<strong&gt; Catalog #</strong</td&gt;<td<strong&gt; Kommentare (optional)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; Primer F2</td&gt;<td&gt; Integrated DNA Technologies</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<td&gt; Primer R2</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<td&gt; Primer F2p</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<td&gt; Primer P1</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<td&gt; Primer P2</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; Primer 5 &#39;end_R1_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; Primer 5 &#39;end_F3_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; Primer 5 &#39;end_R1p_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; Sequenz: NH2-DLRGVPNPWGWIFGR-COOH</td&gt;</tr&gt;<tr&gt;<td&gt; DNA Polymerase</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; 11304-102</td&gt;<td&gt; Platinum Taq DNA Polymerase High Fidelity</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; New England Biolabs Inc</td&gt;<td&gt; R0101S</td&gt;<td&gt; Restriktionsenzym</td&gt;</tr&gt;<tr&gt;<td&gt; Agar</td&gt;<td&gt; American Bioanalytical</td&gt;<td&gt; AB01185</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Agarose</td&gt;<td&gt; Promega</td&gt;<td&gt; V3125</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 237500</td&gt;<td&gt; Brain Heart Infusion</td&gt;</tr&gt;<tr&gt;<td&gt; Pferdeserum</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; SH3007403</td&gt;<td&gt; Pferdeserum</td&gt;</tr&gt;<tr&gt;<td&gt; Km</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; BP906-5</td&gt;<td&gt; Kanamycin</td&gt;</tr&gt;<tr&gt;<td&gt; TH Brühe</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 249240</td&gt;<td&gt; Todd Hewitt Broth</td&gt;</tr&gt;<tr&gt;<td&gt; PureLink 96</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; K310096</td&gt;<td&gt; PureLink 96 PCR Purification Kit</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; Qiagen</td&gt;<td&gt; 28106</td&gt;<td&gt; QIAquick PCR Purification Kit</td&gt;</tr&gt;<tr&gt;<td&gt; Filter</td&gt;<td&gt; Corning</td&gt;<td&gt; 431117</td&gt;<td&gt; 0,22 um Polystyrol-Filter</td&gt;</tr&gt;<tr&gt;<td&gt; Anoxomat-System</td&gt;<td&gt; Mart Microbiology bv</td&gt;<td&gt; Anoxomat Mark II</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Tischzentrifuge</td&gt;<td&gt; Thermo Scientific</td&gt;<td&gt; 75004377</td&gt;<td&gt; Sorvall Legend RT Plus Mikrotiterplatten Rotors</td&gt;</tr&gt;<tr&gt;<td&gt; Gel-Dokumentation</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc-It 210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Incubator</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; 11-690-625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; Labnet die Gel XL</td&gt;<td&gt; Labnet</td&gt;<td&gt; E0160</td&gt;<td&gt; Labnet die Gel XL</td&gt;</tr&gt;<tr&gt;<td&gt; Microcentrifuge</td&gt;<td&gt; Eppendorf</td&gt;<td&gt; 22621408</td&gt;<td&gt; Mikrozentrifuge 5415 R</td&gt;</tr&gt;<tr&gt;<td&gt; Mehrkanalpipetten</td&gt;<td&gt; Thermo Scientfic</td&gt;<td&gt; 4661040, 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; Thermal Cycler</td&gt;<td&gt; Applied Biosystems Inc.</td&gt;<td&gt; N805-0200</td&gt;<td&gt; GeneAmp PCR-System 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Transposon-Mutagenese-und Single-Gen-Deletion gibt zwei Methoden in genomweiten Gen-Knockout in Bakterien 1,2 angewendet. Obwohl Transposon-Mutagenese ist weniger zeitaufwendig, weniger kostspielig und erfordert keine abgeschlossene Genom Informationen gibt es zwei Schwachstellen in diesem Verfahren: (1) die Möglichkeit einer unterschiedlichen Mutanten in der gemischten Mutantenbibliothek daß der Zähler-wählt Mutanten mit verminderter Wettbewerb; und (2) die Möglichkeit eines teilweisen Geninaktivierung wobei Gene nicht vollständig verlieren ihre Funktion nach dem Einsetzen eines Transposons. Single-Gen-Deletion Analyse kann für die Nachteile, die mit der Transposon-Mutagenese zu kompensieren. Um die Effizienz der genomweiten einzigen Gen-Deletion zu verbessern, versuchen wir, einen hohen Durchsatz Technik für genomweite einzigen Gen-Deletion mit Streptococcus sanguinis als Modellorganismus zu etablieren. Jedes Gendeletion in S. konstruieren sanguinis Genom soll 1 umfassen-Kb stromaufwärts des Zielgens, das aphA-3-Gen, kodierend Kanamycinresistenz Protein und 1-kb stromabwärts des Zielgens. Drei Sätze von Primern F1/R1, F2/R2 und F3/R3 sind jeweils entworfen und synthetisiert in einer 96-Well-Platte Format für PCR-Amplifikationen von diesen drei Komponenten jedes Deletion konstruieren. Primer R1 und F3 enthalten 25-bp-Sequenzen, die komplementär zu Regionen der aphA-3-Gen an ihrem 5&#39;-Ende sind. Eine große Skala PCR-Amplifikation des aphA-3-Gen wird einmal für die Erstellung aller Single-Gendeletion Konstrukte durchgeführt. Der Promotor aphA-3-Gen wird zunächst ausgeschlossen, um das Potenzial polaren Effekt Kanamycinkassette minimieren. Um die Gendeletion Konstrukte zu erzeugen, werden Hochdurchsatz-PCR-Amplifikation und Reinigung in einem 96-Well-Platten-Format durchgeführt wird. Eine lineare rekombinante PCR Amplikon für jedes Gen Löschung wird nach oben durch vier PCR-Reaktionen mit High-Fidelity DNA-Polymerase erfolgen. Die anfängliche exponential Wachstumsphase S. sanguinis in Todd-Hewitt-Brühe kultiviert, ergänzt mit 2,5% inaktiviertem Pferdeserum wird verwendet, um die Zuständigkeit für die Transformation von PCR-rekombinante Konstrukte zu erhöhen. Unter dieser Bedingung bis zu 20% von S. sanguinis transformierten Zellen können unter Verwendung ~ 50 ng der DNA werden. Basierend auf diesem Ansatz wurden 2.048 Mutanten mit Single-Gen-Deletion letztendlich von den 2.270 Gene in S. erhalten sanguinis außer vier Gen-ORFs, die vollständig innerhalb anderen ORFs in S. sanguinis SK36 und 218 potentielle essentiellen Gene. Die Technik zur Erstellung von Gen-Deletion Konstrukte ist mit hohem Durchsatz und könnte leicht in genomweiten Gen Löschungen für alle transformable Bakterien verwenden.

