يقر RSM بتمويل من زمالة أبحاث الدراسات العليا جبهة الخلاص الوطني. يقر MBN بتمويل من زمالة لويس سيغلر وهبت هدية من بيتر لويس. يقر DB بتمويل من المعاهد الوطنية للصحة (GM046406) المعهد الوطني للعلوم الطبية العامة مركز لعلم الأحياء الكمي (GM071508). نحن نعترف كريستينا DeCoste للحصول على المساعدة مع التجارب التدفق الخلوي.

ويقدم الشكل 2 التخطيطي الأقسام بروتوكول 1-3. 1. إنشاء ATFs <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إنشاء الاشعال PCR لتضخيم الحمض النووي ملزم المجال من الفائدة. يضاف إلى التماثل المروج ACT1 ومستقبلات هرمون (كما هو موضح في الشكلين 3 و 4) من خلال PCR لتسهيل إعادة التركيب الصحيح في سلالة yMN15. </li><li style=";text-align:right;direction:rtl"> PCR تضخيم DBD الاهتمام باستخدام البلمرة الدقة العالية. </li><li style=";text-align:right;direction:rtl"> تحويل&gt; 1 ميكروغرام من الناتج PCR المنقى في الخميرة باستخدام طريقة خلات الليثيوم 13. </li><li style=";text-align:right;direction:rtl"> بعد التحول، والخلايا تدور في سرعة قصوى لمدة 15 ثانية في ميكروسنتريفوج وإزالة مزيج التحول. </li><li style=";text-align:right;direction:rtl"> ~ resuspend في 200 ميكرولتر من الماء المعقم وعلى لوحة YPD. </li><li style=";text-align:right;direction:rtl"> في اليوم التالي، لوحة طبق الأصل من YPD على لوحات 5 FOA (لوحات مصنوعة 5 FOA كما هو موضح في دليل الخميرة كولد سبرينج هاربور) 13. </li><li style=";text-align:right;direction:rtl"> يسمح النمو لمدة 2-4 دAYS، وrestreak 5-10 على الأقل المستعمرات على YPD. إجراء PCR مستعمرة باستخدام بادئات في الجدول 1 وتسلسل للتحقق من إدراج. </li></ol> 2. إنشاء ATF البلازميد مراسل <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تحديد موقع ملزم للATF (على الأرجح أن يأتي من الأدب). </li><li style=";text-align:right;direction:rtl"> الترتيب المطلوب ملزمة المنطقة كما oligos (أو Ultramers، إذا لزم الأمر). كما تأمر أعلى وأسفل مع فروع يتدلى الصحيح لNOTI وXbaI كما هو مبين في الجدول رقم 2. </li><li style=";text-align:right;direction:rtl"> تمييع oligos لتركيزات متساوي المولية (100 ميكرومتر). </li><li style=";text-align:right;direction:rtl"> الفوسفات باستخدام T4 كيناز عديد النوكليوتيد ثم يصلب في thermocycler. ظروف التفاعل في الجدول 3. </li><li style=";text-align:right;direction:rtl"> ملخص ~ 1-2 ميكروغرام من pMN8 مع NOTI-HF وXbaI لمدة 1 ساعة عند 37 درجة مئوية (ظروف التفاعل في الجدول رقم 4). </li><li style=";text-align:right;direction:rtl"> هلام تنقية الفرقة العمود الفقري. </li><li style=";text-align:right;direction:rtl"> تمييع العمود الفقري المنقى إلى 10 نانوغرام / ميكرولتر. </li><li style=";text-align:right;direction:rtl"> تمييع المزدوج تقطعت بهم السبل، فسفوريلated موقع ملزم إلى 5x التركيز المولي من العمود الفقري لكل ميكرولتر. </li><li style=";text-align:right;direction:rtl"> باستخدام الحمض النووي يغاز T4، ligate مواقع الربط في العمود الفقري هضمها في درجة حرارة الغرفة لمدة 30 دقيقة (الجدول 5). </li><li style=";text-align:right;direction:rtl"> للتحول، إضافة نصف التفاعل ربط إلى 50 ميكرولتر من معيار، القولونية المختصة كيميائيا مثل XL1 أزرق أو DH5 ألفا. </li><li style=";text-align:right;direction:rtl"> خلايا الصدمة الحرارية لمدة 45 ثانية في 42 ° C حمام الماء ومن ثم وضع على الجليد لمدة 2 دقيقة. </li><li style=";text-align:right;direction:rtl"> إضافة 900 ميكرولتر من شركة نفط الجنوب متوسطة إلى رد فعل التحول. </li><li style=";text-align:right;direction:rtl"> تنمو عند 37 درجة مئوية لمدة 1 ساعة على طبل الدوارة. </li><li style=";text-align:right;direction:rtl"> تنتشر الخلايا 100-200 ميكرولتر لكل LB + AMP (100 ميكروغرام / مل) لوحة واحتضان بين عشية وضحاها. </li><li style=";text-align:right;direction:rtl"> يكبر E. القولونية في LB + AMP الحمض النووي البلازميد السائل والحصاد. تسلسل التحقق من جديد مراسل البلازميد من المستعمرات ربط باستخدام التمهيدي 5&#39;-GTACCTTATATTGAATTTTC-3 &#39;. </li><li style=";text-align:right;direction:rtl"> تحويل جديدة مراسل البلازميد الى المحتوية على الخميرة شارع ATFعين من القسم 1 باستخدام الليثيوم خلات التحول. </li></ol> 3. قياس تأثير ATF الحث على التعبير الجيني باستخدام GFP مراسل إعداد العينات: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> جعل 25 ملي الأسهم β-استراديول (10 مل من الايثانول + 0.0681 غرام من β-استراديول). يحفظ في الثلاجة. </li><li style=";text-align:right;direction:rtl"> تنمو ATF + مراسل المحتوية على سلالة بين عشية وضحاها في 5ML SC-URA. </li><li style=";text-align:right;direction:rtl"> الحصول على تسع 250 مل يهز قوارير وإضافة 25 مل SC-URA على كل منها. </li><li style=";text-align:right;direction:rtl"> إضافة 0 نانومتر، 0.1 نانومتر، 1 نانومتر و 10 نانومتر، 100 نانومتر، 1 ميكرومتر، 10 ميكرومتر أو β-استراديول. يتم ذلك بسهولة عن طريق جعل التخفيفات التسلسلي 10 أضعاف من 25 ملي الأسهم β-استراديول. لتركيز النهائي من 10 ميكرومتر β-استراديول، إضافة 10 ميكرولتر من 25 ملي الأسهم β-استراديول إلى 25 مل من SC-URA. </li><li style=";text-align:right;direction:rtl"> إضافة 125 ميكرولتر من الثقافات بين عشية وضحاها لقوارير (1:200 تمييع). </li><li style=";text-align:right;direction:rtl"> ل2 القوارير المتبقية، مع تطعيم التأسيسية GFP إنتاج الاجهادن وسلالة تفتقر GFP. هناك حاجة لهذه لمعايرة تدفق عداد الكريات. </li><li style=";text-align:right;direction:rtl"> يهز في 200 دورة في الدقيقة عند 30 درجة مئوية لمدة 12-18 ساعة. ملاحظة: يتم تحديد فترة حضانة الأمثل من خلال تحديد عندما GFP تحريض التغييرات التالية لم تعد إضافة β-استراديول. </li><li style=";text-align:right;direction:rtl"> تأخذ 500 ميكرولتر من كل ثقافة وتدور باستمرار في أنابيب 1.7 مل ميكروسنتريفوج منفصلة. </li><li style=";text-align:right;direction:rtl"> نضح SC-URA. </li><li style=";text-align:right;direction:rtl"> يغسل مرة واحدة في 1 مل PBS +0.1٪ توين 20 ونضح. </li><li style=";text-align:right;direction:rtl"> إضافة 1 مل من برنامج تلفزيوني +0.1٪ توين 20 و resuspend. </li><li style=";text-align:right;direction:rtl"> إضافة 1 مل من برنامج تلفزيوني +0.1٪ توين 20 لأنابيب فالكون. </li><li style=";text-align:right;direction:rtl"> إضافة خلايا معلق إلى 5 مل أنابيب (الحجم النهائي = 2 مل) (يمكن تخزينها في 4 درجات مئوية لعدة أيام). </li><li style=";text-align:right;direction:rtl"> اختياري: خلايا يصوتن برفق لتفكك خلايا أي تجمعت. تحليل التدفق الخلوي: نظرة عامة: عادة ما يتم تحليل مضان من الخلايا 10،000-100،000 لكل عينة. يمكن معالجة البيانات إما في FlowJo أو باستخدام البرامج النصية المخصصة في MATLAB أوR. تأكد من معايرة الجهد للقناة GFP باستخدام GFP الضوابط الإيجابية والسلبية. مرة واحدة ويتم تصدير الملفات FCS، برنامج نصي مثل واحد في الشكل (6) جنبا إلى جنب مع fca_readfcs ظيفة ( <a href="http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader">http://www.mathworks.com/matlabcentral/fileexchange/9608-fcs-data-reader</a> ) يمكن استخدامها لمعالجة البيانات. </li><li style=";text-align:right;direction:rtl"> أداء التدفق الخلوي. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> استخدام مبعثر إلى الأمام (FSC) والجانب مبعثر (SSC) لتحديد خلايا الخميرة. </li><li style=";text-align:right;direction:rtl"> ضبط معدل تدفق إلى ~ 3،000 خلية / ثانية. </li><li style=";text-align:right;direction:rtl"> قياس GFP (قناة FITC). </li><li style=";text-align:right;direction:rtl"> مرة واحدة يتم جمع البيانات، تصدير ملفات FCS </li></ol></li><li style=";text-align:right;direction:rtl"> تحميل MATLAB. </li><li style=";text-align:right;direction:rtl"> نقل ملفات FCS، fcs_readfcs.m، والسيناريو مماثلة لتلك التي من الشكل (6) إلى نفس المجلد. </li><li style=";text-align:right;direction:rtl"> تغيير دليل العمل الحالي إلى المجلد الذي يحتوي على البيانات والبرامج النصية. </li><li style=";text-align:right;direction:rtl"> تشغيل البرنامج النصي من الشكل (6) (ملاحظة: للوقد أسطورة إدخالها يدويا لإنتاج ما رأينا في الشكل 7). </li></ol> 4. قياس تأثير ATF الحث على نمو الخلايا <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> من الأسهم المجمدة، خط خارج على حد سواء (1) سلالة المحتوية على ATF و (2) على سلالة تفتقر ATF (مثل yMN15) على لوحات YPD منفصلة. </li><li style=";text-align:right;direction:rtl"> 2 بعد أيام من النمو، وتطعيم الثقافة أنابيب منفصلة تحتوي على 5 مل من YPD السائل مع كل سلالة وتنمو بين عشية وضحاها في 30 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> تنفيذ 10 أضعاف التخفيفات المسلسل من 0.25 ملي محلول المخزون β-استراديول تصل إلى 10،000 أضعاف (0.025 ميكرومتر β-استراديول) في الإيثانول بنسبة 100٪. </li><li style=";text-align:right;direction:rtl"> إضافة 40 ميكرولتر من الثقافات بين عشية وضحاها إلى 10 مل من YPD السائل (1-250 التخفيف). </li><li style=";text-align:right;direction:rtl"> لكل سلالة، إضافة 96 ميكرولتر من الخلايا المخفف إلى 18 بئرا من 96 لوحة جيدا. </li><li style=";text-align:right;direction:rtl"> إضافة 4 ميكرولتر من β-استراديول إلى الخلايا. فإن النقطة الأساسية هي للتأكد من كل بئر لديه نفس القدر من مجموع الايثانول. (بدلا من ذلك، وهو مو<html> إعادة مركزة من الاسهم β-استراديول يمكن استخدامها في وقت لاحق والمخفف لدرجة تأثير الايثانول على النمو ليست قابلة للقياس). </li><li style=";text-align:right;direction:rtl"> أداء في ثلاث نسخ. ثلاثة من آبار لكل سلالة ينبغي أن تكون الضوابط الايثانول فقط. </li><li style=";text-align:right;direction:rtl"> تغطية لوحة 96 جيدا في غشاء نفاذية الغاز. </li><li style=";text-align:right;direction:rtl"> رصد النمو (OD 600) في قارئ لوحة. </li><li style=";text-align:right;direction:rtl"> قياس معدلات النمو باستخدام أي عدد من الطرق القياسية مثل إيجاد أقصى المنحدر. ملاحظة: لقد كان لدينا نجاح جيدة مع حزمة برامج مفتوحة المصدر grofit 14، والذي يعمل في بيئة البرمجة R ومن الجدير بالذكر أنه في حين أن معدلات النمو حسابها من المقايسات لوحة 96 جيدا مقارنة هزة قوارير (25 مل الثقافات). ليست بالضرورة هي نفسها (سواء بسبب الاختلافات في علم وظائف الأعضاء والأجهزة في)، لقد لوحظ أن معدلات النمو النسبي متشابهة (رغم أن هذا قد لا يكون الحال دائما). </li></ol>TLE &quot;&gt; 5. إنشاء محرض الجينوم جمع أليل <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> الحصول pMN10، البلازميد noncentromeric مع المروج-ATF استجابة من pMN8 تنصهر لKanMX (في الاتجاه المعاكس). </li><li style=";text-align:right;direction:rtl"> تقييد هضم العمود الفقري النواقل واستخراج الجل كما هو الحال في القسم 2. </li><li style=";text-align:right;direction:rtl"> يصلب، الفوسفات، وتحتوي على oligos ligate مواقع الربط المناسبة كما هو موضح في القسم 2. </li><li style=";text-align:right;direction:rtl"> تسلسل تحقق. وهذا البلازميد الآن بمثابة قالب الحمض النووي لخلق أليل محرض. </li><li style=";text-align:right;direction:rtl"> الحصول على سلالة الخميرة معربا عن ATF المقابلة من الفائدة. </li><li style=";text-align:right;direction:rtl"> PCR تضخيم كاسيت KanMX-المروج (~ 2 كيلو) باستخدام بادئات من الجدول 6. </li><li style=";text-align:right;direction:rtl"> تحويل المنتج PCR في سلالة، معربا عن ATF باستخدام طريقة خلات الليثيوم. </li><li style=";text-align:right;direction:rtl"> لوحة على لوحة YPD وطبق على YPD G418 + في اليوم التالي. </li><li style=";text-align:right;direction:rtl"> تأكيد الإدراج المناسبة من المروج باستخدام التمهيدي إلى الأمام (5&#39;-CTGCAGCGAGGAGCCGTAAT-3 &#39;) وعكس التمهيدي الداخلية إلى التم استبدال البريد الجين الذي المروج. تم تصميم التمهيدي العكسي عادة ما بين 200-300 سنة مضت المصب من أول ATG 15. المنتج النهائي هو PCR ~ 1.2 كيلو بايت. </li></ol>

