وأيد هذا العمل من قبل الوطنية للملاحة الجوية والفضاء إدارة ولاية فرجينيا الغربية الفضاء غرانت اتحاد (ناسا WVSGC)، ومؤسسة التليف الكيسي (CFF-YU11G0) والمعاهد الوطنية للصحة وP20RR016477 P20GM103434 لشبكة فكرة ولاية فرجينيا الغربية للتميز بحوث الطبية الحيوية. نشكر Vonya M. Eisinger للمساعدة التقنية مع هذا العمل.

1. إعداد سلالات البكتيرية ومتحدر من والدين إختبارات <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تطعيم E. القولونية SM10/λpir/pFAC في 5 مل من مرق لوريا (LB) تستكمل مع 15 ميكروغرام / مل من الجنتاميسين ومكان في حاضنة تهتز بين عشية وضحاها في 37 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> تطعيم P. الزنجارية سلالة PAO1 في 5 مل من LB، ومكان في حاضنة تهتز بين عشية وضحاها في 42 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> قياس OD 600 من الثقافات بين عشية وضحاها وتخلط كميات متساوية من PAO1 وE. القولونية pFAC مثل أن الحجم النهائي بين 1-1،4 مل. </li><li style=";text-align:right;direction:rtl"> خليط أجهزة الطرد المركزي في 6000 x ج لمدة 5 دقائق. </li><li style=";text-align:right;direction:rtl"> وفي الوقت نفسه، تجف لوحات LB للاقتران: ترك لوحات مفتوحة في حاضنة عند 37 درجة مئوية لمدة 10-15 دقيقة. </li><li style=";text-align:right;direction:rtl"> إزالة كافة ولكن 50 ميكرولتر من طاف من خليط الخلية. </li><li style=";text-align:right;direction:rtl"> resuspend الكرية خلية في 50 ميكرولتر المتبقية من طاف وماصة على لوحة LB جافة في قطرة واحدة مدمجة. </li><li style=";text-align:right;direction:rtl"> وضع بعناية لوحة في غطاء الدخان لتجف (IMPORTANT ملاحظة: لا تدع خلايا موزعة على اللوحة، وهذا سوف يقلل بشكل كبير من كفاءة تصريف الافعال). </li><li style=";text-align:right;direction:rtl"> مرة واحدة الحبرية جافة، عكس لوحة LB واحتضان عند 37 درجة مئوية لمدة 4-6 ساعة. </li><li style=";text-align:right;direction:rtl"> في حين أن خليط الخلايا واحتضان، وإعداد كبيرة (150 OD × 15 مم) لوحات مع PIA 300 ميكروغرام / مل من الجنتاميسين. قبل الاستخدام، وإزالة أي الرطوبة المتبقية عن طريق وضع في حاضنة عند 37 درجة مئوية لمدة 15-20 دقيقة. </li><li style=";text-align:right;direction:rtl"> بعد الحضانة من الخليط خلية كاملة، وجمع الخلايا باستخدام التلقيح حلقة عقيمة وفي أنبوب microcentrifuge تحتوي على 1 مل LB ودوامة، أو ماصة، لتخلط جيدا. </li><li style=";text-align:right;direction:rtl"> تنتشر الخلايا بالتساوي على لوحات كبيرة تحتوي على PIA 300 ميكروغرام / مل جنتاميسين. (هام: للحصول على هذه الخطوة، فمن الأفضل لإضافة كميات متزايدة من خليط الخلية لفصل الصفائح (مثل لوحة 1: 10 ميكرولتر، لوحة 2: 50 ميكرولتر، لوحة 3: 100 ميكرولتر، لوحة 4: 500 ميكرولتر، الخ) . </li><li style=";text-align:right;direction:rtl"> احتضان بين عشية وضحاها في 37° C. </li></ol> 2. كشف وعزل المستعمرات موكويد <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إزالة لوحات من الحاضنة ودراسة للمستعمرات مخاطية. </li><li style=";text-align:right;direction:rtl"> عزل مستعمرة مخاطي واحد ومتتالية للعزلة على لوحات صغيرة (100 OD × 10 ملم) مع PIA و 300 ميكروغرام / مل من الجنتاميسين. </li><li style=";text-align:right;direction:rtl"> احتضان بين عشية وضحاها في 37 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> كرر الخطوة 2.2 على الثقافة بين عشية وضحاها السابقة. </li><li style=";text-align:right;direction:rtl"> كرر الخطوات من 2،2-2،4 مرتين أخريين لتحديد استقرار عزل مخاطي. </li><li style=";text-align:right;direction:rtl"> بعد الخطوة عزل النهائي، تطعيم 4.5 مل من LB مع مستعمرة مخاطي واحد واحتضان بين عشية وضحاها في شاكر في 37 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> اليوم التالي، والتسمية 3 أنابيب microcentrifuge لكل متحولة مخاطي. </li><li style=";text-align:right;direction:rtl"> إعداد اثنين من 1.25 مل aliquots من الثقافة بين عشية وضحاها إلى 2 أنابيب لاستخراج الحمض النووي الجيني وتحديد الموقع ينقول الإدراج (انظر البروتوكول 3). </li><li style=";text-align:right;direction:rtl"> بالإضافة إلى ذلك، أرشفة كل متحولة مخاطي من قبل pipetting 1 مل الثقافة بين عشية وضحاها إلى appropriatcryovial المسمى اعل المحتوية على حجم مساو من 10٪ الحليب الخالي من الدسم. المحل في -86 درجة مئوية. </li></ol> 3. gDNA تقييد الهضم وربط <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> استخراج gDNA من متحولة مخاطي باستخدام أي أسلوب المفضل (على سبيل المثال. الفينول كلوروفورم، عمود الدوران، الخ). </li><li style=";text-align:right;direction:rtl"> تحديد تركيز gDNA، هضم ما مجموعه 2 ميكروغرام مع 1 ميكرولتر من نوكلياز داخلية تقييد سالي، 0.5 ميكرولتر من ألبومين المصل البقري، 5 ميكرولتر من العازلة سالي انزيم (100 ملي مول كلوريد الصوديوم، و 50 ملي تريس، حمض الهيدروكلوريك، 10 ملي MgCl 2 ، 1 ملم Dithiothrietol (DTT)، ودرجة الحموضة 7.9 في درجة حرارة الغرفة)، وحجم مناسب من DH 2 O لتحقيق إجمالي حجم 50 ميكرولتر. </li><li style=";text-align:right;direction:rtl"> هضم الحمض النووي بين عشية وضحاها في 37 درجة مئوية. (هام: اعتمادا على كفاءة انزيم التقييد، فإنه قد يكون من الضروري إضافة 1 ميكرولتر إضافية للهضم واحتضان بين عشية وضحاها في 37 درجة مئوية لمدة 1-2 ساعة هذا بالإضافة إلى ملخص ليلة وضحاها.) </li><li style=";text-align:right;direction:rtl"> تنقية DIGEالحمض النووي STED باستخدام أي أسلوب المفضل (مثل الاغاروز هلام تنقية، والأعمدة تدور) وأزل مع 25 ميكرولتر من العازلة. </li><li style=";text-align:right;direction:rtl"> Ligate الحمض النووي يهضم عن طريق خلط 11 ميكرولتر من الحمض النووي المنقى مع التركيز المفضل لل~ 10-20 نانوغرام / ميكرولتر، 1.5 ميكرولتر من العازلة ربط (330 ملي تريس، ودرجة الحموضة 7.5 خلات، 660 ملي خلات البوتاسيوم، المغنيسيوم خلات 100 ملم، 5 ملم DTT)، 1.5 ميكرولتر من 100 ملي ATP و 1 ميكرولتر الحمض النووي يغاز. </li><li style=";text-align:right;direction:rtl"> احتضان الخليط لمدة 15 دقيقة في درجة حرارة الغرفة، ومن ثم تعطيل انزيم التي يحتضنها لمدة 15 دقيقة عند 70 درجة مئوية. (ملاحظة: احتضان الخليط في درجة حرارة الغرفة لمدة أطول قد تزيد من نجاح عملية ربط). </li></ol> 4. العكسية PCR (iPCR) وتحليل تسلسل <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> أداء iPCR على المنتج ربط باستخدام التالية إلى الأمام وعكس الاشعال والتدوير الحراري thermocycling الشروط: إلى الأمام التمهيدي (Gm3OUT): GGGCATACGGGAAGAAGTGA -عكسي التمهيدي (Gm5OUT): GACTGCCCTGCTGCGTAACA Thermocycler كونديستعقد: 1. 94 درجة مئوية لمدة 1 دقيقة. 2. 94 درجة مئوية لمدة 1 دقيقة. 3. 58 درجة مئوية لمدة 2 دقيقة. 4. 72 درجة مئوية لمدة 2 دقيقة. 5. 72 درجة مئوية لمدة 8 دقائق. 6. 10 ° C الانتظار. كرر الخطوات من 2-4 لمدة 34 دورات. (ملاحظة: يمكن تخزين المنتجات أسهب iPCR في 4 درجات مئوية) </li><li style=";text-align:right;direction:rtl"> أداء الاغاروز الكهربائي للهلام لتأكيد نجاح iPCR التضخيم. </li><li style=";text-align:right;direction:rtl"> أداء التسلسل على المنتج iPCR باستخدام Gm3OUT وGm5OUT الاشعال. يتم تعيين موقع الإدراج وتوجه himar1 بها. </li></ol>