Nach der PCR-Amplifikation unter Verwendung der Primer und R1 F1 und F3 und R3, etwa 1-kb stromaufwärts und stromabwärts jeder S. sanguinis Gen wurden in 96-Well-Format bzw. (2A) erhalten. Unter unserer PCR-Bedingungen und mit entworfenen Primern wurde ein bestimmtes Produkt aus S. verstärkt sanguinis genomischen DNA in jeder PCR-Reaktion. Dieses Ergebnis zeigt die Primer waren sehr spezifisch für die Ziele der S. sanguinis. Durch PCR-Amplifikation mit erneute Pri...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Eine effiziente genomweiten Gen-Mutation Methode ermittelt worden<em&gt; Streptococcus sanguinis</em&gt; Als Modellorganismus. Diese Methode wurde über einen hohen Durchsatz rekombinanten PCRs und Transformationen erreicht.

Genomweiten Gen-Deletionen in<em&gt; Streptococcus sanguinis</em&gt; Von High Throughput PCR

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

16.5K Aufrufe.  Virginia Commonwealth University. Eine effiziente genomweiten Gen-Mutation Methode ermittelt worden Streptococcus sanguinis Als Modellorganismus. Diese Methode wurde über einen hohen Durchsatz rekombinanten PCRs und Transformationen erreicht.

