وأيد هذا العمل من قبل الوطنية للملاحة الجوية والفضاء إدارة ولاية فرجينيا الغربية الفضاء غرانت اتحاد (ناسا WVSGC)، ومؤسسة التليف الكيسي (CFF-YU11G0) والمعاهد الوطنية للصحة وP20RR016477 P20GM103434 لشبكة فكرة ولاية فرجينيا الغربية للتميز بحوث الطبية الحيوية. نشكر Vonya M. Eisinger للمساعدة التقنية مع هذا العمل.

1. إعداد سلالات البكتيرية ومتحدر من والدين إختبارات <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> تطعيم E. القولونية SM10/λpir/pFAC في 5 مل من مرق لوريا (LB) تستكمل مع 15 ميكروغرام / مل من الجنتاميسين ومكان في حاضنة تهتز بين عشية وضحاها في 37 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> تطعيم P. الزنجارية سلالة PAO1 في 5 مل من LB، ومكان في حاضنة تهتز بين عشية وضحاها في 42 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> قياس OD 600 من الثقافات بين عشية وضحاها وتخلط كميات متساوية من PAO1 وE. القولونية pFAC مثل أن الحجم النهائي بين 1-1،4 مل. </li><li style=";text-align:right;direction:rtl"> خليط أجهزة الطرد المركزي في 6000 x ج لمدة 5 دقائق. </li><li style=";text-align:right;direction:rtl"> وفي الوقت نفسه، تجف لوحات LB للاقتران: ترك لوحات مفتوحة في حاضنة عند 37 درجة مئوية لمدة 10-15 دقيقة. </li><li style=";text-align:right;direction:rtl"> إزالة كافة ولكن 50 ميكرولتر من طاف من خليط الخلية. </li><li style=";text-align:right;direction:rtl"> resuspend الكرية خلية في 50 ميكرولتر المتبقية من طاف وماصة على لوحة LB جافة في قطرة واحدة مدمجة. </li><li style=";text-align:right;direction:rtl"> وضع بعناية لوحة في غطاء الدخان لتجف (IMPORTANT ملاحظة: لا تدع خلايا موزعة على اللوحة، وهذا سوف يقلل بشكل كبير من كفاءة تصريف الافعال). </li><li style=";text-align:right;direction:rtl"> مرة واحدة الحبرية جافة، عكس لوحة LB واحتضان عند 37 درجة مئوية لمدة 4-6 ساعة. </li><li style=";text-align:right;direction:rtl"> في حين أن خليط الخلايا واحتضان، وإعداد كبيرة (150 OD × 15 مم) لوحات مع PIA 300 ميكروغرام / مل من الجنتاميسين. قبل الاستخدام، وإزالة أي الرطوبة المتبقية عن طريق وضع في حاضنة عند 37 درجة مئوية لمدة 15-20 دقيقة. </li><li style=";text-align:right;direction:rtl"> بعد الحضانة من الخليط خلية كاملة، وجمع الخلايا باستخدام التلقيح حلقة عقيمة وفي أنبوب microcentrifuge تحتوي على 1 مل LB ودوامة، أو ماصة، لتخلط جيدا. </li><li style=";text-align:right;direction:rtl"> تنتشر الخلايا بالتساوي على لوحات كبيرة تحتوي على PIA 300 ميكروغرام / مل جنتاميسين. (هام: للحصول على هذه الخطوة، فمن الأفضل لإضافة كميات متزايدة من خليط الخلية لفصل الصفائح (مثل لوحة 1: 10 ميكرولتر، لوحة 2: 50 ميكرولتر، لوحة 3: 100 ميكرولتر، لوحة 4: 500 ميكرولتر، الخ) . </li><li style=";text-align:right;direction:rtl"> احتضان بين عشية وضحاها في 37° C. </li></ol> 2. كشف وعزل المستعمرات موكويد <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إزالة لوحات من الحاضنة ودراسة للمستعمرات مخاطية. </li><li style=";text-align:right;direction:rtl"> عزل مستعمرة مخاطي واحد ومتتالية للعزلة على لوحات صغيرة (100 OD × 10 ملم) مع PIA و 300 ميكروغرام / مل من الجنتاميسين. </li><li style=";text-align:right;direction:rtl"> احتضان بين عشية وضحاها في 37 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> كرر الخطوة 2.2 على الثقافة بين عشية وضحاها السابقة. </li><li style=";text-align:right;direction:rtl"> كرر الخطوات من 2،2-2،4 مرتين أخريين لتحديد استقرار عزل مخاطي. </li><li style=";text-align:right;direction:rtl"> بعد