<ol>
	<li>Govan, J. R., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+pathogenesis+in+cystic+fibrosis:+mucoid+Pseudomonas+aeruginosa+and+Burkholderia+cepacia.">Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.</a> Microbiol. Rev. 60, 539-574 (1996).</li><li>Chitnis, C. E., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+the+alginate+biosynthetic+gene+cluster+of+Pseudomonas+aeruginosa+shows+evidence+of+an+operonic+structure.">Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure.</a> Mol. Microbiol. 8, 583-593 (1993).</li><li>Franklin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+AlgG+is+a+polymer+level+alginate+C5-mannuronan+epimerase.">Pseudomonas aeruginosa AlgG is a polymer level alginate C5-mannuronan epimerase.</a> J. Bacteriol. 176, 1821-1830 (1994).</li><li>Franklin, M. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutant+analysis+and+cellular+localization+of+the+AlgI,+AlgJ,+and+AlgF+proteins+required+for+O+acetylation+of+alginate+in+Pseudomonas+aeruginosa.">Mutant analysis and cellular localization of the AlgI, AlgJ, and AlgF proteins required for O acetylation of alginate in Pseudomonas aeruginosa.</a> J. Bacteriol. 184, 3000-3007 (2002).</li><li>Deretic, V., Gill, J. F., Chakrabarty, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+algD+coding+for+GDPmannose+dehydrogenase+is+transcriptionally+activated+in+mucoid+Pseudomonas+aeruginosa.">Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.</a> J. Bacteriol. 169, 351-358 (1987).</li><li>Mathee, K., McPherson, C. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+the+algT+(algU)-encoded+sigma22+for+expression+of+the+alginate+regulon+in+Pseudomonas+aeruginosa+and+localization+of+its+antagonist+proteins+MucA+and+MucB+(AlgN)..">Posttranslational control of the algT (algU)-encoded sigma22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN)..</a> J. Bacteriol. 179, 3711-3720 (1997).</li><li>Boucher, J. C., Schurr, M. J., Yu, H., Rowen, D. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+in+cystic+fibrosis:+role+of+mucC+in+the+regulation+of+alginate+production+and+stress+sensitivity.">Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity.</a> Microbiology. 143, 3473-3480 (1997).</li><li>Martin, D. W., Holloway, B. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+locus+determining+the+mucoid+status+of+Pseudomonas+aeruginosa:+AlgU+shows+sequence+similarities+with+a+Bacillus+sigma+factor.">Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: AlgU shows sequence similarities with a Bacillus sigma factor.</a> J. Bacteriol. 175, 1153-1164 (1993).</li><li>Damron, F. H., Goldberg, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteolytic+regulation+of+alginate+overproduction+in+Pseudomonas+aeruginosa.">Proteolytic regulation of alginate overproduction in Pseudomonas aeruginosa.</a> Mol. Microbiol. 84 (4), 595-607 (2012).</li><li>Browne, P., Barret, M., O'Gara, F., Morrissey, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+prediction+of+the+Crc+regulon+identifies+genus-wide+and+species-specific+targets+of+catabolite+repression+control+in+Pseudomonas+bacteria.">Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria.</a> BMC Microbiol. 10, 300 (2010).</li><li>Damron, F. H., Qiu, D., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pseudomonas+aeruginosa+sensor+kinase+KinB+negatively+controls+alginate+production+through+AlgW-dependent+MucA+proteolysis.">The Pseudomonas aeruginosa sensor kinase KinB negatively controls alginate production through AlgW-dependent MucA proteolysis.</a> J. Bacteriol. 191, 2285-2295 (2009).</li><li>Damron, F. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pseudomonas+aeruginosa+regulon+controlled+by+the+sensor+kinase+KinB+and+sigma+factor+RpoN.">Analysis of the Pseudomonas aeruginosa regulon controlled by the sensor kinase KinB and sigma factor RpoN.</a> J. Bacteriol. 194, 1317-1330 (2012).</li><li>Qiu, D., Eisinger, V. M., Rowen, D. W., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+proteolysis+controls+mucoid+conversion+in+Pseudomonas+aeruginosa.">Regulated proteolysis controls mucoid conversion in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 104, 8107-8112 (2007).</li><li>Schurr, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Which+bacterial+biofilm+exopolysaccharide+is+preferred,+Psl+or+alginate.">Which bacterial biofilm exopolysaccharide is preferred, Psl or alginate.</a> J. Bacteriol. 195, 1623-1626 (2013).</li><li>Wong, S. M., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+footprinting+with+mariner-based+transposition+in+Pseudomonas+aeruginosa.">Genetic footprinting with mariner-based transposition in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 10191-10196 (2000).</li><li>Lampe, D. J., Akerley, B. J., Rubin, E. J., Mekalanos, J. J., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hyperactive+transposase+mutants+of+the+Himar1+mariner+transposon.">Hyperactive transposase mutants of the Himar1 mariner transposon.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 11428-11433 (1999).</li></ol>

