This work was supported by grants R01DE018138 from the National Institutes of Health (PX) and in part, by Virginia Commonwealth University Presidential Research Incentive Program (PRIP) 144602-3 (PX). We thank Drs. Lei Chen, Yuetan Dou and Xiaojing Wang for assisting with the construction of genome wide mutants. We also thank the DNA Core Facility at Virginia Commonwealth University for DNA sequencing.

1. Primer Design
<ol>
	<li>Primers are designed using in house scripts based on the S. sanguinis SK36 genome sequence. Three sets of primers, F1/R1, F2/R2, and F3/R3 are designed for amplification of the 1-kb upstream sequence of the target gene, the aphA-3 gene encoding kanamycin resistance (Kmr) protein3 and the 1-kb downstream sequence of the target gene, respectively (Figure 1). Among these primers, F1 and R3 are designed using ePrimer3 in the EMBOSS suite of programs (<a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html</a>) to amplify flanking regions upstream or downstream of the target gene. Gene specific primers, R1 and F3, are designed based upon the 5' and 3' sequences of the target gene. R1 and F3 primers contain 25-bp adaptor sequences at their 5' end that are complementary to the aphA-3 gene. The melting temperatures of each primer were designed to be as close as possible to 60 &deg;C to enable use of a uniform annealing temperature for all PCR reactions in 96-well format.</li>
	<li>F1, R1, F3 and R3 primers are synthesized in 96-well plates based on a gene order. Each plate contains one type of primers in the same gene order. Dilute the primers in 96-well working primer plate to a final concentration of 10 &mu;M for PCR amplification using a multichannel pipette.</li>
</ol>
2. High-throughput PCR Amplification and Purification
<ol>
	<li>To high-throughput amplify 1-kb upstream or downstream of the target S. sanguinis genes, assemble a PCR cocktail mixture on ice in a 15-ml conical tube containing 1640 &mu;l ddH2O, 250 &mu;l 10xHigh Fidelity PCR Buffer, 200 &mu;l of 10 mM dNTP mixture, 100 &mu;l of 50 mM MgSO4, 100 &mu;l of 10 ng/ &mu;l S. sanguinis SK36 genomic DNA and 10 &mu;l Platinum Taq DNA polymerase high fidelity and transfer 23 &mu;l of the mixture into each well on 96-well PCR plate using a multichannel pipette. Transfer 1 &mu;l of each F1 and R1 (or F3 and R3) from the 10 &mu;M working primer plates to the PCR plate using multichannel pipette. Seal the PCR plate and perform amplification at 94 &deg;C for 1 min, and 30 cycles of 94 &deg;C for 30 sec, 54 &deg;C for 30 sec and 68 &deg;C for 1.5 min.</li>
	<li>Prepare 1% agarose gel containing ethidium bromide with 48 wells fitting multichannel pipette loading. Mix 4 &mu;l PCR product with 1 &mu;l of 5xDNA loading buffer on 96-well plate and load the samples on agarose gel using a 10-&mu;l multichannel pipette. Run electrophoresis at 135 V for 30 min. Examine the band on gel under UVP documentation and analysis system.</li>
	<li>Purify the PCR products by PureLink 96 PCR purification kit using centrifugation according to the manufacturer's instruction. For eluting DNA, add 40 &mu;l sterile ddH2O to the well of the binding plate.</li>
	<li>Randomly pick several purified amplicons on the plate to examine the DNA concentrations using NanoDrop spectrophotometer. Adjust the concentration of amplicons on plate to ~10 ng/&mu;l.</li>
	<li>A plasmid containing Kmr cassette is digested using EcoRI as PCR template. The digested plasmid is purified by QIAquick PCR purification kit and the linear plasmid DNA is adjusted to final DNA concentration 10 ng/&mu;l. Assemble 25 &mu;l mixture for Kmr cassette amplicon including 16.4 &mu;l ddH2O, 2.5 &mu;l 10xHigh Fidelity PCR Buffer, 2 &mu;l of 10 mM dNTP mixture, 1 &mu;l of 50 mM Mg SO4, 1 &mu;l of 10 &mu;M F2, 1 &mu;l of 10 &mu;M R2, 1 &mu;l linear plasmid DNA and 0.1 &mu;l Platinum Taq DNA polymerase high fidelity. Perform PCR amplification at 94 &deg;C for 1 min, and 30 cycles of 94 &deg;C for 30 sec, 55 &deg;C for 30 sec and 68 &deg;C for 1 min. Examine the PCR product by gel electrophoresis on 1% agarose. Pool a bulk of the Kmr cassette amplicon from 10 individual PCR purified by QIAquick PCR purification kit. Adjust the amplicon concentration to 10 ng/&mu;l.</li>
