Ce travail a été soutenu par la NASA en Virginie occidentale espace Grant Consortium NASA (National WVSGC), Cystic Fibrosis Foundation (CFF-YU11G0) et NIH P20RR016477 et P20GM103434 au réseau IDeA Virginie-Occidentale pour l&#39;excellence en recherche biomédicale. Nous remercions Vonya M. Eisinger pour l&#39;assistance technique à ces travaux.

Une. Préparation des souches bactériennes et biparentale Conjugaison <ol><li> Inoculer E. coli SM10/λpir/pFAC dans 5 ml de bouillon de Luria (LB) additionné de 15 pg / ml de gentamicine et le placer dans un incubateur à agitation pendant une nuit à 37 ° C. </li><li> Inoculer P. aeruginosa souche PAO1 dans 5 ml de LB, et placer dans un incubateur à agitation pendant une nuit à 42 ° C. </li><li> Mesurer la DO 600 de cultures de la nuit et mélanger des quantités égales de PAO1 et E. coli PFA telle que le volume final est entre 1 à 1,4 ml. </li><li> mélange Centrifuger à 6000 g pendant 5 min. </li><li> Pendant ce temps, sécher des plaques LB pour la conjugaison: laisser les plaques ouvertes dans l&#39;incubateur à 37 ° C pendant 10-15 min. </li><li> Retirez tous mais 50 pi de surnageant de mélange de cellules. </li><li> Reprendre le culot cellulaire dans les 50 pi restants de surnageant et pipette sur une plaque LB sec dans une gouttelette compact. </li><li> Placez délicatement la plaque dans une hotte à sécher (IMPORemarque rtant: Ne laissez pas les cellules réparties sur la plaque, ce diminuera de façon significative l&#39;efficacité de la conjugaison). </li><li> Une fois la goutte est sec, retourner la plaque LB et incuber à 37 ° C pendant 4-6 heures. </li><li> Bien que le mélange de cellules est en incubation, préparer de grandes (150 mm x 15 mm) des plaques de PIA avec 300 pg / ml de gentamicine. Avant toute utilisation, enlever toute humidité résiduelle en plaçant dans un incubateur à 37 ° C pendant 15-20 min. </li><li> Après l&#39;incubation du mélange de cellules est terminée, recueillir les cellules à l&#39;aide d&#39;une anse d&#39;inoculation stérile et dans un tube à centrifuger contenant 1 ml de LB et vortex, ou d&#39;une pipette, pour bien mélanger. </li><li> Répartir les cellules uniformément sur les grandes plaques PIA contiennent 300 pg / ml de gentamicine. (IMPORTANT: Pour cette étape, il est préférable d&#39;ajouter des volumes croissants de mélange de cellules pour séparer les plaques (par exemple Planche 1: 10 pi, Planche 2: 50 pi, Planche 3: 100 pi, Planche 4: 500 pi, etc) . </li><li> Incuber une nuit à 37° C. </li></ol> 2. La détection et l&#39;isolement des colonies mucoïdes <ol><li> Retirer les plaques de l&#39;incubateur et examiner les colonies mucoïdes. </li><li> Isoler une seule colonie mucoïde et par épuisement sur les petites plaques (100 mm x 10 mm) avec PIA et 300 pg / ml de gentamicine. </li><li> Incuber pendant une nuit à 37 ° C. </li><li> Répétez l&#39;étape 2.2 de la culture de la nuit précédente. </li><li> Répétez les étapes 02.02 à 02.04 deux fois de plus pour déterminer la stabilité de l&#39;isolat mucoïde. </li><li> Après l&#39;étape finale de l&#39;isolat, inoculer 4,5 ml de LB avec une