المؤلف هونغ وى D. يو هو موظف العلوم رئيس وأحد مؤسسي تكاثر مبكر تكنولوجيز، ذ.

من المهم أن نلاحظ أن هذه الطريقة يمكن استخدامها في الأنواع الأخرى الزائفة مع هذه التعديلات: احتضان P. المتألقة وP. الكريهة عند 30 درجة مئوية، وP. الشتوتسرية في 42 درجة مئوية، P. stuzeri ينبغي مثقف على لوحات LB تستكمل مع 150 ميكروغرام / مل من الجنتاميسين؛ على خطوة 1.11، P. ينبغي نقل الخلايا الشتوتسرية إلى 500 ميكرولتر من LB بدلا من 1 مل. بالإضافة إلى ذلك، هناك نوعان من الخطوات الحاسمة لهذا البروتوكول. أولا، يجب أن يكون مثقف سلالة المتلقي في درجة حرارة مناسبة. على سبيل المثال، PAO1 ينبغي حضنت في 42 درجة مئوية إلى زيادة وتيرة إعادة التركيب 15. كفاءة مكتبة متحولة انخفض بشكل كبير إذا كانت سلالة المتلقي إن لم يكن مثقف في درجة الحرارة الصحيحة. الثانية، iPCR هو تكرار للغاية، ولكن يجب أن يتم هضمها gDNA تماما لجعل ضمان أن الحمض النووي تساهميا مغلقة دائرية يمكن أن يتم من خلال ربط الحمض النووي. أناو يتم ذلك بشكل صحيح، فإن المنتج iPCR تظهر الفرقة واحدة على هلام الاغاروز. إذا تم تحديد نطاقات متعددة، فإنها تشير إلى أن هناك الإدراج متعددة في متحولة. وجدنا أن النتائج iPCR كانت مرتبطة بقوة مع نتائجنا طخة الجنوبية (~ 100٪). وبالتالي، iPCR يمكن استخدامها في مكان تحليل لطخة جنوب لعدد من عمليات الإدراج في متحولة. في بحار ينقول مصغرة himar1 في pFAC لا يوجد لديه فاصل النسخي، ويتم تنظيم ذلك عن طريق σ المروج 70 التي تعتمد على القيادة والتعبير عن الكاسيت الجنتاميسين. لاحظنا أن موقف وتوجه الإدراج himar1 قد آثار متفاوتة على تنظيم جينات معينة. تم المعطل الجينات عند دمجها في منتصف الجين. مثال على ذلك هو تعطيل للالحسية kinB كيناز الجين (PA5484) الذي يؤدي إلى التحويل إلى mucoidy في PAO1 (PAO1-VE13) 11. بالإضافة إلى ذلك، فإنه يمكن أيضا شف تنظيم التعبير عن الجينات، في حالة إدخالها المنبع من المنطقة الترميز في نفس التوجه كما الجين. مثال على ذلك هو PAO1-كتبها Ve2، حيث يدفع himar1 التعبير عن mucE (PA4033) 13. الحد من هذا البروتوكول هو أن الجينات التنظيمية الوحيدة التي هي غير الأساسية للنمو يمكن تحديدها. بالإضافة إلى ذلك، هذه المسوخ مخاطي تحديدها باستخدام هذه الطريقة قد لا يحدث بشكل طبيعي.