الخطوة عزل النهائي، تطعيم 4.5 مل من LB مع مستعمرة مخاطي واحد واحتضان بين عشية وضحاها في شاكر في 37 درجة مئوية. </li><li style=";text-align:right;direction:rtl"> اليوم التالي، والتسمية 3 أنابيب microcentrifuge لكل متحولة مخاطي. </li><li style=";text-align:right;direction:rtl"> إعداد اثنين من 1.25 مل aliquots من الثقافة بين عشية وضحاها إلى 2 أنابيب لاستخراج الحمض النووي الجيني وتحديد الموقع ينقول الإدراج (انظر البروتوكول 3). </li><li style=";text-align:right;direction:rtl"> بالإضافة إلى ذلك، أرشفة كل متحولة مخاطي من قبل pipetting 1 مل الثقافة بين عشية وضحاها إلى appropriatcryovial المسمى اعل المحتوية على حجم مساو من 10٪ الحليب الخالي من الدسم. المحل في -86 درجة مئوية. </li></ol> 3. gDNA تقييد الهضم وربط <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> استخراج gDNA من متحولة مخاطي باستخدام أي أسلوب المفضل (على سبيل المثال. الفينول كلوروفورم، عمود الدوران، الخ). </li><li style=";text-align:right;direction:rtl"> تحديد تركيز gDNA، هضم ما مجموعه 2 ميكروغرام مع 1 ميكرولتر من نوكلياز داخلية تقييد سالي، 0.5 ميكرولتر من ألبومين المصل البقري، 5 ميكرولتر من العازلة سالي انزيم (100 ملي مول كلوريد الصوديوم، و 50 ملي تريس، حمض الهيدروكلوريك، 10 ملي MgCl 2 ، 1 ملم Dithiothrietol (DTT)، ودرجة الحموضة 7.9 في درجة حرارة الغرفة)، وحجم مناسب من DH 2 O لتحقيق إجمالي حجم 50 ميكرولتر. </li><li style=";text-align:right;direction:rtl"> هضم الحمض النووي بين عشية وضحاها في 37 درجة مئوية. (هام: اعتمادا على كفاءة انزيم التقييد، فإنه قد يكون من الضروري إضافة 1 ميكرولتر إضافية للهضم واحتضان بين عشية وضحاها في 37 درجة مئوية لمدة 1-2 ساعة هذا بالإضافة إلى ملخص ليلة وضحاها.) </li><li style=";text-align:right;direction:rtl"> تنقية DIGEالحمض النووي STED باستخدام أي أسلوب المفضل (مثل الاغاروز هلام تنقية، والأعمدة تدور) وأزل مع 25 ميكرولتر من العازلة. </li><li style=";text-align:right;direction:rtl"> Ligate الحمض النووي يهضم عن طريق خلط 11 ميكرولتر من الحمض النووي المنقى مع التركيز المفضل لل~ 10-20 نانوغرام / ميكرولتر، 1.5 ميكرولتر من العازلة ربط (330 ملي تريس، ودرجة الحموضة 7.5 خلات، 660 ملي خلات البوتاسيوم، المغنيسيوم خلات 100 ملم، 5 ملم DTT)، 1.5 ميكرولتر من 100 ملي ATP و 1 ميكرولتر الحمض النووي يغاز. </li><li style=";text-align:right;direction:rtl"> احتضان الخليط لمدة 15 دقيقة في درجة حرارة الغرفة، ومن ثم تعطيل انزيم التي يحتضنها لمدة 15 دقيقة عند 70 درجة مئوية. (ملاحظة: احتضان الخليط في درجة حرارة الغرفة لمدة أطول قد تزيد من نجاح عملية ربط). </li></ol> 4. العكسية PCR (iPCR) وتحليل تسلسل <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> أداء iPCR على المنتج ربط باستخدام التالية إلى الأمام وعكس الاشعال والتدوير الحراري thermocycling الشروط: إلى الأمام التمهيدي (Gm3OUT): GGGCATACGGGAAGAAGTGA -عكسي التمهيدي (Gm5OUT): GACTGCCCTGCTGCGTAACA Thermocycler كونديستعقد: 1. 94 درجة مئوية لمدة 1 دقيقة. 2. 94 درجة مئوية لمدة 1 دقيقة. 3. 58 درجة مئوية لمدة 2 دقيقة. 4. 72 درجة مئوية لمدة 2 دقيقة. 5. 72 درجة مئوية لمدة 8 دقائق. 6. 10 ° C الانتظار. كرر الخطوات من 2-4 لمدة 34 دورات. (ملاحظة: يمكن تخزين المنتجات أسهب iPCR في 4 درجات مئوية) </li><li style=";text-align:right;direction:rtl"> أداء الاغاروز الكهربائي للهلام لتأكيد نجاح iPCR التضخيم. </li><li style=";text-align:right;direction:rtl"> أداء التسلسل على المنتج iPCR باستخدام Gm3OUT وGm5OUT الاشعال. يتم تعيين موقع الإدراج وتوجه himar1 بها. </li></ol>