Serie: Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis of Aminoacylation (Charging) Levels of tRNA Using Microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both prokaryotic and eukaryotic cells lead to translational regulation which is a major cellular mechanism of stress response. Familiar examples are the stringent response in E. coli and the Gcn2 stress response pathway in yeast ([2-6]). Recent work in E. coli and S. cerevisiae have shown that tRNA charging patterns are highly dynamic and depends on the type of stress experienced by cells [1, 6, 7]. The highly dynamic, variable nature of tRNA charging makes it essential to determine changes in tRNA charging levels at the genomic scale, in order to fully elucidate cellular response to environmental variations. In this review we present a method for simultaneously measuring the relative charging levels of all tRNAs in S. cerevisiae . While the protocol presented here is for yeast, this protocol has been successfully applied for determining relative charging levels in a wide variety of organisms including E. coli and human cell cultures[7, 8].

Genome-wide Analysis of Aminoacylation Charging Levels of tRNA Using Microarrays

We describe a method for microarray analysis to determine relative aminoacylation levels of all tRNAs from S. cerivisiae.

Genomweite Analyse der Aminoacylierung (Charging) Ebenen der tRNA mittels Microarrays

tRNA aminoacylation, or charging, levels can rapidly change within a cell in response to the environment[1]. Changes in tRNA charging levels in both ...

Forschung

Biologie

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Genomweite Analyse mittels ChIP zu Isoform-spezifische Gene-Targets zu identifizieren

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

Genomweiten Screen für miRNA-Targets mit dem Missionsziel ID-Bibliothek

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. elegans, gene function can be knocked down simply and efficiently by feeding worms with bacteria expressing a dsRNA corresponding to a specific gene 1. While the creation of libraries of RNAi clones covering most of the C. elegans genome 2,3 opened the way for true functional genomic studies (see for example 4-7), most established methods are laborious. Moy and colleagues have developed semi-automated protocols that facilitate genome-wide screens 8. The approach relies on microscopic imaging and image analysis. 
	Here we describe an alternative protocol for a high-throughput genome-wide screen, based on robotic handling of bacterial RNAi clones, quantitative analysis using the COPAS Biosort (Union Biometrica (UBI)), and an integrated software: the MBioLIMS (Laboratory Information Management System from Modul-Bio) a technology that provides increased throughput for data management and sample tracking. The method allows screens to be conducted on solid medium plates. This is particularly important for some studies, such as those addressing host-pathogen interactions in C. elegans, since certain microbes do not efficiently infect worms in liquid culture.
	We show how the method can be used to quantify the importance of genes in anti-fungal innate immunity in C. elegans. In this case, the approach relies on the use of a transgenic strain carrying an epidermal infection-inducible fluorescent reporter gene, with GFP under the control of the promoter of the antimicrobial peptide gene nlp 29 and a red fluorescent reporter that is expressed constitutively in the epidermis. The latter provides an internal control for the functional integrity of the epidermis and nonspecific transgene silencing9. When control worms are infected by the fungus they fluoresce green. Knocking down by RNAi a gene required for nlp 29 expression results in diminished fluorescence after infection. Currently, this protocol allows more than 3,000 RNAi clones to be tested and analyzed per week, opening the possibility of screening the entire genome in less than 2 months.

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

We describe a protocol using C. elegans and RNAi feeding libraries that allows automated measurement of multiple parameters such as fluorescence, size and opacity of individual worms in a population. We give one example of a screen to identify genes involved in anti-fungal innate immunity in C. elegans.

Quantitative und automatisierte Hochdurchsatz-genomweiten RNAi-Screens in C elegans</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Profiling Individuelle humanen embryonalen Stammzellen durch quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often depend on its interactions with other proteins. Here, we describe a protocol for the yeast protein-fragment complementation assay (PCA), a powerful method to detect direct and proximal associations between proteins in living cells. The interaction between two proteins, each fused to a dihydrofolate reductase (DHFR) protein fragment, translates into growth of yeast strains in presence of the drug methotrexate (MTX). Differential fitness, resulting from different amounts of reconstituted DHFR enzyme, can be quantified on high-density colony arrays, allowing to differentiate interacting from non-interacting bait-prey pairs. The high-throughput protocol presented here is performed using a robotic platform that parallelizes mating of bait and prey strains carrying complementary DHFR-fragment fusion proteins and the survival assay on MTX. This protocol allows to systematically test for thousands of protein-protein interactions (PPIs) involving bait proteins of interest and offers several advantages over other PPI detection assays, including the study of proteins expressed from their endogenous promoters without the need for modifying protein localization and for the assembly of complex reporter constructs.