قدرة الانتهازية، الممرض سالبة الجرام الزائفة الزنجارية لتحفيزه على إنتاج الجينات هو أحد العوامل الرئيسية في قدرتها على إنشاء بيوفيلم. الافراط في الجينات هو النمط الظاهري غالبا ما يشار إليها باسم mucoidy. عزل مستعمرات مخاطية من sputa الأفراد المصابين بالتليف الكيسي (CF) يدل على وجود عدوى مزمنة، ويرتبط مباشرة مع الانخفاض العام في صحة المريض 1. حاليا، فمن المفهوم أن تنظيم وإنتاج الجينات في P. الزنجارية يحدث في المقام الأول على اثنين من operons. الأول هو الاوبرون السكروز الجينات، والذي يحتوي على 12 الجينات (algD - alg8 - alg44 - algK - الالم - algG - algX - algL - ALGI - algJ - algF - الطحالب) التي هي المسئولة عن تصنيع وتصدير البوليمر الجينات عبر والجبلة المحيطية إلى خارج الخلية environmeالإقليم الشمالي 2-5. والاوبرون الثاني هو مجموعة من الجينات التي تبدأ مع عامل سيغما بديل ALGU / T والمستمر مع mucA، mucB، وmucD. ALGU / T هو منظم إيجابية، في حين تصنف mucAB-D كما المنظمين السلبية لإنتاج الجينات 6-8. بالإضافة إلى ذلك، والمنظمين النسخي، مثل AlgB، AlgQ، الغر، وRpoN، وكذلك في مرحلة ما بعد النسخي وتعديل آخر متعدية عن طريق التحكم القمع مقيضة، والنشاط كيناز (KinB) والتحلل البروتيني intramembrane، وأيضا ثبت أن تشارك في الجينات تنظيم 9-14. تم إنشاء ينقول ناقلات صغيرة himar1 المعروفة باسم pFAC أصلا في مختبر الدكتور Mekalanos &#39;في كلية هارفارد الطبية 15. يتكون البلازميد pFAC عنصر القابلة للنقل يحيط بها اثنان يكرر مقلوب من 27 نقطة أساس وكاسيت الجنتاميسين المقاومة في الوسط (aacC1: 534 بي بي)، جين ترميز hyperactإيف transposase مارينر 16، والجينات ترميز β-اكتاماز (بلوخ) (الشكل 1). تسلسل المعلومات عن العنصر القابلة للنقل من pFAC متاح في عدد انضمام بنك الجينات: DQ366300 13. في pFAC، هناك موقع استنساخ متعددة (MCS) وراء الجينات aacC1 والذي يستخدم لتحديد موقع الإدراج الكروموسومات باستخدام العكسية PCR. واحدة ميزة كبيرة مع استخدام ينقول مصغرة himar1 هو ليس هناك حاجة لعوامل المضيف محددة للتبديل (الطفرات). بالإضافة إلى ذلك، هناك وفرة عالية من TA المواقع الإدراج ثنائي النوكليوتيد جدت في جميع أنحاء الجينوم من P. الزنجارية. على سبيل المثال، TA المواقع ثنائي النوكليوتيد الإدراج يحدث و94404 100229 مرات في PAO1 (6264404 بت في الثانية، بنك الجينات عدد الانضمام NC_002516.2) وPA14 (6537648 بت في الثانية؛ رقم الوصول بنك الجينات NC_008463) الجينوم، على التوالي. بسبب وفرة من TA ثنائي النوكليوتيد في الجينوم، ميني himar1 </em&gt; ينقول يمكن أن يسبب عالية الكثافة والطفرات العشوائية، والتي هي مناسبة خاصة لتحليل الجينات الفوعة والجينات التي تنظم للغاية. نظريا، يمكن للينقول مصغرة himar1 إدراجها في أي الجينات غير الضرورية داخل جينوم P. الزنجارية. وهذا يوفر مواقع الإدراج TA حوالي 18 في إطار القراءة المفتوح في الجينوم PAO1. هنا، نحن تصف البروتوكول باستخدام مصغرة himar1 بوساطة الطفرات ينقول لتحديد المنظمين رواية mucoidy في P. الزنجارية. وبشكل أكثر تحديدا، ونحن مترافق biparentally متجه pFAC تحتوي على ينقول مصغرة himar1 من E. القولونية SM10/λpir في nonmucoid أنموذجية التغذي سلالة PAO1. بعد دمج ينقول في الجينوم، سلالة المتلقي هو مثقف على الزائفة عزلة أجار (PIA) التي تحتوي على التريكلوسان الذي يمنع نمو E. القولونية. وبالتالي، مكتبة من المسوخ من <em&gt; P. يمكن اختيار الزنجارية من النمو على PIA وحة تستكمل مع الجنتاميسين وجود النمط الظاهري مخاطي. ملاحظة، صحيح سوف مقابل ومتحولة التكامل بوساطة ينقول يكون النمط الظاهري المقاومة والحساسة للكربنيسيلين الجنتاميسين. في هذه الدراسة، تم عزل ما يقرب من 80،000 من المسوخ الإدراج PAO1 من خلال أربعة الإقتران منفصلة. نحن بعد ذلك فرزها لعزلات مخاطي، وتحديد موقع من قبل الإدراج تقييد انزيم الهضم، وربط والعكسية PCR. أجرينا تحليل لطخة الجنوبية باستخدام المقاومة كاسيت الجنتاميسين كما تحقيقا لرؤية عدد من الإدراج في الجينوم. توصلنا إلى أن أكثر من 90٪ من المسوخ التي تم الحصول عليها في الاقتران باستخدام هذا البروتوكول لم يحصل إلا على نسخة واحدة من himar1 في الجينوم وعرض النمط الظاهري المقاومة والحساسة للكربنيسيلين الجنتاميسين. وقد تم تحديد ما مجموعه 32 عزلات مخاطي، تم تعيين 22 منهم إلى مواضع مختلفة من P. الزنجارية PAO1كروموسوم. هذا المعدل من الإدراج توفر تغطية كافية لتحديد العديد من المنظمين رواية من الإفراط الجينات.