<ol>
	<li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+gene+expression+perturbation+systems+with+rapid,+tunable,+single-gene+specificity+in+yeast.">Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast.</a> Nucleic acids res. 41, e57 (2013).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast-acting+and+nearly+gratuitous+induction+of+gene+expression+and+protein+depletion+in+Saccharomyces+cerevisiae.">Fast-acting and nearly gratuitous induction of gene expression and protein depletion in Saccharomyces cerevisiae.</a> Mol. Biol. cell. 22, 4447-4459 (2011).</li><li>Louvion, J. F., Havaux-Copf, B., Picard, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fusion+of+GAL4-VP16+to+a+steroid-binding+domain+provides+a+tool+for+gratuitous+induction+of+galactose-responsive+genes+in+yeast.">Fusion of GAL4-VP16 to a steroid-binding domain provides a tool for gratuitous induction of galactose-responsive genes in yeast.</a> Gene. 131, 129-134 (1993).</li><li>Littlewood, T. D., Hancock, D. C., Danielian, P. S., Parker, M. G., Evan, G. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+modified+oestrogen+receptor+ligand-binding+domain+as+an+improved+switch+for+the+regulation+of+heterologous+proteins.">A modified oestrogen receptor ligand-binding domain as an improved switch for the regulation of heterologous proteins.</a> Nucleic acids res. 23, 1686-1690 (1995).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+Analysis+of+mRNA+Molecules+Using+Fluorescence+In+Situ+Hybridization+in+Saccharomyces+cerevisiae.">Visualization and Analysis of mRNA Molecules Using Fluorescence In Situ Hybridization in Saccharomyces cerevisiae.</a> J. Vis. Exp. (76), e50382 (2013).</li><li>McIsaac, R. S., Petti, A. A., Bussemaker, H. J., Botstein, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Perturbation-based+analysis+and+modeling+of+combinatorial+regulation+in+the+yeast+sulfur+assimilation+pathway.">Perturbation-based analysis and modeling of combinatorial regulation in the yeast sulfur assimilation pathway.</a> Mol. Biol. cell. 23, 2993-3007 (2012).</li><li>Belli, G., Gari, E., Piedrafita, L., Aldea, M., Herrero, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+activator/repressor+dual+system+allows+tight+tetracycline-regulated+gene+expression+in+budding+yeast.">An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.</a> Nucleic acids res. 26, 942-947 (1998).</li><li>Baron, U., Bujard, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tet+repressor-based+system+for+regulated+gene+expression+in+eukaryotic+cells:+principles+and+advances.">Tet repressor-based system for regulated gene expression in eukaryotic cells: principles and advances.</a> Meth. Enzymol. 327, 401-421 (2000).</li><li>Kodama, S., Okada, K., Akimoto, K., Inui, H., Ohkawa, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recombinant+aryl+hydrocarbon+receptors+for+bioassay+of+aryl+hydrocarbon+receptor+ligands+in+transgenic+tobacco+plants.">Recombinant aryl hydrocarbon receptors for bioassay of aryl hydrocarbon receptor ligands in transgenic tobacco plants.</a> Plant Biotechnol. J. 7, 119-128 (2009).</li><li>Hickman, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coordinated+regulation+of+sulfur+and+phospholipid+metabolism+reflects+the+importance+of+methylation+in+the+growth+of+yeast.">Coordinated regulation of sulfur and phospholipid metabolism reflects the importance of methylation in the growth of yeast.</a> Mol. Biol. cell. 22, 4192-4204 (2011).</li><li>Taxis, C., Stier, G., Spadaccini, R., Knop, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+protein+depletion+by+genetically+controlled+deprotection+of+a+dormant+N-degron.">Efficient protein depletion by genetically controlled deprotection of a dormant N-degron.</a> Mol. Syst. Biol. 5, 267 (2009).</li><li>Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+auxin-based+degron+system+for+the+rapid+depletion+of+proteins+in+nonplant+cells.">An auxin-based degron system for the rapid depletion of proteins in nonplant cells.</a> Nat. methods. 6, 917-922 (2009).</li><li>Burke, D. J., Amberg, D. C., Strathern, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual. , (2005).</li><li>Kahm, M., Hasenbrink, G., Lichtenberg-Frate, H., Ludwig, J., Kschischo, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=grofit:+Fitting+Biological+Growth+Curves+with+R.">grofit: Fitting Biological Growth Curves with R.</a> J. Stat. Softw. 33, 1-21 (2010).</li><li>Rozen, S., Skaletsky, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer3+on+the+WWW+for+general+users+and+for+biologist+programmers.">Primer3 on the WWW for general users and for biologist programmers.</a> Methods Mol. Biol. 132, 365-386 (2000).</li><li>Khalil, A. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+synthetic+biology+framework+for+programming+eukaryotic+transcription+functions.">A synthetic biology framework for programming eukaryotic transcription functions.</a> Cell. 150, 647-658 (2012).</li><li>Chockalingam, K., Chen, Z., Katzenellenbogen, J. A., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+specific+receptor-ligand+pairs+for+use+in+the+creation+of+gene+switches.">Directed evolution of specific receptor-ligand pairs for use in the creation of gene switches.</a> Proceedings of the National Academy of Sciences of the United States of America. 102, 5691-5696 (2005).</li><li>McLachlan, M. J., Chockalingam, K., Lai, K. C., Zhao, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+evolution+of+orthogonal+ligand+specificity+in+a+single+scaffold.">Directed evolution of orthogonal ligand specificity in a single scaffold.</a> Angewandte Chemie. 48, 7783-7786 (2009).</li><li>Jorgensen, P., Nishikawa, J. L., Breitkreutz, B. J., Tyers, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systematic+identification+of+pathways+that+couple+cell+growth+and+division+in+yeast.">Systematic identification of pathways that couple cell growth and division in yeast.</a> Science. 297, 395-400 (2002).</li><li>Sopko, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+pathways+and+phenotypes+by+systematic+gene+overexpression.">Mapping pathways and phenotypes by systematic gene overexpression.</a> Mol. cell. 21, 319-330 (2006).</li><li>Shimizu-Sato, S., Huq, E., Tepperman, J. M., Quail, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+light-switchable+gene+promoter+system.">A light-switchable gene promoter system.</a> Nat. biotechnol. 20, 1041-1044 (2002).</li><li>Polstein, L. R., Gersbach, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Light-inducible+spatiotemporal+control+of+gene+activation+by+customizable+zinc+finger+transcription+factors.">Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors.</a> J. Am. Chem. Soc. 134, 16480-16483 (2012).</li><li>Losi, A., Gartner, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Old+chromophores,+new+photoactivation+paradigms,+trendy+applications:+flavins+in+blue+light-sensing+photoreceptors.">Old chromophores, new photoactivation paradigms, trendy applications: flavins in blue light-sensing photoreceptors.</a> Photochem. Photobiol. 87, 491-510 (2011).</li><li>Boyden, E. S., Zhang, F., Bamberg, E., Nagel, G., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond-timescale,+genetically+targeted+optical+control+of+neural+activity.">Millisecond-timescale, genetically targeted optical control of neural activity.</a> Nat. Neurosci. 8, 1263-1268 (2005).</li><li>Gradinaru, V., Mogri, M., Thompson, K. R., Henderson, J. M., Deisseroth, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optical+deconstruction+of+parkinsonian+neural+circuitry.">Optical deconstruction of parkinsonian neural circuitry.</a> Science. 324, 354-359 (2009).</li><li>Milias-Argeitis, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+silico+feedback+for+in+vivo+regulation+of+a+gene+expression+circuit.">In silico feedback for in vivo regulation of a gene expression circuit.</a> Nat. biotechnol. 29, 1114-1116 (2011).</li></ol>