seule colonie mucoïde et incuber pendant une nuit dans un agitateur à 37 ° C. </li><li> Le lendemain, l&#39;étiquette 3 microtubes pour chaque mutant mucoïde. </li><li> Préparer deux 1,25 ml aliquotes de culture d&#39;une nuit dans 2 tubes pour l&#39;extraction de l&#39;ADN génomique et l&#39;identification du site d&#39;insertion du transposon (voir protocole n ° 3). </li><li> En outre, archiver chaque mutant mucoïde par pipetage 1 ml de culture durant la nuit dans un CRÉDITScryovial ely-marqué contenant un volume égal de 10% de lait écrémé. Conserver à -86 ° C. </li></ol> 3. ADNg digestion de restriction et ligature <ol><li> Extraire à partir de l&#39;ADNg de la mucoïde mutant en utilisant n&#39;importe quel procédé préféré (par exemple. Phénol-chloroforme, colonne de centrifugation, etc.) </li><li> Déterminer la concentration de l&#39;ADNg, de digérer un total de 2 pg à 1 microlitre de l&#39;endonucléase de restriction Sal I, 0,5 ul d&#39;albumine de sérum bovin, 5 ul de Sali enzyme tampon (100 mM de NaCl, 50 mM Tris-HCl, 10 mM de MgCl2 , 1 mM de dithiothréitol (DTT), pH 7,9 à température ambiante), et le volume approprié de dH 2 O pour obtenir un volume total de 50 ul. </li><li> Digérer l&#39;ADN pendant une nuit à 37 ° C. (IMPORTANT:. Selon l&#39;efficacité de l&#39;enzyme de restriction, il peut être nécessaire d&#39;ajouter un 1 pi supplémentaires pour le résumé du jour au lendemain et incuber à 37 ° C pendant 1-2 heures C&#39;est en plus de la digestion pendant la nuit.) </li><li> Purifier le digeADN STED utilisant n&#39;importe quelle méthode préférée (par exemple agarose de purification de gel, les colonnes de spin) et élue avec 25 pi de tampon. </li><li> Ligaturer l&#39;ADN digéré par mélange de 11 ul d&#39;ADN purifié avec une concentration préférée de ~ 10 à 20 ng / pl, 1,5 pl de tampon de ligature (330 mM de Tris-acétate pH 7,5, 660 mM d&#39;acétate de potassium, l&#39;acétate de magnésium 100 mM, 5 mM DTT), 1,5 ul de 100 mM d&#39;ATP et 1 ul d&#39;ADN ligase. </li><li> Faire incuber le mélange pendant 15 min à température ambiante, et ensuite inactiver l&#39;enzyme par incubation pendant 15 min à 70 ° C. (Remarque: l&#39;incubation du mélange à température ambiante pendant plus peut augmenter le succès de la ligation). </li></ol> 4. PCR inverse (iPCR) et Analyse de séquence <ol><li> Effectuer iPCR sur le produit de ligature en utilisant le texte suivant amorces sens et antisens et conditions thermocycler: Primer-Forward (Gm3OUT): GGGCATACGGGAAGAAGTGA Primer inversée (Gm5OUT): GACTGCCCTGCTGCGTAACA Thermocycleur Conditions: Une. 94 ° C pendant 1 min. 2. 94 ° C pendant 1 min. 3. 58 ° C pendant 2 min. 4. 72 ° C pendant 2 min. 5. 72 ° C pendant 8 min. 6. 10 ° C en attente. Répétez les étapes 2-4 pour 34 cycles. (REMARQUE: Les produits amplifiés PCR inverse peuvent être stockés à 4 ° C) </li><li> Effectuer l&#39;électrophorèse sur gel d&#39;agarose pour confirmer la réussite amplification iPCR. </li><li> Effectuer le séquençage du produit iPCR utilisant les amorces Gm3OUT et Gm5OUT. Le site d&#39;insertion et l&#39;orientation de himar1 sont tracées. </li></ol>