<ol>
	<li>Govan, J. R., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+pathogenesis+in+cystic+fibrosis:+mucoid+Pseudomonas+aeruginosa+and+Burkholderia+cepacia.">Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.</a> Microbiol. Rev. 60, 539-574 (1996).</li><li>Chitnis, C. E., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+the+alginate+biosynthetic+gene+cluster+of+Pseudomonas+aeruginosa+shows+evidence+of+an+operonic+structure.">Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure.</a> Mol. Microbiol. 8, 583-593 (1993).</li><li>Franklin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+AlgG+is+a+polymer+level+alginate+C5-mannuronan+epimerase.">Pseudomonas aeruginosa AlgG is a polymer level alginate C5-mannuronan epimerase.</a> J. Bacteriol. 176, 1821-1830 (1994).</li><li>Franklin, M. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutant+analysis+and+cellular+localization+of+the+AlgI,+AlgJ,+and+AlgF+proteins+required+for+O+acetylation+of+alginate+in+Pseudomonas+aeruginosa.">Mutant analysis and cellular localization of the AlgI, AlgJ, and AlgF proteins required for O acetylation of alginate in Pseudomonas aeruginosa.</a> J. Bacteriol. 184, 3000-3007 (2002).</li><li>Deretic, V., Gill, J. F., Chakrabarty, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+algD+coding+for+GDPmannose+dehydrogenase+is+transcriptionally+activated+in+mucoid+Pseudomonas+aeruginosa.">Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.</a> J. Bacteriol. 169, 351-358 (1987).</li><li>Mathee, K., McPherson, C. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+the+algT+(algU)-encoded+sigma22+for+expression+of+the+alginate+regulon+in+Pseudomonas+aeruginosa+and+localization+of+its+antagonist+proteins+MucA+and+MucB+(AlgN)..">Posttranslational control of the algT (algU)-encoded sigma22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN)..</a> J. Bacteriol. 179, 3711-3720 (1997).</li><li>Boucher, J. C., Schurr, M. J., Yu, H., Rowen, D. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+in+cystic+fibrosis:+role+of+mucC+in+the+regulation+of+alginate+production+and+stress+sensitivity.">Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity.</a> Microbiology. 143, 3473-3480 (1997).</li><li>Martin, D. W., Holloway, B. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+locus+determining+the+mucoid+status+of+Pseudomonas+aeruginosa:+AlgU+shows+sequence+similarities+with+a+Bacillus+sigma+factor.">Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: AlgU shows sequence similarities with a Bacillus sigma factor.</a> J. Bacteriol. 175, 1153-1164 (1993).</li><li>Damron, F. H., Goldberg, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteolytic+regulation+of+alginate+overproduction+in+Pseudomonas+aeruginosa.">Proteolytic regulation of alginate overproduction in Pseudomonas aeruginosa.</a> Mol. Microbiol. 84 (4), 595-607 (2012).</li><li>Browne, P., Barret, M., O'Gara, F., Morrissey, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+prediction+of+the+Crc+regulon+identifies+genus-wide+and+species-specific+targets+of+catabolite+repression+control+in+Pseudomonas+bacteria.">Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria.</a> BMC Microbiol. 10, 300 (2010).</li><li>Damron, F. H., Qiu, D., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pseudomonas+aeruginosa+sensor+kinase+KinB+negatively+controls+alginate+production+through+AlgW-dependent+MucA+proteolysis.">The Pseudomonas aeruginosa sensor kinase KinB negatively controls alginate production through AlgW-dependent MucA proteolysis.</a> J. Bacteriol. 191, 2285-2295 (2009).</li><li>Damron, F. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pseudomonas+aeruginosa+regulon+controlled+by+the+sensor+kinase+KinB+and+sigma+factor+RpoN.">Analysis of the Pseudomonas aeruginosa regulon controlled by the sensor kinase KinB and sigma factor RpoN.</a> J. Bacteriol. 194, 1317-1330 (2012).</li><li>Qiu, D., Eisinger, V. M., Rowen, D. W., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+proteolysis+controls+mucoid+conversion+in+Pseudomonas+aeruginosa.">Regulated proteolysis controls mucoid conversion in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 104, 8107-8112 (2007).</li><li>Schurr, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Which+bacterial+biofilm+exopolysaccharide+is+preferred,+Psl+or+alginate.">Which bacterial biofilm exopolysaccharide is preferred, Psl or alginate.</a> J. Bacteriol. 195, 1623-1626 (2013).</li><li>Wong, S. M., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+footprinting+with+mariner-based+transposition+in+Pseudomonas+aeruginosa.">Genetic footprinting with mariner-based transposition in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 10191-10196 (2000).</li><li>Lampe, D. J., Akerley, B. J., Rubin, E. J., Mekalanos, J. J., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hyperactive+transposase+mutants+of+the+Himar1+mariner+transposon.">Hyperactive transposase mutants of the Himar1 mariner transposon.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 11428-11433 (1999).</li></ol>