قدمت McIsaac، نويس، وBotstein (مع الآخرين) جزء من هذا النظام باعتباره الإفصاح براءات الاختراع.

مفاتيح القائم على هرمون الموصوفة هنا لها تطبيقات لا تعد ولا تحصى، من دراسة بيولوجيا الخلية الأم إلى اختبار قدرة مجال الحمض النووي ملزم من الفائدة لاستهداف تسلسل الحمض النووي في الجسم الحي. النظام لديه العديد من الميزات مرغوب فيه، بما في ذلك استجابة لمحفز متدرج، والعمل بسرعة، وتنظيم محكم (أي. أي التسرب قابلة للقياس، انظر الشكل 7). ومع ذلك، لا يزال هناك مجال للتحسين والتوسع. وقد أكدت الأعمال الأخيرة في البيولوجيا التركيبية الاصطناعية أنظمة مضاعفة وتوسيع مرجع تتميز بشكل جيد وقطع الحمض النووي للبرمجة 16. مستقلة، التعبير الشرطي من الجينات المستهدفة متميزة يتطلب محرضات متعددة والمجالات ملزمة الحمض النووي التي تفتقر إلى تداخل خصوصية. توافر مستقبلات المهندسة والتي تحدث بشكل طبيعي ويقدم مجموعة كبيرة من قطع الغيار التي لتطوير عوامل النسخ اصطناعية جديدة. توسيعمرجع مفاتيح متعامد بعضها بعضا وقد ساعد الى حد كبير عن طريق التطور الموجه النهج 17،18. وستعرض الجهود المبذولة حاليا لإعادة برمجة خصوصية ملزم يجند لدينا عوامل النسخ الاصطناعي في المستقبل. سابقا، فإن عواقب المظهري من الجينات الحذف / من overexpression تم دراستها على نطاق واسع في الخميرة 19،20. ومع ذلك، لم يتم ذلك مباشرة لدراسة تأثير التعبير عن الظواهر المختلفة على مجموعة من مستويات التعبير. والميزة الأساسية لنظام الواردة في هذه الوثيقة هو طبيعة متدرج لها (الشكل 8). في حين غالبا ما يفترض، والعلاقة بين التعبير الجيني والظواهر من الفائدة قد لا يكون بالضرورة رتيب. سوف عوامل النسخ الاصطناعية مثل Z 3 EV وZ 4 EV جعل مهمة يعاير ردود المظهري للتغيرات في التعبير الجيني مباشرة. وأخيرا، فإن البروتوكولات مناقشةإد في هذه المخطوطة هي للهندسة وتميز عوامل النسخ الاصطناعية التي تستجيب لβ-استراديول، ولكن بديلا هاما إلى مجالات تستجيب كيميائيا هو استخدام المجالات ضوء استجابة (مثل PhyB/Pif3، LOV، وBLUF)، الأنشطة التي هي عكسها دون الحاجة إلى التشويش على نمو ثقافة المتوسط ​​21-23. الأنظمة القائمة على ضوء تسهيل السيطرة الزمانية المكانية في التعبير الجيني، وتفاعلات البروتين البروتين، والنقل أيون، والنشاط الأنزيمي، والتي أثبتت بالفعل قوية 21-26. في الختام، قدمنا ​​طرق البناء السريع للمحرض، عوامل النسخ اصطناعية في الخميرة. يوفر هذا البروتوكول قالب لبنائها بالتزامن مع صحفيين GFP وما شابه ذلك، وكذلك طرق تحليل البيانات باستخدام مراسل التدفق الخلوي ويعاير تأثير التنشيط ATF على النمو.