<ol>
	<li>Govan, J. R., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+pathogenesis+in+cystic+fibrosis:+mucoid+Pseudomonas+aeruginosa+and+Burkholderia+cepacia.">Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.</a> Microbiol. Rev. 60, 539-574 (1996).</li><li>Chitnis, C. E., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+the+alginate+biosynthetic+gene+cluster+of+Pseudomonas+aeruginosa+shows+evidence+of+an+operonic+structure.">Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure.</a> Mol. Microbiol. 8, 583-593 (1993).</li><li>Franklin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+AlgG+is+a+polymer+level+alginate+C5-mannuronan+epimerase.">Pseudomonas aeruginosa AlgG is a polymer level alginate C5-mannuronan epimerase.</a> J. Bacteriol. 176, 1821-1830 (1994).</li><li>Franklin, M. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutant+analysis+and+cellular+localization+of+the+AlgI,+AlgJ,+and+AlgF+proteins+required+for+O+acetylation+of+alginate+in+Pseudomonas+aeruginosa.">Mutant analysis and cellular localization of the AlgI, AlgJ, and AlgF proteins required for O acetylation of alginate in Pseudomonas aeruginosa.</a> J. Bacteriol. 184, 3000-3007 (2002).</li><li>Deretic, V., Gill, J. F., Chakrabarty, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+algD+coding+for+GDPmannose+dehydrogenase+is+transcriptionally+activated+in+mucoid+Pseudomonas+aeruginosa.">Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.</a> J. Bacteriol. 169, 351-358 (1987).</li><li>Mathee, K., McPherson, C. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+the+algT+(algU)-encoded+sigma22+for+expression+of+the+alginate+regulon+in+Pseudomonas+aeruginosa+and+localization+of+its+antagonist+proteins+MucA+and+MucB+(AlgN)..">Posttranslational control of the algT (algU)-encoded sigma22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN)..</a> J. Bacteriol. 179, 3711-3720 (1997).</li><li>Boucher, J. C., Schurr, M. J., Yu, H., Rowen, D. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+in+cystic+fibrosis:+role+of+mucC+in+the+regulation+of+alginate+production+and+stress+sensitivity.">Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity.</a> Microbiology. 143, 3473-3480 (1997).</li><li>Martin, D. W., Holloway, B. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+locus+determining+the+mucoid+status+of+Pseudomonas+aeruginosa:+AlgU+shows+sequence+similarities+with+a+Bacillus+sigma+factor.">Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: AlgU shows sequence similarities with a Bacillus sigma factor.</a> J. Bacteriol. 175, 1153-1164 (1993).</li><li>Damron, F. H., Goldberg, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteolytic+regulation+of+alginate+overproduction+in+Pseudomonas+aeruginosa.">Proteolytic regulation of alginate overproduction in Pseudomonas aeruginosa.</a> Mol. Microbiol. 84 (4), 595-607 (2012).</li><li>Browne, P., Barret, M., O'Gara, F., Morrissey, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+prediction+of+the+Crc+regulon+identifies+genus-wide+and+species-specific+targets+of+catabolite+repression+control+in+Pseudomonas+bacteria.">Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria.</a> BMC Microbiol. 10, 300 (2010).</li><li>Damron, F. H., Qiu, D., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pseudomonas+aeruginosa+sensor+kinase+KinB+negatively+controls+alginate+production+through+AlgW-dependent+MucA+proteolysis.">The Pseudomonas aeruginosa sensor kinase KinB negatively controls alginate production through AlgW-dependent MucA proteolysis.</a> J. Bacteriol. 191, 2285-2295 (2009).</li><li>Damron, F. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pseudomonas+aeruginosa+regulon+controlled+by+the+sensor+kinase+KinB+and+sigma+factor+RpoN.">Analysis of the Pseudomonas aeruginosa regulon controlled by the sensor kinase KinB and sigma factor RpoN.</a> J. Bacteriol. 194, 1317-1330 (2012).</li><li>Qiu, D., Eisinger, V. M., Rowen, D. W., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+proteolysis+controls+mucoid+conversion+in+Pseudomonas+aeruginosa.">Regulated proteolysis controls mucoid conversion in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 104, 8107-8112 (2007).</li><li>Schurr, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Which+bacterial+biofilm+exopolysaccharide+is+preferred,+Psl+or+alginate.">Which bacterial biofilm exopolysaccharide is preferred, Psl or alginate.</a> J. Bacteriol. 195, 1623-1626 (2013).</li><li>Wong, S. M., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+footprinting+with+mariner-based+transposition+in+Pseudomonas+aeruginosa.">Genetic footprinting with mariner-based transposition in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 10191-10196 (2000).</li><li>Lampe, D. J., Akerley, B. J., Rubin, E. J., Mekalanos, J. J., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hyperactive+transposase+mutants+of+the+Himar1+mariner+transposon.">Hyperactive transposase mutants of the Himar1 mariner transposon.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 11428-11433 (1999).</li></ol>