	<li>To obtain the final linear recombinant PCR amplicon, three PCR amplicons are combined with each 1 &mu;l (in nearly equal-molar amounts) in one PCR plate well as the PCR template. Other PCR components is added including 14.4 &mu;l ddH2O, 2.5 &mu;l 10xHigh Fidelity PCR Buffer, 2 &mu;l of 10 mM dNTP mixture, 1 &mu;l of 50 mM Mg SO4, 1 &mu;l of 10 &mu;M F1, 1 &mu;l of 10 &mu;M R3, 0.1 &mu;l Platinum Taq DNA polymerase high fidelity. PCR amplification is performed at 94 &deg;C for 2 min, 30 cycles of 94 &deg;C for 30 sec 55 &deg;C for 30 sec and 68 &deg;C for 3.5 min, and finally 68 &deg;C for 4 min.</li>
	<li>Examine the PCR amplicons on agarose gel. Purify and quantify the PCR amplicons as described above. Freeze the recombined PCR amplicons at -20 &deg;C.</li>
</ol>
3. Competent Cells Preparation
<ol>
	<li>Todd Hewitt broth is prepared, adjusted pH to 7.6 using 10 N NaOH, heated to boil and then cooled to room temperature and sterilized using 0.22 &mu;m polystyrene filter4. Add 300 &mu;l heat-inactivated horse sera (final concentration to 2.5%) to 11.7 ml Todd Hewitt broth in 15-ml conical tube to make up TH+HS medium. Aliquot TH+HS medium into 2 ml and 10 ml in tubes.</li>
	<li>Inoculate 5 &mu;l of stock S. sanguinis SK36 frozen at -80 &deg;C into 2 ml TH+HS medium and incubate the culture overnight with capping tightly at 37 &deg;C, accompanied by pre-incubating the 10 ml-TH+HS tube.</li>
	<li>After overnight, transfer 50 &mu;l culture into 10 ml TH+HS and incubate the tube at 37 &deg;C for 3 hr (corresponding to OD660 of 0.07-0.08), immediately using for transformation.</li>
</ol>
4. Cell Transformation and Antibiotic Selection
<ol>
	<li>Add 2 &mu;l of 70 ng S. sanguinis SK36 competence stimulating peptide (CSP) and 2 &mu;l linear recombinant PCR amplicon (~50 ng) to Eppendorf tubes on 96-well block and pre-warm them at 37 &deg;C. Transfer 330 &mu;l of 3 hr-incubated SK36 culture into each tube. Incubate at 37 &deg;C for 1 hr. Replace DNA with sterile ddH2O as control.</li>
	<li>Place the block on ice and spread 100 &mu;l of each transformation on brain heart infusion (BHI) agar plate with 500 &mu;g/ml kanamycin. Incubate the plates at 37 &deg;C for 2 d under microaerobic conditions.</li>
</ol>
5. Mutant Confirmation and Storage
<ol>
	<li>For each replacement mutant, randomly pick up 2 individual colonies, inoculate the colony into 5 ml BHI containing 500 &mu;g/ml kanamycin and incubate the inoculum microaerobically overnight at 37 &deg;C. Cryopreserve each culture in 30% glycerol at -80 &deg;C</li>
	<li>To examine whether the mutant containing the expected gene replacement, perform colony PCR for each mutant using F1 and R3 primers in 96-well PCR plate. About 1-&mu;l overnight culture from individual colony is used as the DNA template in 25-&mu;l PCR-amplification reaction. PCR is performed at 94 &deg;C for 5 min, 35 cycles of 94 &deg;C for 30 sec, 55 &deg;C for 30 sec and 68 &deg;C for 3.5 min, and finally 68 &deg;C for 4 min.</li>
	<li>To precisely identify double-band mutants or contaminant PCR amplicon, examine the PCR amplicon by electrophoresis for 4 hr on &gt;12 cm long 2% agarose gel with ethidium bromide staining. Under this agarose gel electrophoresis condition, any amplicons with &ge; 100 bp difference were clearly identified. When bands resulting from amplification of the Kmr cassette and the wild-type gene are anticipated to differ by &lt; 100 bp, an internal T1 primer is used to determine whether a wild-type gene can be detected by PCR.</li>
	<li>To further confirm the deletion, the amplicons are purified by PureLink 96 PCR purification kit and sequenced using the P1 primer which binds to the Kmr cassette. Keep only correct mutants confirmed by sequencing.</li>
</ol>

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

No conflicts of interest declared.