<table><tbody><tr><td>Luria Broth</td><td>Difco</td><td>240230</td><td>via Fisher Scientific</td></tr><tr><td>&lt;em&gt;Pseudomonas&lt;/em&gt; isolation agar</td><td>Difco</td><td>292710</td><td>via Fisher Scientific</td></tr><tr><td>Small Plates (100 O.D. x 10 mm)</td><td>Fisher Scientific</td><td>08-757-13</td><td></td></tr><tr><td>Large Plates (150 O.D. x 15 mm)</td><td>Fisher Scientific</td><td>08-757-14</td><td></td></tr><tr><td>Glycerol</td><td>Fisher Scientific</td><td>BP229-4</td><td></td></tr><tr><td>Benchtop Shaking Incubator</td><td>New Brunswick Scientific</td><td>Innova 4080</td><td>shake at 200 rpm</td></tr><tr><td>Cabinet Incubator</td><td>VWR</td><td>1540</td><td></td></tr><tr><td>Benchtop Microcentrifuge</td><td>Sorvall</td><td>75-003-287</td><td>via Fisher Scientific</td></tr><tr><td>SmartSpec Plus Spectrophotometer</td><td>Bio-Rad</td><td>170-2525</td><td>or preferred method/vendor</td></tr><tr><td>Diposable Inoculation Loops</td><td>Fisher Scientific</td><td>22-363-597</td><td></td></tr><tr><td>1.5 ml Microcentrifuge Tubes</td><td>Fisher Scientific</td><td>05-408-129</td><td></td></tr><tr><td>2.0 ml Cryogenic Vials</td><td>Corning</td><td>430659</td><td>via Fisher Scientific</td></tr><tr><td>15 ml Tubes</td><td>Fisher Scientific</td><td>05-539-12</td><td></td></tr><tr><td>Skim Milk</td><td>Difco</td><td>DF0032-17-3</td><td>via Fisher Scientific</td></tr><tr><td>DNeasy Blood and Tissue (250)&amp;nbsp;</td><td>Qiagen</td><td>69506</td><td>or preferred method/vendor</td></tr><tr><td>QIAquick PCR Purification Kit (250)</td><td>Qiagen</td><td>28106</td><td>or preferred method/vendor</td></tr><tr><td>QIAprep Spin Miniprep Kit (250)&amp;nbsp;</td><td>Qiagen</td><td>27106</td><td>or preferred method/vendor</td></tr><tr><td>FastLink II DNA Ligation Kit</td><td>Epicentre Technologies</td><td>LK6201H</td><td>via Fisher Scientific</td></tr><tr><td>Accu block Digital Dry Bath&amp;nbsp;</td><td>Labnet</td><td>NC0205808</td><td>via Fisher Scientific</td></tr><tr><td>Sal1, restriction endonuclease</td><td>New England BioLabs</td><td>R0138L</td><td></td></tr><tr><td>EasyStart Micro 50</td><td>Molecular BioProducts</td><td>6020</td><td>via Fisher Scientific</td></tr><tr><td>Taq DNA Polymerase</td><td>New England BioLabs</td><td>M0267L</td><td></td></tr><tr><td>iCycler, Thermocycler</td><td>Bio-Rad</td><td>170-8740</td><td></td></tr><tr><td>LE agarose</td><td>Genemate</td><td>3120-500</td><td>via Fisher Scientific</td></tr><tr><td>Gentamycin Sulfate</td><td>Fisher Scientific</td><td>BP918-1</td><td></td></tr><tr><td>2.0 ml Cryogenic Vials</td><td>Corning</td><td>430659</td><td>via Fisher Scientific</td></tr></tbody></table>

identification of novel genes associated with alginate production in pseudomonas aeruginosa using mini-himar1 mariner transposon-mediated mutagenesis

الزائفة الزنجارية هي سالبة الجرام، بكتيريا البيئية مع قدرات التمثيل الغذائي تنوعا. P. الزنجارية هو الممرض الانتهازية البكتيرية التي تنص على الالتهابات الرئوية المزمن في المرضى الذين يعانون من التليف الكيسي (CF). الافراط في السكاريد المحفظة تسمى الجينات، والمعروف أيضا باسم mucoidy، ويشجع على تشكيل الأغشية الحيوية مخاطي التي هي أكثر مقاومة من خلايا العوالق للعلاج الكيميائي للمضادات الحيوية ودفاعات المضيف. بالإضافة إلى ذلك، التحويل من nonmucoid إلى النمط الظاهري مخاطي هو علامة السريرية لظهور عدوى مزمنة في CF. الإفراط الجينات التي كتبها P. الزنجارية هي عملية ماص للطاقة التي ضرائب ثقيلة على الطاقة الخلوية. لذلك، يتم تنظيم الجينات في إنتاج عالية P. الزنجارية. من أجل فهم أفضل تنظيم الجينات، وصفنا بروتوكول باستخدام مصغرة himar1 ينقول الطفرات لتحديد الجينات منظم الروايةق في سلالة PAO1 prototypic. يتكون هذا الإجراء من خطوتين أساسيتين. أولا، ونقل ينقول مصغرة himar1 (pFAC) من المضيف E. القولونية SM10/λpir إلى المتلقي P. الزنجارية PAO1 عبر اقتران متحدر من والدين لإنشاء مكتبة متحولة عالية الكثافة الإدراج، والتي تم اختيارها على لوحات الزائفة عزلة أجار تستكمل مع الجنتاميسين. ثانيا، نحن فحص وعزل مستعمرات مخاطية لرسم خريطة للموقع من خلال الإدراج العكسية PCR باستخدام بادئات الحمض النووي لافتا إلى الخارج من الكاسيت الجنتاميسين وتسلسل الحمض النووي. باستخدام هذا البروتوكول، حددنا اثنين من المنظمين رواية الجينات، mucE (PA4033) وkinB (PA5484)، في سلالة PAO1 مع البرية من نوع mucA ترميز عامل مكافحة سيغما MucA للسيد الجينات منظم ALGU (AlgT، σ 22) . يمكن تعديل هذا البروتوكول الطفرات الإنتاجية العالية لتحديد الجينات الأخرى ذات الصلة الفوعة تسبب تغيير في كولونيويورك التشكل.