وضع مفاتيح الوراثية في الخميرة هي ذات أهمية كبيرة في البحوث الأكاديمية والصناعية على حد سواء. في الحالة المثالية، ومفاتيح الوراثية يمكن استخدامها لتنشيط جينات معينة (أو مجموعة من الجينات) فقط عندما المرجوة من قبل المجرب. لا يتم التعبير الترميز تسلسل الجين وضعت المصب من المروج الاصطناعية في حال عدم وجود جزيء حمل: عند إضافة محفز ينبغي التعبير عن الجين بسرعة. وقد تم مؤخرا فقط تبين أن مثل هذا التحول يمكن هندستها في الخميرة، حيث في حالة عدم وجود محفز، يعرض سلالة النمط الظاهري الحذف، ولكن في وجود محفز، يتم تنشيط التعبير بما يتناسب مع مستوى محفز في جميع الخلايا 1،2. تاريخيا، وقد اعتمدت أنظمة التعبير الشرطي في الخميرة بشكل كبير على تسلسل الحمض النووي المغذيات استجابة، بما في ذلك MET، PHO، والمروجين GAL (التي تعتبر أنشطتها الحساسة لمستويات خارج الخلية من ميثيونين والفوسفات، والجالاكتوز، على التوالي). بينما التعبير الشرطي لا يمكن أن يتحقق، لأنه يأتي على حساب الآثار عديد المظاهر الهامة. وقد أثبتت مستقبلات هرمون مثل مستقبلات هرمون الاستروجين الإنسان أن تكون مفاتيح فعالة في حقيقيات النوى 3،4. في غياب هرمون، وهو بروتين تنصهر لمستقبلات هرمون يمكن عزلها في السيتوبلازم حيث يتفاعل مع مجمع كوصي Hsp90. عند ملزم يجند المناسبة، ومستقبلات تخضع لعملية تغيير متعلق بتكوين جزئي، الامر الذي ادى الى ان يفرج عنها من مجمع كوصي Hsp90 والكشف عن إشارة توطين النووية. لمراقبة ديناميات توطين هرمون البروتين التي تحتوي على مستقبلات خاصة، أنشأنا الانصهار C-محطة من Gal4dbd.ER.VP16 (GEV، عامل النسخ الاصطناعية التي تحتوي على المجال ملزمة Gal4p الحمض النووي، والمجال ملزم يجند من مستقبلات هرمون الاستروجين الإنسان وVP16) مع GFP 2. ولوحظ توطين النووية في غضون 8 دقائق التالية بالإضافة للتشبع مبالغ محفز، ß-استراديول، إلى أي نوع الخميرة البرية خاملة تماما. قبل هذا الوقت، فإن غالبية الخلايا لديها واضحة للعيان مواقع النسخ نشطة لالجينات المستهدفة GEV (يعاير عبر مضان التهجين في الموقع)، وكذلك mRNAs وناضجة تماما 2،5. زيادة GEV الجينات المستهدفة في التعبير&gt; 2 أضعاف في غضون 2.5 دقيقة 2،6 (تقاس باستخدام ميكروأرس)، مما يدل على ان الامر يستغرق &lt;2.5 دقيقة للالمنشط خيالية لنقل من إلى النواة، ربط الحمض النووي، وتفعيل النسخ. بينما العديد من الآخرين على مفاتيح طبقت في الخميرة التي تستخدم مختلف الجزيئات الصغيرة أو المخدرات (بما في ذلك مفاتيح القائم الدوكسيسيكلين الكلاسيكية من الإشريكية القولونية 7،8 والتبديل القائم على النيلي 9 من نبات الأرابيدوبسيس thaliana)، قد حققت أي سرعة، خصوصية، أو ضيق التنظيم التي أظهرتها مفاتيح القائم على الهرمون. ومن الجدير بالذكر رقبعة السريع قد وضعت أيضا إيقاف مفاتيح في الخميرة، وعادة العمل عن طريق دمج الجينات إلى البروتيني أو اليوبيكويتين يغاز استهداف تسلسل 2،10،11،12. القدرة على إزالة بسرعة بروتين الهدف من الخلية يسهل دراسة الجينات الأساسية فضلا عن الجينات التي تكون عرضة لقمع الوراثية عند حذف 10. الأساليب الموصوفة في هذا البروتوكول هي لبناء وتوصيف الاصطناعية على مفاتيح في الخميرة. الأولى، وتبين لنا كيفية توليد بسرعة البروتينات الانصهار متكاملة genomically تتكون من مجال الحمض النووي ملزم من الفائدة، ويجند المجال من مستقبلات هرمون الاستروجين الإنسان الملزمة، وVP16 (DBD-EV في). بعد بروتوكول لدينا، يتم التعبير عن انصهار بروتين من المروج ACT1. نحن ثم تظهر كيفية إنشاء مراسل البلازميد وما شابه ذلك لATF واختبار وظائفه باستخدام التدفق الخلوي. على الرغم من أننا نتصور هذه البلازميدات مراسل المستخدمة مع ATFs جديدة (الشكل 1)، وأنها يمكن أن به تستخدم للصحفيين للحصول على المنشط النسخي الأم كذلك. أخيرا، يتم توفير تفاصيل لاختبار تأثير التنشيط ATF على نمو الخلايا في لوحات 96 جيدا وللهندسة الأليلات الجيني محرض.