L&#39;auteur Hongwei D. Yu est le conseiller scientifique en chef et co-fondateur de ProGenesis Technologies, LLC.

Il est important de noter que ce procédé peut être utilisé dans d&#39;autres espèces de Pseudomonas avec ces altérations: incuber P. fluorescens et P. putida à 30 ° C, et P. stutzeri à 42 ° C; P. stuzeri doit être mis en culture sur des plaques LB supplémenté avec 150 ug / ml de gentamycine, à l&#39;étape 1.11, P. stutzeri cellules doivent être transférés dans 500 pl de LB au lieu de 1 ml. En outre, il ya deux étapes essentielles de ce protocole. T...

La capacité de la opportuniste, agent pathogène Gram négatif Pseudomonas aeruginosa à la surproduction de l&#39;alginate est un facteur majeur dans sa capacité à établir un film biologique. La surproduction d&#39;alginate est un phénotype souvent dénommé mucoidy. L&#39;isolement des colonies mucoïdes de crachats de personnes atteintes de fibrose kystique (FK) est indicative d&#39;une infection chronique, et est directement associée à une baisse générale de la santé du patient 1. Actuellement, il est entendu que la régulation de la production et de l&#39;alginate dans P. aeruginosa se ​​produit principalement à deux opérons. Le premier est l&#39;opéron de biosynthèse de l&#39;alginate, qui contient 12 gènes (ALGD - alg8 - alg44 - algK - Alge - algG - Algx - algL - ALGI - algJ - algF - algA) qui sont responsables de la synthèse et de l&#39;exportation du polymère d&#39;alginate dans le périplasme de la environme extracellulairent 2-5. La deuxième opéron est un groupe de gènes en commençant par le facteur sigma alternatif ALGU / T et en continuant avec Muca, mucB, et mucD. ALGU / T est un régulateur positif, tandis que mucAB-D sont classés en tant que régulateurs négatifs de la production d&#39;alginate 6-8. En outre, les régulateurs de la transcription, tels que ALGB, AlgQ, ALGr, et rpoN, ainsi que post-transcriptionnel et la modification post-traductionnelle par le contrôle de la répression catabolique, l&#39;activité kinase (KinB) et la protéolyse intramembranaire, se sont également avérés être impliqués dans l&#39;alginate réglementation 9-14. Le vecteur de transposon mini-himar1 appelé PFA a été créé à l&#39;origine dans le laboratoire du Dr Mekalanos à Harvard Medical School 15. Le plasmide PFA est constitué d&#39;un élément transposable flanqué de deux répétitions inversées de 27 pb et une cassette de résistance à la gentamycine dans le milieu (aacC1: 534 pb), un gène codant pour la hyperactive transposase mariner 16, et un codage de β-lactamase de gène (bla) (figure 1). L&#39;information de séquence pour les éléments transposables du PFA est disponible au numéro d&#39;accession GenBank: DQ366300 13. Dans PFA, il existe un site de clonage multiple (MCS) derrière le gène aacC1 qui est utilisé pour l&#39;identification du site d&#39;insertion chromosomique en utilisant une PCR inverse. Un avantage majeur à l&#39;utilisation du transposon mini-himar1 a pas de facteurs de l&#39;hôte spécifiques sont nécessaires pour la transposition (mutagenèse). En outre, il existe une grande abondance de sites d&#39;insertion de dinucléotides TA trouvés dans le génome de P. aeruginosa. Par exemple, AT sites d&#39;insertion dinucléotide se produit 94 404 et 100 229 fois dans le PAO1 (6264404 bps, numéro d&#39;accession GenBank NC_002516.2) et PA14 (6537648 bps; numéro d&#39;accès GenBank NC_008463) génomes, respectivement. En raison de l&#39;abondance de dinucléotide TA dans le génome, d&#39;un mini-himar1 </em&gt; Transposon peut provoquer la densité élevée et une mutagénèse aléatoire, ce qui est particulièrement appropriée pour l&#39;analyse des gènes de virulence et des gènes qui sont fortement réglementés. Théoriquement, le transposon mini-himar1 peut insérer dans tout gène non essentiel dans le génome de P. aeruginosa. Ceci permet d&#39;obtenir environ 18 sites d&#39;insertion par TA cadre ouvert de lecture dans le génome de PAO1. Ici, nous décrivons un protocole utilisant des mini-transposon himar1 médiation mutagenèse pour identifier de nouveaux régulateurs de mucoidy dans P. aeruginosa. Plus précisément, nous biparentally conjugué du vecteur PFA contenant un transposon mini-himar1 de E. coli SM10/λpir dans le non mucoïde prototrophique souche PAO1. Après que le transposon est intégré dans le génome, la souche réceptrice est mise en culture sur gélose Pseudomonas isolement (PIA) contenant du triclosan qui inhibe la croissance de E. coli. Ainsi, une banque de mutants d&#39; <em&gt; P. aeruginosa peut être sélectionnée par la croissance de la plaque PIA supplémenté avec de la gentamycine et de la présence du phénotype mucoïde. Remarque, un transposon médiation contre un mutant d&#39;intégration véritable aura un phénotype résistant et carbenicilline sensible gentamicine. Dans cette étude, environ 80 000 mutants d&#39;insertion de PAO1 ont été isolés au moyen de quatre conjugaisons séparées. Nous avons ensuite projeté pour les isolats mucoïdes, et déterminé le site d&#39;insertion par l&#39;enzyme de restriction digestion, ligature et PCR inverse. Nous avons effectué une analyse par transfert de Southern avec la cassette de résistance à la gentamycine comme une sonde pour voir le nombre d&#39;insertion par génome. Nous avons déterminé que plus de 90% des mutants obtenus par conjugaison en utilisant ce protocole n&#39;avait qu&#39;une seule copie du himar1 dans le génome et affiché le phénotype résistant et carbenicilline sensible gentamicine. Un total de 32 isolats muqueuses ont été identifiés, 22 d&#39;entre eux ont été cartographiés à différents loci du P. aeruginosa PAO1chromosome. Ce taux d&#39;insertion prévoit une couverture suffisante pour identifier plusieurs nouveaux régulateurs de surproduction alginate.