كما هو موضح في الشكل 1، وبحار ينقول ناقلات صغيرة himar1، pFAC، يحتوي على اثنين من 27 سنة مضت يكرر مقلوب مع مواقع الإدراج TA المرافقة المقاومة aacC1 الجنتاميسين كاسيت، مع σ المروج 70 التابعة لها، وموقع الاستنساخ متعددة (MCS). بالإضافة إلى ذلك، يحتوي pFAC ناقلات الجينات ترميز transposase نشطة للغاية himar1، β-اكتاماز (جيش تحرير بلوشستان)، ونقل الاوبرون هيئة تنظيم الاتصالات. المواقع الإدراج TA تسمح للتكامل فعال في جينوم P. سلالات الزنجارية. الدقة في تحديد واختيار المسوخ مخاطي أمر بالغ الأهمية لنجاح الكلية في تحديد مواضع الجينات المعنية مع تنظيم الجينات. وترد أمثلة من العزلات مخاطي وnonmucoid في الشكل 1. لتحديد أكثر دقة المسوخ مخاطي، ينبغي مطلي الإقتران الانتهاء على لوحات كبيرة متعددة (150 ملم). وميجب معلق مخاليط ليرة لبنانية في برنامج تلفزيوني العقيمة ومطلي من خلال نشر على لوحات PIA زائد الجنتاميسين (300 ميكروغرام / مل). سيتم نشر التخفيفات من خليط الخلية في برنامج تلفزيوني على لوحات مع الهدف من وجود بين 1،000-3،000 المستعمرات / لوحة. على أساس بروتوكول أعلاه، يجب على كل اقتران إنتاج ضفة ~ 20،000 المسوخ أكثر من 15-20 لوحات كبيرة. فترة حضانة الأمثل لوحات عند 37 درجة مئوية ما بين 24-36 ساعة. ويرجع ذلك إلى الإفراط في الجينات، ينبغي أن تكون مستعمرة مخاطي واضحة أو بيضاء اللون ولها مظهر دسم أو غروي. إذا لا يمكن تمييزها المستعمرات مخاطي، ثم احتضان ل24-36 ساعة إضافية في درجة حرارة الغرفة. من الأفضل عزل المسوخ مخاطي عن طريق تمرير ثلاث مرات على لوحة PIA منتظمة مع الجنتاميسين. خلال هذا الوقت، يمكنك تحديد استقرار النمط الظاهري مخاطي. وسوف تستخدم هذه المستعمرة مخاطي تنقيته لاستخلاص الحمض النووي الجيني وتحديد الجينات التي كتبها iPCR. يمكن منتجات iPCR تصور باستخدام هلام الاغاروز شectrophoresis (الشكل 2). في حال نجاحها، يجب أن يكون هناك AMPLICON واحد في الحجم المناسب. PAO1 الحمض النووي الجيني الذي خضع الهضم تقييد وربط يمكن استخدامها كعنصر تحكم السلبية. كما هو موضح في الشكل 2، وهناك غياب iPCR AMPLICON في PAO1، لكننا الكشف عن واحدة من AMPLICON ~ ~ 1،400 سنة مضت و1،000 سنة مضت في PAO1-Ve2 غير وPAO1-VE13، على التوالي. حجم هذه amplicons يتوافق مع الإدراج من بحار ينقول himar1 في منطقة المروج من PA4033 (mucE) في PAO1-Ve2 غير وداخليا في PA5484 (kinB) في PAO1-VE13. وينبغي إجراء تسلسل الحمض النووي من amplicons iPCR بها مع التمهيدي GM5OUT. عند استخدام بسيطة المحلي محاذاة أداة البحث (الانفجار) لتحليل تسلسل الهدف، وتكرار مقلوب على 5 &#39;نهاية pFAC وTA ثنائي النوكليوتيد بمناسبة الموقع والتوجه من himar1 الإدراج في الجينوم من P. الزنجارية (الشكل 2 </stron<html> ز&gt;). <img alt="الشكل 1" fo:content-width="5in" fo:src="/files/ftp_upload/51346/51346fig1highres.jpg" src="/files/ftp_upload/51346/51346fig1.jpg" /> الشكل 1. الرسم التخطيطي للبحار ينقول ناقلات صغيرة himar1، pFAC، وتمثيل المسوخ مخاطي. يحتوي البلازميد pFAC عنصر himar1 بحار ينقول مع اثنين من تكرار مقلوب، والجنتاميسين كاسيت المقاومة (aacC1) للاختيار، جين ترميز himar1 transposase مفرط ، وريبليكون الشرطي. في بحار ينقول مصغرة himar1 يمكن أن يسبب ارتفاع الكثافة الإدراج في P. الزنجارية بسبب وفرة من الركيزة (TA ثنائي النوكليوتيد). عدد dinucleotides TA في الجينوم لاثنين P. وتظهر سلالات الزنجارية، PAO1 وPA14 باللون الأحمر. السهام الحمراء تشير إلى المسوخ مخاطي تحديدها باستخدام هذا الإجراء.om/files/ftp_upload/51346/51346fig1highres.jpg &quot;الهدف =&quot; _blank &quot;&gt; الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم. <img alt="الرقم 2" fo:content-width="5in" fo:src="/files/ftp_upload/51346/51346fig2highres.jpg" src="/files/ftp_upload/51346/51346fig2.jpg" /> الشكل 2. . ممثل iPCR ونتائج التسلسل أ) 1٪ الاغاروز الكهربائي للهلام من iPCR التضخيم باستخدام الأمام وعكس Gm3OUT Gm5OUT الاشعال وسلم 1 كيلو بايت: PAO1 (المراقبة السلبية)، PAO1-كتبها Ve2 (1396 سنة مضت)، وPAO1-VE13 (999 بي بي). الحمض النووي الجيني من ثلاث سلالات من P. تم استخراج الزنجارية ويتفاعل مع إنزيمات التقييد سالي تليها ربط المصير. تم استخدام الحمض النووي دائرية مغلقة كقوالب لiPCR كما هو موضح في النص. ب) تحليل تسلسل الجينوم المقارن باستخدام إشارة PAO1 يحدد الموقع الدقيق للمارين himar1إيه ينقول الإدراج في PAO1-Ve2 غير وPAO1-VE13. تسلسل صفت باللون الأحمر يشير إلى 5 &#39;نهاية تكرار مقلوب في pFAC. وقد أكد موقع الإدراج TA. وهناك بحث انفجار هذه متواليات اثنين خريطة الموقع الدقيق وتوجه ينقول himar1 داخل جينوم PAO1.

Watch this Scientific Journal Video about Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis at JoVE.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

نحن هنا وصف بروتوكول باستخدام بحار بوساطة الطفرات ينقول مصغرة himar1 لتوليد مكتبة متحولة عالية الكثافة الإدراج إلى الشاشة، وعزل وتحديد الجينات رواية المنظمين في prototypic الزائفة الزنجارية سلالة PAO1.

تحديد جينات جديدة ترتبط مع الجينات في الإنتاج<em&gt; الزائفة الزنجارية</em&gt; استخدام ميني<em&gt; himar1</em&gt; مارينر الطفرات ينقول بوساطة

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

identification-novel-genes-associated-with-alginate-production

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

12.2K Views.  Marshall University.  نحن هنا وصف بروتوكول باستخدام بحار بوساطة الطفرات ينقول مصغرة himar1 لتوليد مكتبة متحولة عالية الكثافة الإدراج إلى الشاشة، وعزل وتحديد الجينات رواية المنظمين في prototypic الزائفة الزنجارية سلالة PAO1. 