<table border="0" cellpadding="0" cellspacing="0" width="352">
	<colgroup>
		<col span="4" />
	</colgroup>
	<tbody>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Name of the Reagent</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments&#160;</td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Expand High Fidelity PCR System</td>
			<td style="width:88px;">Roche</td>
			<td style="width:88px;">11 732 650 001</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">T4 DNA Ligase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0202S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Competent E. coli</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">18258-012</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Estradiol</td>
			<td style="width:88px;">Tocris Biosciences</td>
			<td style="width:88px;">2824</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Ampicillin</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">BP1760-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">T4 Polynucleotide Kinase</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">M0201</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">PBS</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">10010-23</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">Tween-20</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">9005-64-5</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">clonNAT</td>
			<td style="width:88px;">Jena Bioscience</td>
			<td style="width:88px;">AB-102L</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">XbaI</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R0145S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">NotI-HF</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">R3189S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">CutSmart Buffer</td>
			<td style="width:88px;">NEB</td>
			<td style="width:88px;">B7204S</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Glucose</td>
			<td style="width:88px;">Fisher Scientific</td>
			<td style="width:88px;">D15-500</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Bacto-Peptone</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">211677</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Yeast Extract</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">210929</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Agarose</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">214010</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">100% Ethanol</td>
			<td style="width:88px;">Decon Laboratories</td>
			<td style="width:88px;">04-355-222</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">G418</td>
			<td style="width:88px;">Life Technologies</td>
			<td style="width:88px;">11811-031</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">QIAprep Spin Miniprep Kit</td>
			<td style="width:88px;">QIAGEN</td>
			<td style="width:88px;">27104</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="51">
			<td height="51" style="height:51px;width:88px;">Lithium acetate dihydrate</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">L-6883</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="34">
			<td height="34" style="height:34px;width:88px;">Salmon sperm DNA</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">93283</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:88px;">PEG 3350</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">P-3640</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plasmids pMN8 and pMN10; yeast strain yMN15</td>
			<td style="width:88px;">Noyes or Botstein labs</td>
			<td style="width:88px;"></td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Luria Broth</td>
			<td>Sigma-Aldrich</td>
			<td>L3397</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EQUIPMENT:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;"></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Material Name</td>
			<td style="width:88px;">Company</td>
			<td style="width:88px;">Catalogue Number</td>
			<td style="width:88px;">Comments (optional)</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">LSRII Flow Cyometer&#160;</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">Various Models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="103">
			<td height="103" style="height:103px;width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;">MATLAB or FlowJo</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">Software for analyzing .FCS files from flow cytometry experiments</td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">R</td>
			<td style="width:88px;">Open Source</td>
			<td style="width:88px;"></td>
			<td style="width:88px;">For analyzing growth-rate data from plate reader.&#160;</td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Falcon Tubes</td>
			<td style="width:88px;">BD Biosciences</td>
			<td style="width:88px;">352052</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="52">
			<td height="52" style="height:52px;width:88px;">1.7 ml Eppendorf&#160; Tubes</td>
			<td style="width:88px;">GeneMate</td>
			<td style="width:88px;">C3262-1</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">250 ml Shake Flasks</td>
			<td style="width:88px;">Corning</td>
			<td style="width:88px;">4446-250</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">96-well, flat-bottom plates</td>
			<td style="width:88px;">Costar</td>
			<td style="width:88px;">3635</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="69">
			<td height="69" style="height:69px;width:88px;">Plate Reader (Synergy H1 Multi-Mode Plate Reader)</td>
			<td style="width:88px;">BioTek</td>
			<td style="width:88px;">H1MG</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Breathe-Easy Membranes</td>
			<td style="width:88px;">Sigma-Aldrich</td>
			<td style="width:88px;">Z380059-1PAK</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">Thermocycler</td>
			<td style="width:88px;">various companies</td>
			<td style="width:88px;">Various models</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">SC-Ura powder</td>
			<td style="width:88px;">MP Biomedicals</td>
			<td style="width:88px;">114410622</td>
			<td style="width:88px;"></td>
		</tr>
		<tr height="35">
			<td height="35" style="height:35px;width:88px;">5-FOA</td>
			<td style="width:88px;">Zymo Research</td>
			<td style="width:88px;">F9001-1</td>
			<td style="width:88px;"></td>
		</tr>
	</tbody>
</table>

rapid synthesis and screening of chemically activated transcription factors with gfp-based reporters

يهدف البيولوجيا الاصطناعية لتصميم وبناء دوائر بعقلانية الاصطناعية مع الخصائص الكمية المطلوبة، فضلا عن توفير الأدوات اللازمة لاستجواب هيكل دوائر التحكم الأصلية. في كلتا الحالتين، يمكن للبرنامج القدرة على التعبير الجيني بطريقة سريعة والانضباطي، مع عدم وجود آثار خارج الهدف، تكون مفيدة. لقد شيدت سلالات الخميرة التي تحتوي على ACT1 مروج المنبع من شريط URA3 تليها المجال ملزم يجند من مستقبلات هرمون الاستروجين الإنسان وVP16. عن طريق تحويل هذه السلالة مع منتج PCR الخطية التي تحتوي على الحمض النووي ملزم مجال اختيار وضد وجود URA3، يمكن أن تتولد عامل النسخ الاصطناعية أعرب جوهري (ATF) من خلال إعادة التركيب مثلي. ATFs هندسيا في هذا الشكل يمكن تنشيط الجينات المستهدفة فريدة من نوعها في وجود محفز، وبالتالي القضاء على كل من التنشيط بعيدا عن الهدف وظروف النمو nonphysiological وجدت مع conditi استخدامانظم التعبير الجيني اونال. وتقدم أيضا هناك طريقة بسيطة لبناء السريع للالبلازميدات مراسل GFP التي تستجيب تحديدا إلى عامل النسخ الأصلية أو اصطناعية من الفائدة.