To minimize the possible polar effects of the replacement of one targeted gene with exogenous antibiotics gene on neighboring genes, two steps are taken while initial primer designing. For most of deleted genes, the primers R1 and F3 are designed to delete the coding region from 6 bp following the start codon to 30 bp prior to the stop codon. The last 30 base pairs are retained to protect potential ribosomal binding site used by the adjacent downstream gene. The retained region between two neighboring genes is extended t...

<table border="1">
	<tbody>
 <tr>
 <td>Names</td>
 <td>Company</td>
 <td>Catalog#</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>Primer F2</td>
 <td>Integrated DNA Technologies</td>
 <td></td>
 <td>TGACTAACTAGGAGGAATAAATG GCTAAAATGAGAATAT</td>
 </tr>
 <tr>
 <td>Primer R2</td>
 <td>ibid</td>
 <td></td>
 <td>CATTATTCCCTCCAGGTACTAAAA CAATTCATCCAGT</td>
 </tr>
 <tr>
 <td>Primer F2p</td>
 <td>ibid</td>
 <td></td>
 <td>GATAAACCCAGCGAACCATTTGA</td>
 </tr>
 <tr>
 <td>Primer P1</td>
 <td>ibid</td>
 <td></td>
 <td>GCTTATATACCTTAGCAGGAGACA</td>
 </tr>
 <tr>
 <td>Primer P2</td>
 <td>ibid</td>
 <td></td>
 <td>GTATGACATTGCCTTCTGCGTCC</td>
 </tr>
 <tr>
 <td>Primer 5' end_R1_seq</td>
 <td>ibid</td>
 <td></td>
 <td>GCCATTTATTCCTCCTAGTTAGTCA</td>
 </tr>
 <tr>
 <td>Primer 5' end_F3_seq</td>
 <td>ibid</td>
 <td></td>
 <td>GTTTTAGTACCTGGAGGGAATAATG</td>
 </tr>
 <tr>
 <td>Primer 5' end_R1p_seq</td>
 <td>ibid</td>
 <td></td>
 <td>CCTCAAATGGTTCGCTGGGTTTATC</td>
 </tr>
 <tr>
 <td>CSP</td>
 <td>Synprep</td>
 <td></td>
 <td>Sequence:NH2-DLRGVPNPWGWIFGR-COOH</td>
 </tr>
 <tr>
 <td>DNA Polymerase </td>
 <td>Invitrogen</td>
 <td>11304-102</td>
 <td>Platinum Taq DNA Polymerase High Fidelity</td>
 </tr>
 <tr>
 <td>EcoRI</td>
 <td>New England Biolabs Inc</td>
 <td>R0101S</td>
 <td>Restriction enzyme</td>
 </tr>
 <tr>
 <td>Agar</td>
 <td>American Bioanalytical</td>
 <td>AB01185</td>
 <td></td>
 </tr>
 <tr>
 <td>Agarose</td>
 <td>Promega</td>
 <td>V3125</td>
 <td></td>
 </tr>
 <tr>
 <td>BHI</td>
 <td>BD Biosciences </td>
 <td>237500</td>
 <td>Brain Heart Infusion</td>
 </tr>
 <tr>
 <td>Horse serum</td>
 <td>Fisher Scientific</td>
 <td>SH3007403</td>
 <td>Horse serum</td>
 </tr>
 <tr>
 <td>Km</td>
 <td>Fisher Scientific</td>
 <td>BP906-5</td>
 <td>Kanamycin</td>
 </tr>
 <tr>
 <td>TH broth</td>
 <td>BD Biosciences </td>
 <td>249240</td>
 <td>Todd Hewitt broth</td>
 </tr>
 <tr>
 <td>PureLink 96</td>
 <td>Invitrogen</td>
 <td>K310096</td>
 <td>PureLink 96 PCR purification kit</td>
 </tr>
 <tr>
 <td>QIAquick</td>
 <td>Qiagen</td>
 <td>28106</td>
 <td>QIAquick PCR purification kit</td>
 </tr>
 <tr>
 <td>Filter</td>
 <td>Corning</td>
 <td>431117</td>
 <td>0.22 &mu;m polystyrene filter</td>
 </tr>
 <tr>
 <td>Anoxomat System</td>
 <td>Mart Microbiology b.v.</td>
 <td>Anoxomat Mark II</td>
 <td></td>
 </tr>
 <tr>
 <td>Benchtop centrifuge</td>
 <td>Thermo Scientific</td>
 <td>75004377</td>
 <td>Sorvall Legend RT Plus microplate rotor</td>
 </tr>
 <tr>
 <td>Gel Documentation</td>
 <td>UVP LLC</td>
 <td>BioDoc-It 210</td>
 <td></td>
 </tr>
 <tr>
 <td>Incubator</td>
 <td>Fisher Scientific</td>
 <td>11-690-625D</td>
 <td>Isotemp </td>
 </tr>
 <tr>
 <td>Labnet's Gel XL</td>
 <td>Labnet</td>
 <td>E0160</td>
 <td>Labnet's Gel XL</td>
 </tr>
 <tr>
 <td>Microcentrifuge</td>
 <td>Eppendorf</td>
 <td>22621408</td>
 <td>Microcentrifuge 5415 R</td>
 </tr>
 <tr>
 <td>Multichannel pipettes</td>
 <td>Thermo Scientfic</td>
 <td>4661040, 4661020</td>
 <td>Finnpipette F1</td>
 </tr>
 <tr>
 <td>Thermal Cycler</td>
 <td>Applied Biosystems Inc.</td>
 <td>N805-0200</td>
 <td>GeneAmp PCR system 9700</td>
 </tr>
	 </tbody>
 </table>