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

Proteins interact with each other and these interactions determine in a large part their functions. Protein interaction partners can be identified at high-throughput in vivo using a yeast fitness assay based on the dihydrofolate reductase protein-fragment complementation assay (DHFR-PCA).

Genomweite Protein-Protein-Wechselwirkungen durch Screening Protein-Fragment Komplementierungsassay (PKA) in lebenden Zellen

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Hochdurchsatz-Screening für Chemische Modulatoren der Post-transkriptionell regulierten Genen

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic chromosome, synIII1, and one synthetic chromosome arm, synIXR2, have been constructed and their in vivo function validated in the absence of the corresponding wild type chromosomes. An important design feature of Sc2.0 chromosomes is the introduction of PCRTags, which are short, re-coded sequences within open reading frames (ORFs) that enable differentiation of synthetic chromosomes from their wild type counterparts. PCRTag primers anneal selectively to either synthetic or wild type chromosomes and the presence/absence of each type of DNA can be tested using a simple PCR assay. The standard readout of the PCRTag assay is to assess presence/absence of amplicons by agarose gel electrophoresis. However, with an average PCRTag amplicon density of one per 1.5 kb and a genome size of ~12 Mb, the completed Sc2.0 genome will encode roughly 8,000 PCRTags. To improve throughput, we have developed a real time PCR-based detection assay for PCRTag genotyping that we call qPCRTag analysis. The workflow specifies 500 nl reactions in a 1,536 multiwell plate, allowing us to test up to 768 PCRTags with both synthetic and wild type primer pairs in a single experiment.

Designer chromosomes of the Synthetic Yeast Genome project, Sc2.0, can be distinguished from their native counterparts using a PCR-based genotyping assay called PCRTagging, which has a presence/absence endpoint. Here we describe a high-throughput real time PCR detection method for PCRTag genotyping.

qPCRTag Analyse - ein hoher Durchsatz, Echtzeit-PCR-Assay für Sc2.0 Genotyping

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to dose-limiting toxicity and many adverse side effects. Targeting the genome with sequence-specific small molecules may enable molecules with increased therapeutic index and fewer off-target effects. N-methylpyrrole/N-methylimidazole polyamides are molecules that can be rationally designed to target specific DNA sequences with exquisite precision. And unlike most natural transcription factors, polyamides can bind to methylated and chromatinized DNA without a loss in affinity. The sequence specificity of polyamides has been extensively studied in vitro with cognate site identification (CSI) and with traditional biochemical and biophysical approaches, but the study of polyamide binding to genomic targets in cells remains elusive. Here we report a method, the crosslinking of small molecules to isolate chromatin (COSMIC), that identifies polyamide binding sites across the genome. COSMIC is similar to chromatin immunoprecipitation (ChIP), but differs in two important ways: (1) a photocrosslinker is employed to enable selective, temporally-controlled capture of polyamide binding events, and (2) the biotin affinity handle is used to purify polyamide&#8211;DNA conjugates under semi-denaturing conditions to decrease DNA that is non-covalently bound. COSMIC is a general strategy that can be used to reveal the genome-wide binding events of polyamides and other genome-targeting chemotherapeutic agents.

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Identifying the direct targets of genome-targeting molecules remains a major challenge. To understand how DNA-binding molecules engage the genome, we developed a method that relies on crosslinking of small molecules to isolate chromatin (COSMIC).

Genomweite Kartierung der Drug-DNA-Wechselwirkungen in Zellen mit COSMIC (Vernetzung von kleinen Molekülen, um Chromatin isolieren)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DAMiD-seq: Genomweite Mapping von Protein-DNA-Wechselwirkungen von Hochdurchsatz-Sequenzierung von Adenin-methylierten DNA-Fragmenten

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...

Genomweiten Gen-Deletionen in

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video