<table border="0" cellpadding="0" cellspacing="0" width="780">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:267px;">Luria Broth</td>
			<td style="width:187px;">Difco</td>
			<td style="width:125px;">240230</td>
			<td style="width:203px;">via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pseudomonas isolation agar</td>
			<td>Difco</td>
			<td>292710</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Small Plates (100 O.D. x 10 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-13</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Large Plates (150 O.D. x 15 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-14</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycerol</td>
			<td>Fisher Scientific</td>
			<td>BP229-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Shaking Incubator</td>
			<td>New Brunswick Scientific</td>
			<td>Innova 4080</td>
			<td>shake at 200 rpm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cabinet Incubator</td>
			<td>VWR</td>
			<td>1540</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Microcentrifuge</td>
			<td>Sorvall</td>
			<td>75-003-287</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SmartSpec Plus Spectrophotometer</td>
			<td>Bio-Rad</td>
			<td>170-2525</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Diposable Inoculation Loops</td>
			<td>Fisher Scientific</td>
			<td>22-363-597</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1.5 mL Microcentrifuge Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-408-129</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">15 mL Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-539-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Skim Milk</td>
			<td>Difco</td>
			<td>DF0032-17-3</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNeasy Blood and Tissue (250)&#160;</td>
			<td>Qiagen</td>
			<td>69506</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAquick PCR Purification Kit (250)</td>
			<td>Qiagen</td>
			<td>28106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAprep Spin Miniprep Kit (250)&#160;</td>
			<td>Qiagen</td>
			<td>27106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastLink II DNA Ligation Kit</td>
			<td>Epicentre Technologies</td>
			<td>LK6201H</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accu block Digital Dry Bath&#160;</td>
			<td>Labnet</td>
			<td>NC0205808</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sal1, restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0138L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EasyStart Micro 50</td>
			<td>Molecular BioProducts</td>
			<td>6020</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq DNA Polymerase</td>
			<td>New England BioLabs</td>
			<td>M0267L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iCycler, Thermocycler</td>
			<td>Bio-Rad</td>
			<td>170-8740</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LE agarose</td>
			<td>Genemate</td>
			<td>3120-500</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gentamycin Sulfate</td>
			<td>Fisher Scientific</td>
			<td>BP918-1</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
	</tbody>
</table>

identification of novel genes associated with alginate production in pseudomonas aeruginosa using mini-himar1 mariner transposon-mediated mutagenesis

Pseudomonas aeruginosa est une bactérie à Gram négatif de l&#39;environnement avec des capacités métaboliques polyvalents. P. aeruginosa est une bactérie pathogène opportuniste qui établit des infections pulmonaires chroniques chez les patients atteints de fibrose kystique (FK). La surproduction d&#39;un polysaccharide capsulaire appelé alginate, également connu sous le nom mucoidy, favorise la formation de biofilms mucoïdes qui sont plus résistants que les cellules planctoniques antibiotique et à la chimiothérapie défenses de l&#39;hôte. En outre, la conversion de la non mucoïde au phénotype mucoïde est un marqueur clinique pour le début de l&#39;infection chronique à CF. Surproduction alginate par P. aeruginosa est un processus endergonic qui impose lourdement énergie cellulaire. Par conséquent, la production d&#39;alginate est très réglementé dans P. aeruginosa. Afin de mieux comprendre la régulation de l&#39;alginate, nous décrivons un protocole à l&#39;aide du mini-transposon himar1 mutagenèse pour l&#39;identification de nouveau régulateur d&#39;alginates dans une souche PAO1 prototype. La procédure se compose de deux étapes de base. Tout d&#39;abord, nous avons transféré la mini-himar1 transposon (PFA) de l&#39;hôte E. coli dans SM10/λpir destinataire P. aeruginosa PAO1 par conjugaison biparentale pour créer une bibliothèque de mutants d&#39;insertion à haute densité, qui ont été sélectionnés sur des plaques de gélose Pseudomonas d&#39;isolation additionné de gentamycine. En second lieu, nous avons criblé et isolé les colonies mucoïdes pour mapper le site d&#39;insertion par PCR inverse en utilisant des amorces d&#39;ADN pointant vers l&#39;extérieur à partir de la cassette de la gentamycine et de séquençage de l&#39;ADN. En utilisant ce protocole, nous avons identifié deux nouveaux régulateurs d&#39;alginate, MUCE (PA4033) et kinB (PA5484), à souche PAO1 avec un type sauvage Muca codant pour le facteur anti-sigma Muca pour le régulateur de l&#39;alginate de maître ALGU (ALGT, σ 22) . Ce protocole de mutagenèse à haut débit peut être modifié pour l&#39;identification d&#39;autres gènes liés à la virulence causant le changement dans la colomorphologie ny.