Video: Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

علم البصريات الوراثي الطفرات عشوائية عن طريق هيستون-miniSOG في<em&gt; C. ايليجانس</em

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

Genetics

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

النسخ المتماثل لمطلوب، "مكتبة نونريدوندانت" من سلالة الزّنجاريّة Pseudomonas PA14 ينقول طفرات الإدراج

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Phenotypes are determined by a complex series of physical (e.g. protein-protein) and functional (e.g. gene-gene or genetic) interactions (GI)1. While physical interactions can indicate which bacterial proteins are associated as complexes, they do not necessarily reveal pathway-level functional relationships1. GI screens, in which the growth of double mutants bearing two deleted or inactivated genes is measured and compared to the corresponding single mutants, can illuminate epistatic dependencies between loci and hence provide a means to query and discover novel functional relationships2. Large-scale GI maps have been reported for eukaryotic organisms like yeast3-7, but GI information remains sparse for prokaryotes8, which hinders the functional annotation of bacterial genomes. To this end, we and others have developed high-throughput quantitative bacterial GI screening methods9, 10.
Here, we present the key steps required to perform quantitative E. coli Synthetic Genetic Array (eSGA) screening procedure on a genome-scale9, using natural bacterial conjugation and homologous recombination to systemically generate and measure the fitness of large numbers of double mutants in a colony array format. Briefly, a robot is used to transfer, through conjugation, chloramphenicol (Cm) - marked mutant alleles from engineered Hfr (High frequency of recombination) 'donor strains' into an ordered array of kanamycin (Kan) - marked F- recipient strains. Typically, we use loss-of-function single mutants bearing non-essential gene deletions (e.g. the 'Keio' collection11) and essential gene hypomorphic mutations (i.e. alleles conferring reduced protein expression, stability, or activity9, 12, 13) to query the functional associations of non-essential and essential genes, respectively. After conjugation and ensuing genetic exchange mediated by homologous recombination, the resulting double mutants are selected on solid medium containing both antibiotics. After outgrowth, the plates are digitally imaged and colony sizes are quantitatively scored using an in-house automated image processing system14. GIs are revealed when the growth rate of a double mutant is either significantly better or worse than expected9. Aggravating (or negative) GIs often result between loss-of-function mutations in pairs of genes from compensatory pathways that impinge on the same essential process2. Here, the loss of a single gene is buffered, such that either single mutant is viable. However, the loss of both pathways is deleterious and results in synthetic lethality or sickness (i.e. slow growth). Conversely, alleviating (or positive) interactions can occur between genes in the same pathway or protein complex2 as the deletion of either gene alone is often sufficient to perturb the normal function of the pathway or complex such that additional perturbations do not reduce activity, and hence growth, further. Overall, systematically identifying and analyzing GI networks can provide unbiased, global maps of the functional relationships between large numbers of genes, from which pathway-level information missed by other approaches can be inferred9.

Mapping Bacterial Functional Networks and Pathways in Escherichia Coli using Synthetic Genetic Arrays

Systematic, large-scale synthetic genetic (gene-gene or epistasis) interaction screens can be used to explore genetic redundancy and pathway cross-talk. Here, we describe a high-throughput quantitative synthetic genetic array screening technology, termed eSGA that we developed for elucidating epistatic relationships and exploring genetic interaction networks in Escherichia coli.

رسم خرائط الشبكات الوظيفية البكتيرية والممرات في<em&gt; كولاي</em&gt; استخدام المصفوفات الوراثية الاصطناعية

Phenotypes  are determined by a complex series of physical (e.g. protein-protein) and  functional (e.g. gene-gene or genetic) interactions (GI)1. While ...

Biology

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

جيل من المتحولين في الإطار الجينات الحذف في الزائفة الزنجاريه واختبار لتوهين ضراوة في نموذج الماوس بسيطه من العدوى

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...

Culture of Small Colony Variant of Pseudomonas aeruginosa and Quantitation of its Alginate

Pseudomonas aeruginosa, an opportunistic Gram-negative bacterial pathogen, can overproduce an exopolysaccharide alginate resulting in a unique phenotype called mucoidy. Alginate is linked to chronic lung infections resulting in poor prognosis in patients with cystic fibrosis (CF). Understanding the pathways that regulate the production of alginate can aid in the development of novel therapeutic strategies targeting the alginate formation. Another disease-related phenotype is the small colony variant (SCV). SCV is due to the slow growth of bacteria and often associated with increased resistance to antimicrobials. In this paper, we first show a method of culturing a genetically defined form of P. aeruginosa SCV due to pyrimidine biosynthesis mutations. Supplementation of nitrogenous bases, uracil or cytosine, returns the normal growth to these mutants, demonstrating the presence of a salvage pathway that scavenges free bases from the environment. Next, we discuss two methods for the measurement of bacterial alginate. The first method relies on the hydrolysis of the polysaccharide to its uronic acid monomer followed by derivatization with a chromogenic reagent, carbazole, while the second method uses an ELISA based on a commercially available, alginate-specific mAb. Both methods require a standard curve for quantitation. We also show that the immunological method is specific for alginate quantification and may be used for the measurement of alginate in the clinical specimens.

Culture of Small Colony Variant of Pseudomonas aeruginosa and Quantitation of its Alginate

Here, we describe a growth condition to culture the small colony variant of Pseudomonas aeruginosa. We also describe two separate methods for the detection and quantitation of the exopolysaccharide alginate produced by P. aeruginosa using a traditional uronic acid carbazole assay and an alginate-specific monoclonal antibody (mAb) based ELISA.

ثقافة البديل مستعمرة صغيرة من Pseudomonas aeruginosa وكمية من Alginate لها

Pseudomonas aeruginosa, an opportunistic Gram-negative bacterial pathogen, can overproduce an exopolysaccharide alginate resulting in a unique phenotype ...

التكامل الجيني المستقر في شلوريلا الشائع باستخدام Agrobacterium tumefaciens

Agrobacterium tumefaciens-Mediated Genetic Engineering of Green Microalgae, Chlorella vulgaris

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit the capacity for gene transfer to a diverse array of species. Numerous microalgae species lack well-established methods for reliably integrating genes of interest into their nuclear genome. To harness the potential benefits of microalgal biotechnology, simple and efficient genome manipulation tools are crucial. Herein, an optimized AMT protocol is presented for the industrial microalgae species Chlorella vulgaris, utilizing the reporter green fluorescent protein (mGFP5) and the antibiotic resistance marker for Hygromycin B. Mutants are selected through plating on Tris-Acetate-Phosphate (TAP) media containing Hygromycin B and cefotaxime. Expression of mGFP5 is quantified via fluorescence after over ten generations of subculturing, indicating the stable transformation of the T-DNA cassette. This protocol allows for the reliable generation of multiple transgenic C. vulgaris colonies in under two weeks, employing the commercially available pCAMBIA1302 plant expression vector.