المؤلف هونغ وى D. يو هو موظف العلوم رئيس وأحد مؤسسي تكاثر مبكر تكنولوجيز، ذ.

من المهم أن نلاحظ أن هذه الطريقة يمكن استخدامها في الأنواع الأخرى الزائفة مع هذه التعديلات: احتضان P. المتألقة وP. الكريهة عند 30 درجة مئوية، وP. الشتوتسرية في 42 درجة مئوية، P. stuzeri ينبغي مثقف على لوحات LB تستكمل مع 150 ميكروغرام / مل من الجنتاميسين؛ على خط...

قدرة الانتهازية، الممرض سالبة الجرام الزائفة الزنجارية لتحفيزه على إنتاج الجينات هو أحد العوامل الرئيسية في قدرتها على إنشاء بيوفيلم. الافراط في الجينات هو النمط الظاهري غالبا ما يشار إليها باسم mucoidy. عزل مستعمرات مخاطية من sputa الأفراد المصابين بالتليف الكيسي (CF) يدل على وجود عدوى مزمنة، ويرتبط مباشرة مع الانخفاض العام في صحة المريض 1. حاليا، فمن المفهوم أن تنظيم وإنتاج الجينات في P. الزنجارية يحدث في المقام الأول على اثنين من operons. الأول هو الاوبرون السكروز الجينات، والذي يحتوي على 12 الجينات (algD - alg8 - alg44 - algK - الالم - algG - algX - algL - ALGI - algJ - algF - الطحالب) التي هي المسئولة عن تصنيع وتصدير البوليمر الجينات عبر والجبلة المحيطية إلى خارج الخلية environmeالإقليم الشمالي 2-5. والاوبرون الثاني هو مجموعة من الجينات التي تبدأ مع عامل سيغما بديل ALGU / T والمستمر مع mucA، mucB، وmucD. ALGU / T هو منظم إيجابية، في حين تصنف mucAB-D كما المنظمين السلبية لإنتاج الجينات 6-8. بالإضافة إلى ذلك، والمنظمين النسخي، مثل AlgB، AlgQ، الغر، وRpoN، وكذلك في مرحلة ما بعد النسخي وتعديل آخر متعدية عن طريق التحكم القمع مقيضة، والنشاط كيناز (KinB) والتحلل البروتيني intramembrane، وأيضا ثبت أن تشارك في الجينات تنظيم 9-14. تم إنشاء ينقول ناقلات صغيرة himar1 المعروفة باسم pFAC أصلا في مختبر الدكتور Mekalanos &#39;في كلية هارفارد الطبية 15. يتكون البلازميد pFAC عنصر القابلة للنقل يحيط بها اثنان يكرر مقلوب من 27 نقطة أساس وكاسيت الجنتاميسين المقاومة في الوسط (aacC1: 534 بي بي)، جين ترميز hyperactإيف transposase مارينر 16، والجينات ترميز β-اكتاماز (بلوخ) (الشكل 1). تسلسل المعلومات عن العنصر القابلة للنقل من pFAC متاح في عدد انضمام بنك الجينات: DQ366300 13. في pFAC، هناك موقع استنساخ متعددة (MCS) وراء الجينات aacC1 والذي يستخدم لتحديد موقع الإدراج الكروموسومات باستخدام العكسية PCR. واحدة ميزة كبيرة مع استخدام ينقول مصغرة himar1 هو ليس هناك حاجة لعوامل المضيف محددة للتبديل (الطفرات). بالإضافة إلى ذلك، هناك وفرة عالية من TA المواقع الإدراج ثنائي النوكليوتيد جدت في جميع أنحاء الجينوم من P. الزنجارية. على سبيل المثال، TA المواقع ثنائي النوكليوتيد الإدراج يحدث و94404 100229 مرات في PAO1 (6264404 بت في الثانية، بنك الجينات عدد الانضمام NC_002516.2) وPA14 (6537648 بت في الثانية؛ رقم الوصول بنك الجينات NC_008463) الجينوم، على التوالي. بسبب وفرة من TA ثنائي النوكليوتيد في الجينوم، ميني himar1 </em&gt; ينقول يمكن أن يسبب عالية الكثافة والطفرات العشوائية، والتي هي مناسبة خاصة لتحليل الجينات الفوعة والجينات التي تنظم للغاية. نظريا، يمكن للينقول مصغرة himar1 إدراجها في أي الجينات غير الضرورية داخل جينوم P. الزنجارية. وهذا يوفر مواقع الإدراج TA حوالي 18 في إطار القراءة المفتوح في الجينوم PAO1. هنا، نحن تصف البروتوكول باستخدام مصغرة himar1 بوساطة الطفرات ينقول لتحديد المنظمين رواية mucoidy في P. الزنجارية. وبشكل أكثر تحديدا، ونحن مترافق biparentally متجه pFAC تحتوي على ينقول مصغرة himar1 من E. القولونية SM10/λpir في nonmucoid أنموذجية التغذي سلالة PAO1. بعد دمج ينقول في الجينوم، سلالة المتلقي هو مثقف على الزائفة عزلة أجار (PIA) التي تحتوي على التريكلوسان الذي يمنع نمو E. القولونية. وبالتالي، مكتبة من المسوخ من <em&gt; P. يمكن اختيار الزنجارية من النمو على PIA وحة تستكمل مع الجنتاميسين وجود النمط الظاهري مخاطي. ملاحظة، صحيح سوف مقابل ومتحولة التكامل بوساطة ينقول يكون النمط الظاهري المقاومة والحساسة للكربنيسيلين الجنتاميسين. في هذه الدراسة، تم عزل ما يقرب من 80،000 من المسوخ الإدراج PAO1 من خلال أربعة الإقتران منفصلة. نحن بعد ذلك فرزها لعزلات مخاطي، وتحديد موقع من قبل الإدراج تقييد انزيم الهضم، وربط والعكسية PCR. أجرينا تحليل لطخة الجنوبية باستخدام المقاومة كاسيت الجنتاميسين كما تحقيقا لرؤية عدد من الإدراج في الجينوم. توصلنا إلى أن أكثر من 90٪ من المسوخ التي تم الحصول عليها في الاقتران باستخدام هذا البروتوكول لم يحصل إلا على نسخة واحدة من himar1 في الجينوم وعرض النمط الظاهري المقاومة والحساسة للكربنيسيلين الجنتاميسين. وقد تم تحديد ما مجموعه 32 عزلات مخاطي، تم تعيين 22 منهم إلى مواضع مختلفة من P. الزنجارية PAO1كروموسوم. هذا المعدل من الإدراج توفر تغطية كافية لتحديد العديد من المنظمين رواية من الإفراط الجينات.