Comme illustré sur la figure 1, le vecteur marin transposon mini-himar1, PFA, contient deux répétitions inversées de 27 pb avec des sites d&#39;insertion TA flanquant la cassette de résistance aacC1 de gentamycine, avec son σ promoteur 70-dépendante, et un site de clonage multiple (MCS). En outre, le vecteur contient des gènes codant pour des PFA la transposase hautement actif de himar1, β-lactamase (bla), et l&#39;opéron de transfert <em...

Watch this Scientific Journal Video about Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis at JoVE.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Ici, nous décrivons un protocole en utilisant la mini-himar1 marin mutagenèse de transposon médiation pour générer une bibliothèque de mutants d&#39;insertion à haute densité à l&#39;écran, isoler et d&#39;identifier de nouveaux régulateurs d&#39;alginate dans le prototype Pseudomonas aeruginosa souche PAO1.

Identification de nouveaux gènes associés à la production d&#39;alginate dans<em&gt; Pseudomonas aeruginosa</em&gt; Utilisation de Mini-<em&gt; Himar1</em&gt; Mutagenèse Mariner Transposon médiation

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

identification-novel-genes-associated-with-alginate-production

Research

JoVE Journal

Immunology and Infection

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

12.2K vues.  Marshall University.  Ici, nous décrivons un protocole en utilisant la mini-himar1 marin mutagenèse de transposon médiation pour générer une bibliothèque de mutants d'insertion à haute densité à l'écran, isoler et d'identifier de nouveaux régulateurs d'alginate dans le prototype Pseudomonas aeruginosa souche PAO1. 

Vidéo: Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living surfaces. In this paper, we describe protocols for forming Pseudomonas aeruginosa biofilms on human airway epithelial cells (CFBE cells) grown in culture. In the first method (termed the Static Co-culture Biofilm Model), P. aeruginosa is incubated with CFBE cells grown as confluent monolayers on standard tissue culture plates. Although the bacterium is quite toxic to epithelial cells, the addition of arginine delays the destruction of the monolayer long enough for biofilms to form on the CFBE cells. The second method (termed the Flow Cell Co-culture Biofilm Model), involves adaptation of a biofilm flow cell apparatus, which is often used in biofilm research, to accommodate a glass coverslip supporting a confluent monolayer of CFBE cells. This monolayer is inoculated with P. aeruginosa and a peristaltic pump then flows fresh medium across the cells. In both systems, bacterial biofilms form within 6-8 hours after inoculation. Visualization of the biofilm is enhanced by the use of P. aeruginosa strains constitutively expressing green fluorescent protein (GFP). The Static and Flow Cell Co-culture Biofilm assays are model systems for early P. aeruginosa infection of the Cystic Fibrosis (CF) lung, and these techniques allow different aspects of P. aeruginosa biofilm formation and virulence to be studied, including biofilm cytotoxicity, measurement of biofilm CFU, and staining and visualizing the biofilm.

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

This paper describes different methods of growing Pseudomonas aeruginosa biofilms on cultured human airway epithelial cells. These protocols can be adapted to study different aspects of biofilm formation, including visualization of the biofilm, staining of the biofilm, measuring the colony forming units (CFU) of the biofilm, and studying biofilm cytotoxicity.

Co-culture des modèles Pseudomonas aeruginosa Les biofilms Cultivé sur le Live cellules des voies respiratoires de l&#39;homme

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living ...