تسليط الضوء على المؤلف: بروتوكول التحول الأمثل لشلوريلا الشائع باستخدام Agrobacterium tumefaciens 

This protocol outlines the utilization of Agrobacterium tumefaciens-mediated transformation (AMT) for integrating gene(s) of interest into the nuclear genome of the green microalgae Chlorella vulgaris, leading to the production of stable transformants.

Agrobacterium tumefaciens- الهندسة الوراثية بوساطة الطحالب الدقيقة الخضراء ، شلوريلا الشائع

Agrobacterium tumefaciens-mediated transformation (AMT) serves as a widely employed tool for manipulating plant genomes. However, A. tumefaciens exhibit ...

Bioengineering

Generation of Null Mutants to Elucidate the Role of Bacterial Glycosyltransferases in Bacterial Motility

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans constitute a strain-specific barcode. The associated glycans show higher diversity in sugar composition and structure than those of eukaryotes and are important in bacterial-host recognition processes and interaction with the environment. In pathogenic bacteria, glycoproteins have been involved in different stages of the infectious process, and glycan modifications can interfere with specific functions of glycoproteins. However, despite the advances made in the understanding of glycan composition, structure, and biosynthesis pathways, understanding of the role of glycoproteins in pathogenicity or interaction with the environment remains very limited. Furthermore, in some bacteria, the enzymes required for protein glycosylation are shared with other polysaccharide biosynthetic pathways, such as lipopolysaccharide and capsule biosynthetic pathways. The functional importance of glycosylation has been elucidated in several bacteria through mutation of specific genes thought to be involved in the glycosylation process and the study of its impact on the expression of the target glycoprotein and the modifying glycan. Mesophilic Aeromonas have a single and O-glycosylated polar flagellum. Flagellar glycans show diversity in carbohydrate composition and chain length between Aeromonas strains. However, all strains analyzed to date show a pseudaminic acid derivative as the linking sugar that modifies serine or threonine residues. The pseudaminic acid derivative is required for polar flagella assembly, and its loss has an impact on adhesion, biofilm formation, and colonization. The protocol detailed in this article describes how the construction of null mutants can be used to understand the involvement of genes or genome regions containing putative glycosyltransferases in the biosynthesis of a flagellar glycan. This includes the potential to understand the function of the glycosyltransferases involved and the role of the glycan. This will be achieved by comparing the glycan deficient mutant to the wild-type strain.

Here, we describe the construction of null mutants of Aeromonas in specific glycosyltransferases or regions containing glycosyltransferases, the motility assays, and flagella purification performed to establish the involvement and function of their encoded enzymes in the biosynthesis of a glycan, as well as the role of this glycan in bacterial pathogenesis.

توليد الطفرات الخالية لتوضيح دور الجليكوسيل ترانسفيراز البكتيري في الحركة البكتيرية

The study of glycosylation in prokaryotes is a rapidly growing area. Bacteria harbor different glycosylated structures on their surface whose glycans ...

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can be generated using a transposome. The commercially available, Tn5-derived transposome used in this protocol consists of a linear segment of DNA containing an R6K&#947; replication origin, a gene for kanamycin resistance and two mosaic sequence ends, which serve as transposase binding sites. The transposome, provided as a DNA/transposase protein complex, is introduced by electroporation into the prototrophic strain, Enterobacter sp. YSU, and randomly incorporates itself into this host&#8217;s genome. Transformants are replica plated onto Luria-Bertani agar plates containing kanamycin, (LB-kan) and onto M-9 medium agar plates containing kanamycin (M-9-kan). The transformants that grow on LB-kan plates but not on M-9-kan plates are considered to be auxotrophs. Purified genomic DNA from an auxotroph is partially digested, ligated and transformed into a pir+ Escherichia coli (E. coli) strain. The R6K&#947; replication origin allows the plasmid to replicate in pir+ E. coli strains, and the kanamycin resistance marker allows for plasmid selection. Each transformant possesses a new plasmid containing the transposon flanked by the interrupted chromosomal region. Sanger sequencing and the Basic Local Alignment Search Tool (BLAST) suggest a putative identity of the interrupted gene. There are three advantages to using this transposome mutagenesis strategy. First, it does not rely on the expression of a transposase gene by the host. Second, the transposome is introduced into the target host by electroporation, rather than by conjugation or by transduction and therefore is more efficient. Third, the R6K&#947; replication origin makes it easy to identify the mutated gene which is partially recovered in a recombinant plasmid. This technique can be used to investigate the genes involved in other characteristics of Enterobacter sp. YSU or of a wider variety of bacterial strains.

Generation of Enterobacter sp. YSU Auxotrophs Using Transposon Mutagenesis

Enterobacter sp. YSU grows in glucose minimal salts medium. Auxotrophs are generated by transforming it with a transposome which randomly inserts itself into the host genome. Mutants are found by replica plating from complex medium to minimal medium. Interrupted genes are identified by gene rescue and sequencing.

جيل من<em&gt; الأمعائية</em&gt; س. YSU Auxotrophs عن طريق الطفرات ينقول

Prototrophic bacteria grow on M-9 minimal salts medium supplemented with glucose (M-9 medium), which is used as a carbon and energy source. Auxotrophs can ...

تحديد جينات جديدة ترتبط مع الجينات في الإنتاج

Summary

Explore More Videos

Chapters in this video

علم البصريات الوراثي الطفرات عشوائية عن طريق هيستون-miniSOG في

النسخ المتماثل لمطلوب، "مكتبة نونريدوندانت" من سلالة الزّنجاريّة Pseudomonas PA14 ينقول طفرات الإدراج

رسم خرائط الشبكات الوظيفية البكتيرية والممرات في

جيل من المتحولين في الإطار الجينات الحذف في الزائفة الزنجاريه واختبار لتوهين ضراوة في نموذج الماوس بسيطه من العدوى

ثقافة البديل مستعمرة صغيرة من Pseudomonas aeruginosa وكمية من Alginate لها

Agrobacterium tumefaciens- الهندسة الوراثية بوساطة الطحالب الدقيقة الخضراء ، شلوريلا الشائع

Agrobacterium tumefaciens- الهندسة الوراثية بوساطة الطحالب الدقيقة الخضراء ، شلوريلا الشائع

Agrobacterium tumefaciens- الهندسة الوراثية بوساطة الطحالب الدقيقة الخضراء ، شلوريلا الشائع

توليد الطفرات الخالية لتوضيح دور الجليكوسيل ترانسفيراز البكتيري في الحركة البكتيرية

جيل من