<table border="0" cellpadding="0" cellspacing="0" width="780">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:267px;">Luria Broth</td>
			<td style="width:187px;">Difco</td>
			<td style="width:125px;">240230</td>
			<td style="width:203px;">via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pseudomonas isolation agar</td>
			<td>Difco</td>
			<td>292710</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Small Plates (100 O.D. x 10 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-13</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Large Plates (150 O.D. x 15 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-14</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycerol</td>
			<td>Fisher Scientific</td>
			<td>BP229-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Shaking Incubator</td>
			<td>New Brunswick Scientific</td>
			<td>Innova 4080</td>
			<td>shake at 200 rpm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cabinet Incubator</td>
			<td>VWR</td>
			<td>1540</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Microcentrifuge</td>
			<td>Sorvall</td>
			<td>75-003-287</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SmartSpec Plus Spectrophotometer</td>
			<td>Bio-Rad</td>
			<td>170-2525</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Diposable Inoculation Loops</td>
			<td>Fisher Scientific</td>
			<td>22-363-597</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1.5 mL Microcentrifuge Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-408-129</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">15 mL Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-539-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Skim Milk</td>
			<td>Difco</td>
			<td>DF0032-17-3</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNeasy Blood and Tissue (250)&#160;</td>
			<td>Qiagen</td>
			<td>69506</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAquick PCR Purification Kit (250)</td>
			<td>Qiagen</td>
			<td>28106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAprep Spin Miniprep Kit (250)&#160;</td>
			<td>Qiagen</td>
			<td>27106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastLink II DNA Ligation Kit</td>
			<td>Epicentre Technologies</td>
			<td>LK6201H</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accu block Digital Dry Bath&#160;</td>
			<td>Labnet</td>
			<td>NC0205808</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sal1, restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0138L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EasyStart Micro 50</td>
			<td>Molecular BioProducts</td>
			<td>6020</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq DNA Polymerase</td>
			<td>New England BioLabs</td>
			<td>M0267L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iCycler, Thermocycler</td>
			<td>Bio-Rad</td>
			<td>170-8740</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LE agarose</td>
			<td>Genemate</td>
			<td>3120-500</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gentamycin Sulfate</td>
			<td>Fisher Scientific</td>
			<td>BP918-1</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
	</tbody>
</table>

identification of novel genes associated with alginate production in pseudomonas aeruginosa using mini-himar1 mariner transposon-mediated mutagenesis

الزائفة الزنجارية هي سالبة الجرام، بكتيريا البيئية مع قدرات التمثيل الغذائي تنوعا. P. الزنجارية هو الممرض الانتهازية البكتيرية التي تنص على الالتهابات الرئوية المزمن في المرضى الذين يعانون من التليف الكيسي (CF). الافراط في السكاريد المحفظة تسمى الجينات، والمعروف أيضا باسم mucoidy، ويشجع على تشكيل الأغشية الحيوية مخاطي التي هي أكثر مقاومة من خلايا العوالق للعلاج الكيميائي للمضادات الحيوية ودفاعات المضيف. بالإضافة إلى ذلك، التحويل من nonmucoid إلى النمط الظاهري مخاطي هو علامة السريرية لظهور عدوى مزمنة في CF. الإفراط الجينات التي كتبها P. الزنجارية هي عملية ماص للطاقة التي ضرائب ثقيلة على الطاقة الخلوية. لذلك، يتم تنظيم الجينات في إنتاج عالية P. الزنجارية. من أجل فهم أفضل تنظيم الجينات، وصفنا بروتوكول باستخدام مصغرة himar1 ينقول الطفرات لتحديد الجينات منظم الروايةق في سلالة PAO1 prototypic. يتكون هذا الإجراء من خطوتين أساسيتين. أولا، ونقل ينقول مصغرة himar1 (pFAC) من المضيف E. القولونية SM10/λpir إلى المتلقي P. الزنجارية PAO1 عبر اقتران متحدر من والدين لإنشاء مكتبة متحولة عالية الكثافة الإدراج، والتي تم اختيارها على لوحات الزائفة عزلة أجار تستكمل مع الجنتاميسين. ثانيا، نحن فحص وعزل مستعمرات مخاطية لرسم خريطة للموقع من خلال الإدراج العكسية PCR باستخدام بادئات الحمض النووي لافتا إلى الخارج من الكاسيت الجنتاميسين وتسلسل الحمض النووي. باستخدام هذا البروتوكول، حددنا اثنين من المنظمين رواية الجينات، mucE (PA4033) وkinB (PA5484)، في سلالة PAO1 مع البرية من نوع mucA ترميز عامل مكافحة سيغما MucA للسيد الجينات منظم ALGU (AlgT، σ 22) . يمكن تعديل هذا البروتوكول الطفرات الإنتاجية العالية لتحديد الجينات الأخرى ذات الصلة الفوعة تسبب تغيير في كولونيويورك التشكل.