Recherche

Immunologie et infection

Transfection and Mutagenesis of Target Genes in Mosquito Cells by Locked Nucleic Acid-modified Oligonucleotides

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new infections each year. Despite decades of research, there is still no vaccine against malaria, highlighting the need for novel control strategies. One innovative approach is the use of genetically modified mosquitoes to effectively control malaria parasite transmission. Deliberate alterations of cell signaling pathways in the mosquito, via targeted mutagenesis, have been found to regulate parasite development 1. From these studies, we can begin to identify potential gene targets for transformation. Targeted mutagenesis has traditionally relied upon the homologous recombination between a target gene and a large DNA molecule. However, the construction and use of such complex DNA molecules for generation of stably transformed cell lines is costly, time consuming and often inefficient. Therefore, a strategy using locked nucleic acid-modified oligonucleotides (LNA-ONs) provides a useful alternative for introducing artificial single nucleotide substitutions into episomal and chromosomal DNA gene targets (reviewed in 2). LNA-ON-mediated targeted mutagenesis has been used to introduce point mutations into genes of interest in cultured cells of both yeast and mice 3,4. We show here that LNA-ONs can be used to introduce a single nucleotide change in a transfected episomal target that results in a switch from blue fluorescent protein (BFP) expression to green fluorescent protein (GFP) expression in both Anopheles gambiae and Anopheles stephensi cells. This conversion demonstrates for the first time that effective mutagenesis of target genes in mosquito cells can be mediated by LNA-ONs and suggests that this technique may be applicable to mutagenesis of chromosomal targets in vitro and in vivo.

Oligonucleotides can be used to site specifically substitute a single nucleotide of transfected target genes in both Anopheles gambiae and Anopheles stephensi cells.

La transfection et la mutagenèse des gènes cibles dans les cellules de moustiques en Fermés d&#39;acide nucléique modifiés Oligonucléotides

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new ...

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological properties compared to free living microorganisms. Biofilms in nature are often difficult to investigate and reside under poorly defined conditions1. Using a transparent substratum it is possible to device a system where simple biofilms can be examined in a non-destructive way in real-time: here we demonstrate the assembly and operation of a flow cell model system, for in vitro 3D studies of microbial biofilms generating high reproducibility under well-defined conditions2,3.
The system consists of a flow cell that serves as growth chamber for the biofilm. The flow cell is supplied with nutrients and oxygen from a medium flask via a peristaltic pump and spent medium is collected in a waste container. This construction of the flow system allows a continuous supply of nutrients and administration of e.g. antibiotics with minimal disturbance of the cells grown in the flow chamber. Moreover, the flow conditions within the flow cell allow studies of biofilm exposed to shear stress. A bubble trapping device confines air bubbles from the tubing which otherwise could disrupt the biofilm structure in the flow cell.
The flow cell system is compatible with Confocal Laser Scanning Microscopy (CLSM) and can thereby provide highly detailed 3D information about developing microbial biofilms. Cells in the biofilm can be labeled with fluorescent probes or proteins compatible with CLSM analysis. This enables online visualization and allows investigation of niches in the developing biofilm. Microbial interrelationship, investigation of antimicrobial agents or the expression of specific genes, are of the many experimental setups that can be investigated in the flow cell system.

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Protocol describing the application of a flow cell system for growing and analyzing microbial biofilms for Confocal Laser Scanning Microscopy (CLSM).

Pseudomonas aeruginosa et le biofilm Saccharomyces cerevisiae en cellules à flux

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological ...

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with leukemia, severe burn wounds, or organ transplants1. In patients at high-risk for developing PA bloodstream infections, the gastrointestinal (GI) tract is the main reservoir for colonization2, but the mechanisms by which PA transitions from an asymptomatic colonizing microbe to an invasive, and often deadly, pathogen are unclear. Previously, we performed in vivo transcription profiling experiments by recovering PA mRNA from bacterial cells residing in the cecums of colonized mice 3 in order to identify changes in bacterial gene expression during alterations to the host&#x2019;s immune status.
As with any transcription profiling experiment, the rate-limiting step is in the isolation of sufficient amounts of high quality mRNA. Given the abundance of enzymes, debris, food residues, and particulate matter in the GI tract, the challenge of RNA isolation is daunting. Here, we present a method for reliable and reproducible isolation of bacterial RNA recovered from the murine GI tract. This method utilizes a well-established murine model of PA GI colonization and neutropenia-induced dissemination4. Once GI colonization with PA is confirmed, mice are euthanized and cecal contents are recovered and flash frozen. RNA is then extracted using a combination of mechanical disruption, boiling, phenol/chloroform extractions, DNase treatment, and affinity chromatography. Quantity and purity are confirmed by spectrophotometry (Nanodrop Technologies) and bioanalyzer (Agilent Technologies) (Fig 1). This method of GI microbial RNA isolation can easily be adapted to other bacteria and fungi as well.