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Transposon mutagenesis and single-gene deletion are two methods applied in genome-wide gene knockout in bacteria 1,2. Although transposon mutagenesis is less time consuming, less costly, and does not require completed genome information, there are two weaknesses in this method: (1) the possibility of a disparate mutants in the mixed mutant library that counter-selects mutants with decreased competition; and (2) the possibility of partial gene inactivation whereby genes do not entirely lose their function following the insertion of a transposon. Single-gene deletion analysis may compensate for the drawbacks associated with transposon mutagenesis. To improve the efficiency of genome-wide single gene deletion, we attempt to establish a high-throughput technique for genome-wide single gene deletion using Streptococcus sanguinis as a model organism. Each gene deletion construct in S. sanguinis genome is designed to comprise 1-kb upstream of the targeted gene, the aphA-3 gene, encoding kanamycin resistance protein, and 1-kb downstream of the targeted gene. Three sets of primers F1/R1, F2/R2, and F3/R3, respectively, are designed and synthesized in a 96-well plate format for PCR-amplifications of those three components of each deletion construct. Primers R1 and F3 contain 25-bp sequences that are complementary to regions of the aphA-3 gene at their 5' end. A large scale PCR amplification of the aphA-3 gene is performed once for creating all single-gene deletion constructs. The promoter of aphA-3 gene is initially excluded to minimize the potential polar effect of kanamycin cassette. To create the gene deletion constructs, high-throughput PCR amplification and purification are performed in a 96-well plate format. A linear recombinant PCR amplicon for each gene deletion will be made up through four PCR reactions using high-fidelity DNA polymerase. The initial exponential growth phase of S. sanguinis cultured in Todd Hewitt broth supplemented with 2.5% inactivated horse serum is used to increase competence for the transformation of PCR-recombinant constructs. Under this condition, up to 20% of S. sanguinis cells can be transformed using ~50 ng of DNA. Based on this approach, 2,048 mutants with single-gene deletion were ultimately obtained from the 2,270 genes in S. sanguinis excluding four gene ORFs contained entirely within other ORFs in S. sanguinis SK36 and 218 potential essential genes. The technique on creating gene deletion constructs is high throughput and could be easy to use in genome-wide single gene deletions for any transformable bacteria.

After PCR amplification using primers F1 and R1, and F3 and R3, approximately 1-kb upstream and downstream of each S. sanguinis gene were obtained in 96-well format, respectively (Figure 2A). Under our PCR conditions and using designed primers, a specific product was amplified from S. sanguinis genomic DNA in each PCR reaction. This result indicated the primers were highly specific to the targets of S. sanguinis. Through PCR re-amplification using primers F1 and R3 and t...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

16.4K Views.  Virginia Commonwealth University. An efficient genome-wide single gene mutation method has been established using Streptococcus sanguinis as a model organism. This method has achieved via high throughput recombinant PCRs and transformations.