كما هو موضح في الشكل 1، وبحار ينقول ناقلات صغيرة himar1، pFAC، يحتوي على اثنين من 27 سنة مضت يكرر مقلوب مع مواقع الإدراج TA المرافقة المقاومة aacC1 الجنتاميسين كاسيت، مع σ المروج 70 التابعة لها، وموقع الاستنساخ متعددة (MCS). بالإضافة إلى ذلك، يحتوي pFAC ناقل...

Watch this Scientific Journal Video about Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis at JoVE.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

نحن هنا وصف بروتوكول باستخدام بحار بوساطة الطفرات ينقول مصغرة himar1 لتوليد مكتبة متحولة عالية الكثافة الإدراج إلى الشاشة، وعزل وتحديد الجينات رواية المنظمين في prototypic الزائفة الزنجارية سلالة PAO1.

تحديد جينات جديدة ترتبط مع الجينات في الإنتاج<em&gt; الزائفة الزنجارية</em&gt; استخدام ميني<em&gt; himar1</em&gt; مارينر الطفرات ينقول بوساطة

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

identification-novel-genes-associated-with-alginate-production

Research

JoVE Journal

Immunology and Infection

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

12.2K Views.  Marshall University.  نحن هنا وصف بروتوكول باستخدام بحار بوساطة الطفرات ينقول مصغرة himar1 لتوليد مكتبة متحولة عالية الكثافة الإدراج إلى الشاشة، وعزل وتحديد الجينات رواية المنظمين في prototypic الزائفة الزنجارية سلالة PAO1. 

Video: Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living surfaces. In this paper, we describe protocols for forming Pseudomonas aeruginosa biofilms on human airway epithelial cells (CFBE cells) grown in culture. In the first method (termed the Static Co-culture Biofilm Model), P. aeruginosa is incubated with CFBE cells grown as confluent monolayers on standard tissue culture plates. Although the bacterium is quite toxic to epithelial cells, the addition of arginine delays the destruction of the monolayer long enough for biofilms to form on the CFBE cells. The second method (termed the Flow Cell Co-culture Biofilm Model), involves adaptation of a biofilm flow cell apparatus, which is often used in biofilm research, to accommodate a glass coverslip supporting a confluent monolayer of CFBE cells. This monolayer is inoculated with P. aeruginosa and a peristaltic pump then flows fresh medium across the cells. In both systems, bacterial biofilms form within 6-8 hours after inoculation. Visualization of the biofilm is enhanced by the use of P. aeruginosa strains constitutively expressing green fluorescent protein (GFP). The Static and Flow Cell Co-culture Biofilm assays are model systems for early P. aeruginosa infection of the Cystic Fibrosis (CF) lung, and these techniques allow different aspects of P. aeruginosa biofilm formation and virulence to be studied, including biofilm cytotoxicity, measurement of biofilm CFU, and staining and visualizing the biofilm.

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

This paper describes different methods of growing Pseudomonas aeruginosa biofilms on cultured human airway epithelial cells. These protocols can be adapted to study different aspects of biofilm formation, including visualization of the biofilm, staining of the biofilm, measuring the colony forming units (CFU) of the biofilm, and studying biofilm cytotoxicity.

شارك في نماذج من الثقافة الزائفة الزنجارية الأغشية الحيوية نمت على خلايا حية إيرواي الإنسان

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living ...

Transfection and Mutagenesis of Target Genes in Mosquito Cells by Locked Nucleic Acid-modified Oligonucleotides

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new infections each year. Despite decades of research, there is still no vaccine against malaria, highlighting the need for novel control strategies. One innovative approach is the use of genetically modified mosquitoes to effectively control malaria parasite transmission. Deliberate alterations of cell signaling pathways in the mosquito, via targeted mutagenesis, have been found to regulate parasite development 1. From these studies, we can begin to identify potential gene targets for transformation. Targeted mutagenesis has traditionally relied upon the homologous recombination between a target gene and a large DNA molecule. However, the construction and use of such complex DNA molecules for generation of stably transformed cell lines is costly, time consuming and often inefficient. Therefore, a strategy using locked nucleic acid-modified oligonucleotides (LNA-ONs) provides a useful alternative for introducing artificial single nucleotide substitutions into episomal and chromosomal DNA gene targets (reviewed in 2). LNA-ON-mediated targeted mutagenesis has been used to introduce point mutations into genes of interest in cultured cells of both yeast and mice 3,4. We show here that LNA-ONs can be used to introduce a single nucleotide change in a transfected episomal target that results in a switch from blue fluorescent protein (BFP) expression to green fluorescent protein (GFP) expression in both Anopheles gambiae and Anopheles stephensi cells. This conversion demonstrates for the first time that effective mutagenesis of target genes in mosquito cells can be mediated by LNA-ONs and suggests that this technique may be applicable to mutagenesis of chromosomal targets in vitro and in vivo.

Oligonucleotides can be used to site specifically substitute a single nucleotide of transfected target genes in both Anopheles gambiae and Anopheles stephensi cells.