<html> ويبين الشكل 5 تحريض GFP بواسطة Z 3 EV، Z 4 EV، أو GEV مع مرور الوقت. ملاحظة الزيادة في الإنتاج GFP ردا على ATFs تحتوي على الحمض النووي nonyeast المجالات ملزمة. نحن تكهنت مؤخرا بأن هذه النتائج من هذه العوامل تحقيق خصوصية أحادية الجينات في جينوم الخميرة 1. GEV الاستقراء وحده يؤدي إلى تنشيط / القمع المئات من الجينات، بينما Z 3 EV وZ 4 EV تفعيل فقط التعبير عن الجينات المستهدفة وضعت المصب من المروج الاصطناعية التي تحتوي على مواقع الربط المناسبة (5&#39;-GCGTGGGCG-3 &#39;و5&#39;- GCGGCGGAGGAG-3 &quot;، على التوالي) 1. يوضح الشكل 7 تنظيم محكم للنظام (لا توجد نتائج محفز في أي كشف GFP) والتي تحصل بفعل كل الخلايا استجابة لمحفز قدرة Z 3 EV للحث GFP عبر مجموعة من وأظهرت تركيزات β-استراديول في الشكل 8. <html> الأنف والحنجرة &quot;FO: المحافظة على together.within صفحة =&quot; دائما &quot;&gt; <img alt="الشكل 1" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig1highres.jpg" src="/files/ftp_upload/51153/51153fig1.jpg" /> الشكل 1. عوامل النسخ الاصطناعي تتفاعل مع Hsp90 في غياب β-استراديول، وعندما يربط β-استراديول إلى ATF، Hsp90 تنأى، والسماح للATF لدخول النواة وتفعيل التعبير عن مراسل البلازميد. <img alt="الرقم 2" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig2highres.jpg" src="/files/ftp_upload/51153/51153fig2.jpg" /> الشكل 2. تخطيطي للبروتوكول للسلالات الهندسة التي تحتوي على عوامل النسخ الاصطناعي وبناء / اختبار صحفيين GFP وما شابه ذلك. load/51153/51153fig3highres.jpg &quot;سرك =&quot; / files/ftp_upload/51153/51153fig3.jpg &quot;/&gt; الرقم 3. تسلسل ACT1pr-URA3-EV في سلالة yMN15 في موضع LEU2. <img alt="الرقم 4" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig4highres.jpg" src="/files/ftp_upload/51153/51153fig4.jpg" /> الشكل 4. تصميم بادئات PCR لتضخيم مجال الحمض النووي ملزم في المصالح مع تسلسل تناظر إضافية لتوليد البروتين الانصهار جديدة عندما تحولت بنجاح في yMN15. <img alt="الرقم 5" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig5highres.jpg" src="/files/ftp_upload/51153/51153fig5.jpg" /> الرقم 5. GFP تحريض من قبل ثلاثة أزواج ATF-المروج مختلفة ردا على 1 ميكرومتر β-استراديول. &lt;/ ع&gt; <img alt="الرقم 6" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig6highres.jpg" src="/files/ftp_upload/51153/51153fig6.jpg" /> الرقم 6. وهناك سيناريو MATLAB لمعالجة تدفق البيانات الخلوي. وقد تم تكييف هذا البرنامج النصي من <a href="http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data">http://openwetware.org/wiki/McClean:_Matlab_Code_for_Analyzing_FACS_Data</a> . <img alt="الرقم 7" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig7highres.jpg" src="/files/ftp_upload/51153/51153fig7.jpg" /> وكان الرقم 7. تحريض GFP بواسطة Z 3 EV استجابة ل0 μ M β-استراديول و 1 ميكرومتر β-استراديول 18 ساعة التالية للتحريض الإسفار أيضا شركة طيران الشرق الأوسطتقاس من خلايا تفتقر GFP لتوضيح تنظيم محكم للنظام EV Z 3. تم إنشاء هذا الرقم باستخدام رمز في الشكل 6. <img alt="الرقم 8" fo:content-width="5in" fo:src="/files/ftp_upload/51153/51153fig8highres.jpg" src="/files/ftp_upload/51153/51153fig8.jpg" /> الرقم 8. تم تصنيف العلاقة بين تركيز محفز والإخراج التعبير مع معامل هيل من ~ 1 (أ) من التوزيعات GFP التعبير بوصفها وظيفة من تركيز β استراديول. (ب) مضان متوسط ​​التوزيعات من (A). وكانت البيانات يصلح لوظيفة G (D) = G + دقيقة (G-G ماكس دقيقة) D ن / (K + D ن ن) حيث D هو جرعة β استراديول، G و G دقيقة كحد أقصى هي الحد الأدنى و أقصى القيم GFP، الدقةpectively، n هو معامل هيل، وK هو جرعة β استراديول أن ينتج ½ (G + G ماكس دقيقة). <table border="0" cellpadding="0" cellspacing="0" fo:keep-together.within-page="always" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> تسلسل قليل النوكليوتيد </td><td> اسم </td></tr><tr><td> 5&#39;-TTGAAACCA AACTCGCCTCT-3 &#39; </td><td> DBD تحقق الأمام </td></tr><tr><td> 5&#39;-tccagagac ttcagggtgct-3 &#39; </td><td> DBD تحقق عكسي </td></tr></tbody></table> الجدول 1. الاشعال لتأكيد الانصهار الصحيح للDBD التي تهم مستقبلات الاستروجين. التمهيدي للمضي قدما هو مثلي المروج ACT1 والتمهيدي العكس هو مثلي لمستقبلات الاستروجين. لDBDs نموذجي (~ 300 سنة مضت)، والمنتج PCR هو &lt;1.5 كيلو بايت. <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> تسلسل قليل النوكليوتيد </td><td> اسم </td></tr><tr><td> 5&#39;-ggccgc ... DBD موقع نهم ... تي 3 &quot; </td><td> أعلى بنسبة ضئيلة </td></tr><tr><td> 5&#39;-ctaga ... موقع الحمض النووي ملزمة عكس ... GC-3 &#39; </td><td> بنسبة ضئيلة أسفل </td></tr><tr><td> 5&#39;دول مجلس التعاون الخليجي gcGTGGGCG T GCGTGGGCG G G CGTGGGCG T GCGTGGGCG G GCGTG GGCG T GCGTGGGCG تي 3 &#39; </td><td> أعلى بنسبة ضئيلة + 6X Zif268 مواقع الربط </td></tr><tr><td> 5&#39;-ctagaCGCCCACGCACGCCCACGCC CGCCCACGCACGCCCACGCCCGCC CACGCACGCCCACgc-3 &#39; </td><td> بنسبة ضئيلة أسفل + 6X Zif268 مواقع الربط </td></tr></tbody></table> الجدول 2. tructure S الاشعال لخلق dsDNA والتي تحتوي على مواقع الربط من الفائدة. لإنشاء Z 3-EV استجابة المروج، وأليغنوكليوتيد أعلى بنسبة ضئيلة + 6X Zif268 تجليد مواقع وبنسبة ضئيلة أسفل + 6X Zif268 استخدمت تجليد.تسلسل لخلق يتدلى الحمض النووي الصحيح في الصغيرة. وأكد الموقع Zif268 الإجماع الملزم، GCGTGGGCG، في أعلى بنسبة ضئيلة. <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> كاشف </td><td> مبلغ </td></tr><tr><td> T4 كيناز عديد النوكليوتيد العازلة </td><td> 5 ميكرولتر </td></tr><tr><td> T4 كيناز عديد النوكليوتيد (@ 10،000 وحدة / مل) </td><td> 1 ميكرولتر </td></tr><tr><td> أعلى بنسبة ضئيلة (100 ميكرومتر) </td><td> 1.5 ميكرولتر </td></tr><tr><td> بنسبة ضئيلة أسفل (100 ميكرومتر) </td><td> 1.5 ميكرولتر </td></tr><tr><td> ماء </td><td> 41 ميكرولتر </td></tr></tbody></table> الجدول 3. الفوسفات والاشعال يصلب في thermocycler باستخدام 50 ميكرولتر من رد الفعل المذكورة أعلاه. هناك نوعان من الخطوات thermocycler. الخطوة 1: 37 ° C 30 دقيقة (الفوسفات)، والخطوة 2: 95 ° C 30 ثانية (التنحي 1 ° C كل 30 ثانية حتى عند 4 درجة مئوية؛ يصلب). <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> كاشف </td><td> مبلغ </td></tr><tr><td> XbaI </td><td> 1 ميكرولتر </td></tr><tr><td> NOTI-HF </td><td> 1 ميكرولتر </td></tr><tr><td> البلازميد الحمض النووي </td><td> 5 ميكرولتر (1-2 ميكروغرام) </td></tr><tr><td> 10X قص الذكية العازلة </td><td> 5 ميكرولتر </td></tr><tr><td> ماء </td><td> 38 ميكرولتر </td></tr></tbody></table> الجدول 4. تقييد هضم البلازميد pMN8 مع XbaI وNOTI. <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr height="22" style="height:16.5pt"><td class="xl65" height="22" style="height:16.5pt;width:66pt" width="88"> كاشف </td><td class="xl66" style="width:66pt" width="88"> مبلغ </td></tr><tr height="43" style="height:32.25pt"><td> T4 يغاز BUFفر </td><td> 2 ميكرولتر </td></tr><tr height="22" style="height:16.5pt"><td> T4 يغاز </td><td> 0.2 ميكرولتر </td></tr><tr height="43" style="height:32.25pt"><td> العمود الفقري @ 10 نانوغرام / ميكرولتر </td><td> 1 ميكرولتر </td></tr><tr height="106" style="height:79.5pt"><td> ملزم متواليات @ 5X تركيز المولي / ميكرولتر </td><td> 1 ميكرولتر </td></tr><tr height="22" style="height:16.5pt"><td> ماء </td><td> 15.8 ميكرولتر </td></tr></tbody></table> الجدول 5. Ligate مواقع الربط في الحمض النووي البلازميد. <table border="0" cellpadding="0" cellspacing="0" width="176" style=";text-align:right;direction:rtl"><tbody><tr><td> كتاب تمهيدي </td><td> وصف </td></tr><tr><td> ~ 40 غليان المنبع من ATG + CGCACTTAACTTCGCATCTG-3 &#39; </td><td> التمهيدي إلى الأمام لتضخيم KanMX-المروج </td></tr><tr><td> 5&#39;عكس تكملة (ATG + ~ 37bp) + TATAGTTTTTTCTCCTTGACG-3 &#39; </td><td> عكس الحزب الثوري المؤسسيمير لتضخيم KanMX-المروج </td></tr><tr><td> 5&#39;-caatttgtctgctcaagaaaataaa ttaaatacaaataaaCGCAC TTAACTTCGCATCTG-3 &#39; </td><td> التمهيدي إلى الأمام لجعل مبادلة GCN4 المروج. </td></tr><tr><td> 5&#39;-tggatttaaagcaaataaacttgg ctgatattcggacatTATAGTT TTTTCTCCTTGACG-3 &#39; </td><td> عكس التمهيدي لصنع مبادلة GCN4 المروج. </td></tr></tbody></table> الجدول 6. PCR تضخيم KanMX-المروج لصنع أليل titratible.

Watch this Scientific Journal Video about Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters at JoVE.com

Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

يصف هذا البروتوكول إجراء التجارب لبناء السريع للعوامل النسخ الاصطناعي (ATFs) مع صحفيين GFP وما شابه ذلك والكمي للقدرة ATFs لتحفيز GFP التعبير عبر التدفق الخلوي.

التجميعي السريع وفحص عوامل النسخ المنشط كيميائيا مع مراسلون القائم GFP

Synthetic biology aims to rationally design and build synthetic circuits with desired quantitative properties, as well as provide tools to interrogate the ...

rapid-synthesis-screening-chemically-activated-transcription-factors

Research

Education

JoVE Journal

JoVE Core

Molecular Biology

Biology

Unit 1

Transcription: DNA to RNA

SCIENTISTS IN ACTION

14.4K Views.  Princeton University.  يصف هذا البروتوكول إجراء التجارب لبناء السريع للعوامل النسخ الاصطناعي (ATFs) مع صحفيين GFP وما شابه ذلك والكمي للقدرة ATFs لتحفيز GFP التعبير عبر التدفق الخلوي. 