ترنسفكأيشن والطفرات في الجينات المستهدفة في الخلايا عن طريق البعوض مغلق [أليغنوكليوتيد] حمض تعديل الأحماض النووية

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new ...

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological properties compared to free living microorganisms. Biofilms in nature are often difficult to investigate and reside under poorly defined conditions1. Using a transparent substratum it is possible to device a system where simple biofilms can be examined in a non-destructive way in real-time: here we demonstrate the assembly and operation of a flow cell model system, for in vitro 3D studies of microbial biofilms generating high reproducibility under well-defined conditions2,3.
The system consists of a flow cell that serves as growth chamber for the biofilm. The flow cell is supplied with nutrients and oxygen from a medium flask via a peristaltic pump and spent medium is collected in a waste container. This construction of the flow system allows a continuous supply of nutrients and administration of e.g. antibiotics with minimal disturbance of the cells grown in the flow chamber. Moreover, the flow conditions within the flow cell allow studies of biofilm exposed to shear stress. A bubble trapping device confines air bubbles from the tubing which otherwise could disrupt the biofilm structure in the flow cell.
The flow cell system is compatible with Confocal Laser Scanning Microscopy (CLSM) and can thereby provide highly detailed 3D information about developing microbial biofilms. Cells in the biofilm can be labeled with fluorescent probes or proteins compatible with CLSM analysis. This enables online visualization and allows investigation of niches in the developing biofilm. Microbial interrelationship, investigation of antimicrobial agents or the expression of specific genes, are of the many experimental setups that can be investigated in the flow cell system.

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Protocol describing the application of a flow cell system for growing and analyzing microbial biofilms for Confocal Laser Scanning Microscopy (CLSM).

والزائفة الزنجارية السكيراء بيوفيلم في خلايا خميرة تدفق

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological ...

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with leukemia, severe burn wounds, or organ transplants1. In patients at high-risk for developing PA bloodstream infections, the gastrointestinal (GI) tract is the main reservoir for colonization2, but the mechanisms by which PA transitions from an asymptomatic colonizing microbe to an invasive, and often deadly, pathogen are unclear. Previously, we performed in vivo transcription profiling experiments by recovering PA mRNA from bacterial cells residing in the cecums of colonized mice 3 in order to identify changes in bacterial gene expression during alterations to the host&#x2019;s immune status.
As with any transcription profiling experiment, the rate-limiting step is in the isolation of sufficient amounts of high quality mRNA. Given the abundance of enzymes, debris, food residues, and particulate matter in the GI tract, the challenge of RNA isolation is daunting. Here, we present a method for reliable and reproducible isolation of bacterial RNA recovered from the murine GI tract. This method utilizes a well-established murine model of PA GI colonization and neutropenia-induced dissemination4. Once GI colonization with PA is confirmed, mice are euthanized and cecal contents are recovered and flash frozen. RNA is then extracted using a combination of mechanical disruption, boiling, phenol/chloroform extractions, DNase treatment, and affinity chromatography. Quantity and purity are confirmed by spectrophotometry (Nanodrop Technologies) and bioanalyzer (Agilent Technologies) (Fig 1). This method of GI microbial RNA isolation can easily be adapted to other bacteria and fungi as well.

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

A reliable method for the RNA isolation of Pseudomonas aeruginosa recovered from murine cecums is described. The RNA recovered is of sufficient quantity and quality for subsequent qPCR, transcription profiling, and RNA Seq experiments. This technique can be adapted for RNA isolation of other intestinal microbes.

عزل الحمض النووي الريبي الزائفة الزنجارية استعمار الهضمي المسالك الفئران

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with ...

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

There is growing concern about the relevance of in vitro antimicrobial susceptibility tests when applied to isolates of P. aeruginosa from cystic fibrosis (CF) patients. Existing methods rely on single or a few isolates grown aerobically and planktonically. Predetermined cut-offs are used to define whether the bacteria are sensitive or resistant to any given antibiotic1. However, during chronic lung infections in CF, P. aeruginosa populations exist in biofilms and there is evidence that the environment is largely microaerophilic2. The stark difference in conditions between bacteria in the lung and those during diagnostic testing has called into question the reliability and even relevance of these tests3.
 Artificial sputum medium (ASM) is a culture medium containing the components of CF patient sputum, including amino acids, mucin and free DNA. P. aeruginosa growth in ASM mimics growth during CF infections, with the formation of self-aggregating biofilm structures and population divergence4,5,6. The aim of this study was to develop a microtitre-plate assay to study antimicrobial susceptibility of P. aeruginosa based on growth in ASM, which is applicable to both microaerophilic and aerobic conditions.
 An ASM assay was developed in a microtitre plate format. P. aeruginosa biofilms were allowed to develop for 3 days prior to incubation with antimicrobial agents at different concentrations for 24 hours. After biofilm disruption, cell viability was measured by staining with resazurin. This assay was used to ascertain the sessile cell minimum inhibitory concentration (SMIC) of tobramycin for 15 different P. aeruginosa isolates under aerobic and microaerophilic conditions and SMIC values were compared to those obtained with standard broth growth. Whilst there was some evidence for increased MIC values for isolates grown in ASM when compared to their planktonic counterparts, the biggest differences were found with bacteria tested in microaerophilic conditions, which showed a much increased resistance up to a &gt;128 fold, towards tobramycin in the ASM system when compared to assays carried out in aerobic conditions.
 The lack of association between current susceptibility testing methods and clinical outcome has questioned the validity of current methods3. Several in vitro models have been used previously to study P. aeruginosa biofilms7, 8. However, these methods rely on surface attached biofilms, whereas the ASM biofilms resemble those observed in the CF lung9 . In addition, reduced oxygen concentration in the mucus has been shown to alter the behavior of P. aeruginosa2 and affect antibiotic susceptibility10. Therefore using ASM under microaerophilic conditions may provide a more realistic environment in which to study antimicrobial susceptibility.