Video: Rapid Synthesis and Screening of Chemically Activated Transcription Factors with GFP-based Reporters

Generation of Human CD40-activated B cells

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer immunotherapy 1-3. Compared to Dendritic cells (DCs), the best characterized APC, CD40-B cells have several distinct biological and technical properties. Similar to DCs, B cells show an increased expression of MHC and co-stimulatory molecules (Fig.1b), exhibit a strong migratory capacity and present antigen presentation efficiently to T cells, after stimulation with interleukin-4 and CD40 ligand (CD40L). However, in contrast to immature or mature DCs, CD40-B cells express the full lymph node homing triad consisting of CD62L, CCR7/CXCR4, and leukocyte function antigen-1 (LFA1, CD11a/CD18), necessary for homing to secondary lymphoid organs (Fig.1a) 3. CD40-B cells can be generated without difficulties from very small amounts of peripheral blood which can be further expanded in vitro to very large amounts of highly-pure CD40-B cells (&gt;109 cells per patient) from healthy donors as well as cancer patients (Fig.1c,d) 1,4. 
In this protocol we demonstrate how to obtain fully activated CD40-B cells from human PBMC. Key molecules for the cell culture are CD40 ligand, interleukin-4 (IL-4) and cyclosporin A (CsA), which are replenished in a 3-4 day culture cycle. For laboratory purposes CD40-stimulation is provided by NIH/3T3 cells expressing recombinant human CD40 ligand (tCD40L NIH/3T3) 5. To avoid contamination with non-transfected cells, expression of the human CD40 ligand on the transfectants has to be checked regularly (Fig.2). 
After 14 days CD40-B cell cultures consist of more than 95% pure B cells and an expansion of CD40-B cells over 65 days is frequently possible without any loss of function 1, 4. CD40-B cells efficiently take up, process and present antigens to T cells 6. They do not only prime na&#970;ve, but also expand memory T cells 7,8. CD40-activated B cells can be used to study B-cell activation, differentiation and function. Moreover, they represent a promising tool for therapeutic or preventive vaccination against tumors 9.

In this video we present the ex vivo generation and expansion of human CD40-activated B cells (CD40-B) from peripheral blood mononuclear cells (PBMC) by stimulation with CD40 ligand and interleukin-4.

جيل من الخلايا البشرية باء تنشيط CD40

CD40-activated B cells (CD40-B cells) have been identified as an alternative source of immuno-stimulatory antigen-presenting cells (APC) for cancer ...

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

مضان الفرز الخلية النباتية المنشط من Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes. However, many compounds identified in screens using cell culture models are often found to be toxic or pharmacologically inactive in vivo1-2. Screening in whole animal models can help avoid these pitfalls and streamline the path to drug development.
C. elegans is a multicellular model organism well suited for HTS. It is small (&lt;1 mm) and can be economically cultured and dispensed in liquids. C. elegans is also one of the most experimentally tractable animal models permitting rapid and detailed identification of drug mode-of-action3.
We describe a protocol for culturing and dispensing fluorescent strains of C. elegans for high-throughput screening of chemical libraries or detection of environmental contaminants that alter the expression of a specific gene. Large numbers of developmentally synchronized worms are grown in liquid culture, harvested, washed, and suspended at a defined density. Worms are then added to black, flat-bottomed 384-well plates using a peristaltic liquid dispenser. Small molecules from a chemical library or test samples (e.g., water, food, or soil) can be added to wells with worms. In vivo, real-time fluorescence intensity is measured with a fluorescence microplate reader. This method can be adapted to any inducible gene in C. elegans for which a suitable reporter is available. Many inducible stress and developmental transcriptional pathways are well defined in C. elegans and GFP transgenic reporter strains already exist for many of them4. When combined with the appropriate transgenic reporters, our method can be used to screen for pathway modulators or to develop robust biosensor assays for environmental contaminants. 
We demonstrate our C. elegans culture and dispensing protocol with an HTS assay we developed to monitor the C. elegans cap &#x2018;n&#x2019; collar transcription factor SKN-1. SKN-1 and its mammalian homologue Nrf2 activate cytoprotective genes during oxidative and xenobiotic stress5-10. Nrf2 protects mammals from numerous age-related disorders such as cancer, neurodegeneration, and chronic inflammation and has become a major chemotherapeutic target11-13.Our assay is based on a GFP transgenic reporter for the SKN-1 target gene gst-414, which encodes a glutathione-s transferase6. The gst-4 reporter is also a biosensor for xenobiotic and oxidative chemicals that activate SKN-1 and can be used to detect low levels of contaminants such as acrylamide and methyl-mercury15-16.

High-throughput Screening and Biosensing with Fluorescent C. elegans Strains

A procedure for liquid-based culturing and dispensing of C. elegans strains expressing fluorescent reporter proteins is described that does not require expensive sorting equipment. This approach can be applied to numerous inducible C. elegans genes for drug discovery or biosensing of contaminants.

الفرز الفائق الإنتاجية وBiosensing مع نيون C. ايليجانس سلالات

High-throughput screening (HTS) is a powerful approach for identifying chemical modulators of biological processes.  However, many compounds identified in ...

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron (dgn)-destabilized Green Fluorescent Protein (GFP)-based Reporter Protein

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. Maintenance of proteasome activity was implicated in many key cellular processes, like cell's stress response 3, cell cycle regulation and cellular differentiation 4 or in immune system response 5. The dysfunction of the ubiquitin-proteasome system has been related to the development of tumors and neurodegenerative diseases 4, 6. Additionally, a decrease in proteasome activity was found as a feature of cellular senescence and organismal aging 7, 8, 9, 10. Here, we present a method to measure ubiquitin-proteasome activity in living cells using a GFP-dgn fusion protein. To be able to monitor ubiquitin-proteasome activity in living primary cells, complementary DNA constructs coding for a green fluorescent protein (GFP)&#x2013;dgn fusion protein (GFP&#x2013;dgn, unstable) and a variant carrying a frameshift mutation (GFP&#x2013;dgnFS, stable 11) are inserted in lentiviral expression vectors. We prefer this technique over traditional transfection techniques because it guarantees a very high transfection efficiency independent of the cell type or the age of the donor. The difference between fluorescence displayed by the GFP&#x2013;dgnFS (stable) protein and the destabilized protein (GFP-dgn) in the absence or presence of proteasome inhibitor can be used to estimate ubiquitin-proteasome activity in each particular cell strain. These differences can be monitored by epifluorescence microscopy or can be measured by flow cytometry.

Monitoring of Ubiquitin-proteasome Activity in Living Cells Using a Degron dgn-destabilized Green Fluorescent Protein GFP-based Reporter Protein

A method to monitor ubiquitin-proteasome activity in living cells is described. A degron-destabilized GFP- (GFP-dgn) and a stable GFP-dgnFS fusion protein are generated and transduced into the cell using a lentiviral expression vector. This technique allows to generate a stable GFP-dgn/GFP-dgnFS expressing cell line in which ubiquitin-proteasome activity can be easily assessed using epifluorescence or flow cytometry.

رصد اليوبيكويتين-proteasome نشاط في الخلايا الحية باستخدام Degron (DGN)-زعزعة استقرار الأخضر نيون البروتين البروتين مراسل (GFP) على أساس

Proteasome is the main intracellular organelle involved in the proteolytic degradation of abnormal, misfolded, damaged or oxidized proteins 1, 2. ...