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

Current diagnostic antimicrobial susceptibility testing relies on the planktonic growth of isolates in nutrient rich, aerobic conditions. Here, we employ an alternative artificial sputum medium to study antimicrobial susceptibility of Pseudomonas aeruginosa biofilms under both aerobic and microaerophilic conditions more representative of the cystic fibrosis lung.

استخدام متوسط ​​البلغم الاصطناعي لاختبار فعالية المضادات الحيوية لمكافحة<em&gt; الزائفة الزنجارية</em&gt; في شروط أكثر ملاءمة لالرئة التليف الكيسي

There  is growing concern about the relevance of in vitro antimicrobial  susceptibility tests when applied to isolates of P. aeruginosa from  cystic ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

على المدى الطويل المزمن<em&gt; الزائفة الزنجارية</em&gt; عدوى مجرى الهواء في الفئران

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

Pseudomonas aeruginosa Induced Lung Injury Model

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. Here we have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa (P. aeruginosa or PA). Using this model, we were able to show lung inflammation at the early phase of injury. In addition, alveolar epithelial barrier leakiness was observed by analyzing bronchoalveolar lavage (BAL); and alveolar cell death was observed by Tunel assay using tissue prepared from injured lungs. At a later phase following injury, we observed cell proliferation required for the repair process. The injury was resolved 7 days from the initiation of P. aeruginosa injection. This model mimics the sequential course of lung inflammation, injury and repair during pneumonia. This clinically relevant animal model is suitable for studying pathology, mechanism of repair, following acute lung injury, and also can be used to test potential therapeutic agents for this disease.

Pseudomonas aeruginosa Induced Lung Injury Model

We have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa. This model mimics lung injury during pneumonia and is clinically relevant.

الزائفة الزنجارية المستحثة الرئة الإصابات نموذج

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. ...

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. typhimurium bacteria are quickly detected and phagocytized by macrophages, and contained in vesicles known as phagosomes in order to be degraded. Isolation of S. typhimurium-containing phagosomes have been widely used to study how S. typhimurium infection alters the process of phagosome maturation to prevent bacterial degradation. Classically, the isolation of bacteria-containing phagosomes has been performed by sucrose gradient centrifugation. However, this process is time-consuming, and requires specialized equipment and a certain degree of dexterity. Described here is a simple and quick method for the isolation of S. typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin-streptavidin-conjugated magnetic beads. Phagosomes obtained by this method can be suspended in any buffer of choice, allowing the utilization of isolated phagosomes for a broad range of assays, such as protein, metabolite, and lipid analysis. In summary, this method for the isolation of S. typhimurium-containing phagosomes is specific, efficient, rapid, requires minimum equipment, and is more versatile than the classical method of isolation by sucrose gradient-ultracentrifugation.

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

We describe here a simple and quick method for the isolation of Salmonella typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin and streptavidin.

عزل السالمونيلا تيفيموريوم-التي تحتوي على فاجوسوميس من الضامة

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

النسخ المتماثل لمطلوب، "مكتبة نونريدوندانت" من سلالة الزّنجاريّة Pseudomonas PA14 ينقول طفرات الإدراج

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Highly Efficient Transfection of Primary Macrophages with In Vitro Transcribed mRNA

Macrophages are phagocytic cells specialized in detecting molecules of non-self origin. To this end, they are equipped with a large array of pattern recognition receptors (PRRs). Unfortunately, this also makes macrophages particularly challenging to transfect as the transfection reagent and the transfected nucleic acids are often recognized by the PRRs as non-self. Therefore, transfection often results in macrophage activation and degradation of the transfected nucleic acids or even in suicide of the macrophages. Here, we describe a protocol that allows highly efficient transfection of murine primary macrophages such as peritoneal macrophages (PM) and bone marrow-derived macrophages (BMDM) with mRNA in vitro transcribed from DNA templates such as plasmids. With this simple protocol, transfection rates of about 50-65% for PM and about 85% for BMDM are achieved without cytotoxicity or immunogenicity observed. We describe in detail the generation of mRNA for transfection from DNA constructs such as plasmids and the transfection procedure.

Macrophages, especially primary macrophages, are challenging to transfect as they specialize in detecting molecules of non-self origin. We describe a protocol that allows highly efficient transfection of primary macrophages with mRNA generated from DNA templates such as plasmids.

النقل عاليه الكفاءة من الضامة الابتدائية مع في المختبر كتب mRNA

Macrophages are phagocytic cells specialized in detecting molecules of non-self origin. To this end, they are equipped with a large array of pattern ...