Synthesis of Nine-atom Deltahedral Zintl Ions of Germanium and their Functionalization with Organic Groups

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 Their redox chemistry is even younger, just about ten years old, but despite this short history these deltahedral clusters ions E9n- (E = Si, Ge, Sn, Pb; n = 2, 3, 4) have already shown interesting and diverse reactivity and have been at the forefront of rapidly developing and exciting new chemistry.3-6 Notable milestones are the oxidative coupling of Ge94- clusters to oligomers and infinite chains,7-19 their metallation,14-16,20-25 capping by transition-metal organometallic fragments,26-34 insertion of a transition-metal atom at the center of the cluster which is sometimes combined with capping and oligomerization,35-47 addition of main-group organometallic fragments as exo-bonded substituents,48-50 and functionalization with various organic residues by reactions with organic halides and alkynes.51-58 
This latter development of attaching organic fragments directly to the clusters has opened up a new field, namely organo-Zintl chemistry, that is potentially fertile for further synthetic explorations, and it is the step-by-step procedure for the synthesis of germanium-divinyl clusters described herein. The initial steps outline the synthesis of an intermetallic precursor of K4Ge9 from which the Ge94- clusters are extracted later in solution. This involves fused-silica glass blowing, arc-welding of niobium containers, and handling of highly air-sensitive materials in a glove box. The air-sensitive K4Ge9 is then dissolved in ethylenediamine in the box and then alkenylated by a reaction with Me3SiC&equiv;CSiMe3. The reaction is followed by electrospray mass spectrometry while the resulting solution is used for obtaining single crystals containing the functionalized clusters [H2C=CH-Ge9-CH=CH2]2-. For this purpose the solution is centrifuged, filtered, and carefully layered with a toluene solution of 18-crown-6. Left undisturbed for a few days, the so-layered solutions produced orange crystalline blocks of [K(18-crown-6)]2[Ge9(HCCH2)2]&bull;en which were characterized by single-crystal X-ray diffraction. 
The process highlights standard reaction techniques, work-up, and analysis towards functionalized deltahedral Zintl clusters. It is hoped that it will help towards further development and understanding of these compounds in the community at large.

We present the high-temperature synthesis of intermetallic precursors K4Ge9, their dissolution in ethylenediamine to form Ge94- deltahedral Zintl ions, and the reaction of the clusters with alkynes to form organo-Zintl ions. The latter are characterized by electrospray mass spectrometry in solutions and by single-crystal X-ray diffraction in the solid state.

توليف الأيونات تسعة ذرة Zintl Deltahedral من الجرمانيوم وFunctionalization مع المجموعات العضوية

Although the first studies of Zintl ions date between the late 1890's and early 1930's they were not structurally characterized until many years later.1,2 ...

Chromatin Interaction Analysis with Paired-End Tag Sequencing (ChIA-PET) for Mapping Chromatin Interactions and Understanding Transcription Regulation

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such architectures are not random and involve interactions between gene promoters and regulatory elements 13. The binding of transcription factors to specific regulatory sequences brings about a network of transcription regulation and coordination 1, 14. 
Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) was developed to identify these higher-order chromatin structures 5,6. Cells are fixed and interacting loci are captured by covalent DNA-protein cross-links. To minimize non-specific noise and reduce complexity, as well as to increase the specificity of the chromatin interaction analysis, chromatin immunoprecipitation (ChIP) is used against specific protein factors to enrich chromatin fragments of interest before proximity ligation. Ligation involving half-linkers subsequently forms covalent links between pairs of DNA fragments tethered together within individual chromatin complexes. The flanking MmeI restriction enzyme sites in the half-linkers allow extraction of paired end tag-linker-tag constructs (PETs) upon MmeI digestion. As the half-linkers are biotinylated, these PET constructs are purified using streptavidin-magnetic beads. The purified PETs are ligated with next-generation sequencing adaptors and a catalog of interacting fragments is generated via next-generation sequencers such as the Illumina Genome Analyzer. Mapping and bioinformatics analysis is then performed to identify ChIP-enriched binding sites and ChIP-enriched chromatin interactions 8. 
We have produced a video to demonstrate critical aspects of the ChIA-PET protocol, especially the preparation of ChIP as the quality of ChIP plays a major role in the outcome of a ChIA-PET library. As the protocols are very long, only the critical steps are shown in the video.

Chromatin Interaction Analysis with Paired-End Tag Sequencing ChIA-PET for Mapping Chromatin Interactions and Understanding Transcription Regulation

Chromatin Interaction Analysis by Paired-End Tag Sequencing (ChIA-PET) is a method for de novo detection of chromatin interactions, for better understanding of transcriptional control.

الكروماتين تحليل التفاعل مع تسلسل العلامات المقترنة النهائي (شيا-PET) لرسم خرائط التفاعلات الكروماتين وفهم تنظيم النسخ

Genomes are organized into three-dimensional structures, adopting higher-order conformations inside the micron-sized nuclear spaces 7, 2, 12. Such ...

Using Coculture to Detect Chemically Mediated Interspecies Interactions

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by secreting metabolites. These metabolites have the potential to modulate the physiology and differentiation of their microbial neighbors and are likely important factors in the establishment and maintenance of complex microbial communities. We have developed a fluorescence-based coculture screen to identify such chemically mediated microbial interactions. The screen involves combining a fluorescent transcriptional reporter strain with environmental microbes on solid media and allowing the colonies to grow in coculture. The fluorescent transcriptional reporter is designed so that the chosen bacterial strain fluoresces when it is expressing a particular phenotype of interest (i.e. biofilm formation, sporulation, virulence factor production, etc.) Screening is performed under growth conditions where this phenotype is not expressed (and therefore the reporter strain is typically nonfluorescent). When an environmental microbe secretes a metabolite that activates this phenotype, it diffuses through the agar and activates the fluorescent reporter construct. This allows the inducing-metabolite-producing microbe to be detected: they are the nonfluorescent colonies most proximal to the fluorescent colonies. Thus, this screen allows the identification of environmental microbes that produce diffusible metabolites that activate a particular physiological response in a reporter strain. This publication discusses how to: a) select appropriate coculture screening conditions, b) prepare the reporter and environmental microbes for screening, c) perform the coculture screen, d) isolate putative inducing organisms, and e) confirm their activity in a secondary screen. We developed this method to screen for soil organisms that activate biofilm matrix-production in Bacillus subtilis; however, we also discuss considerations for applying this approach to other genetically tractable bacteria.

Bacteria produce secreted compounds that have the potential to affect the physiology of their microbial neighbors. Here we describe a coculture screen that allows detection of such chemically mediated interspecies interactions by mixing soil microbes with fluorescent transcriptional reporter strains of Bacillus subtilis on solid media.

باستخدام Coculture لكشف كيميائيا وساطة بين الأنواع التفاعلات

In nature, bacteria rarely exist in isolation; they are instead surrounded by a diverse array of other microorganisms that alter the local environment by ...

Rapid and Efficient Zebrafish Genotyping Using PCR with High-resolution Melt Analysis

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic tools have been introduced, including multiple strategies for inducing mutations and generating transgenic lines. However, large-scale screening is limited by traditional genotyping methods, which are time-consuming and labor-intensive. Here we describe a technique to analyze zebrafish genotypes by PCR combined with high-resolution melting analysis (HRMA).&#160;This approach is rapid, sensitive, and inexpensive, with lower risk of contamination artifacts.&#160;Genotyping by PCR with HRMA can be used for embryos or adult fish, including in high-throughput screening protocols.

PCR combined with high-resolution melt analysis (HRMA) is demonstrated as a rapid and efficient method to genotype zebrafish.

سريعة وفعالة الزرد التنميط الجيني باستخدام PCR عالية الدقة مع تحليل نذوب

Zebrafish is a powerful vertebrate model system for studying development, modeling disease, and performing drug screening. Recently a variety of genetic ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

الإنتاجية العالية للكشف عن المغيرون الكيميائية من الجينات المشاركة ما بعد transcriptionally الخاضعة للرقابة

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder (ALLIGATOR)

Luciferase-based reporters of cellular gene expression are in widespread use for both longitudinal and end-point assays of biological activity. In circadian rhythms research, for example, clock gene fusions with firefly luciferase give rise to robust rhythms in cellular bioluminescence that persist over many days. Technical limitations associated with photomultiplier tubes (PMT) or conventional microscopy-based methods for bioluminescence quantification have typically demanded that cells and tissues be maintained under quite non-physiological conditions during recording, with a trade-off between sensitivity and throughput. Here, we report a refinement of prior methods that allows long-term bioluminescence imaging with high sensitivity and throughput which supports a broad range of culture conditions, including variable gas and humidity control, and that accepts many different tissue culture plates and dishes. This automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) also allows the observation of spatial variations in luciferase expression across a cell monolayer or tissue, which cannot readily be observed by traditional methods. We highlight how the ALLIGATOR provides vastly increased flexibility for the detection of luciferase activity when compared with existing methods.

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder ALLIGATOR

Genetically encoded luciferase is a popular non-invasive reporter of gene expression. Use of an automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) enables longitudinal recording from bioluminescent cells under a wide range of conditions. Here we show how ALLIGATOR may be used in the context of circadian rhythms research.