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

A reliable method for the RNA isolation of Pseudomonas aeruginosa recovered from murine cecums is described. The RNA recovered is of sufficient quantity and quality for subsequent qPCR, transcription profiling, and RNA Seq experiments. This technique can be adapted for RNA isolation of other intestinal microbes.

Isolement des ARN Pseudomonas aeruginosa La colonisation du tractus gastro-intestinal murin

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with ...

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

There is growing concern about the relevance of in vitro antimicrobial susceptibility tests when applied to isolates of P. aeruginosa from cystic fibrosis (CF) patients. Existing methods rely on single or a few isolates grown aerobically and planktonically. Predetermined cut-offs are used to define whether the bacteria are sensitive or resistant to any given antibiotic1. However, during chronic lung infections in CF, P. aeruginosa populations exist in biofilms and there is evidence that the environment is largely microaerophilic2. The stark difference in conditions between bacteria in the lung and those during diagnostic testing has called into question the reliability and even relevance of these tests3.
 Artificial sputum medium (ASM) is a culture medium containing the components of CF patient sputum, including amino acids, mucin and free DNA. P. aeruginosa growth in ASM mimics growth during CF infections, with the formation of self-aggregating biofilm structures and population divergence4,5,6. The aim of this study was to develop a microtitre-plate assay to study antimicrobial susceptibility of P. aeruginosa based on growth in ASM, which is applicable to both microaerophilic and aerobic conditions.
 An ASM assay was developed in a microtitre plate format. P. aeruginosa biofilms were allowed to develop for 3 days prior to incubation with antimicrobial agents at different concentrations for 24 hours. After biofilm disruption, cell viability was measured by staining with resazurin. This assay was used to ascertain the sessile cell minimum inhibitory concentration (SMIC) of tobramycin for 15 different P. aeruginosa isolates under aerobic and microaerophilic conditions and SMIC values were compared to those obtained with standard broth growth. Whilst there was some evidence for increased MIC values for isolates grown in ASM when compared to their planktonic counterparts, the biggest differences were found with bacteria tested in microaerophilic conditions, which showed a much increased resistance up to a &gt;128 fold, towards tobramycin in the ASM system when compared to assays carried out in aerobic conditions.
 The lack of association between current susceptibility testing methods and clinical outcome has questioned the validity of current methods3. Several in vitro models have been used previously to study P. aeruginosa biofilms7, 8. However, these methods rely on surface attached biofilms, whereas the ASM biofilms resemble those observed in the CF lung9 . In addition, reduced oxygen concentration in the mucus has been shown to alter the behavior of P. aeruginosa2 and affect antibiotic susceptibility10. Therefore using ASM under microaerophilic conditions may provide a more realistic environment in which to study antimicrobial susceptibility.

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

Current diagnostic antimicrobial susceptibility testing relies on the planktonic growth of isolates in nutrient rich, aerobic conditions. Here, we employ an alternative artificial sputum medium to study antimicrobial susceptibility of Pseudomonas aeruginosa biofilms under both aerobic and microaerophilic conditions more representative of the cystic fibrosis lung.

L&#39;utilisation de moyen d&#39;expectoration artificielle pour tester l&#39;efficacité des antibiotiques contre<em&gt; Pseudomonas aeruginosa</em&gt; Dans des conditions plus pertinents à la fibrose kystique du poumon

There  is growing concern about the relevance of in vitro antimicrobial  susceptibility tests when applied to isolates of P. aeruginosa from  cystic ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

Chronique à long terme<em&gt; Pseudomonas aeruginosa</em&gt; Infection des voies respiratoires chez les souris

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

Pseudomonas aeruginosa Induced Lung Injury Model

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. Here we have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa (P. aeruginosa or PA). Using this model, we were able to show lung inflammation at the early phase of injury. In addition, alveolar epithelial barrier leakiness was observed by analyzing bronchoalveolar lavage (BAL); and alveolar cell death was observed by Tunel assay using tissue prepared from injured lungs. At a later phase following injury, we observed cell proliferation required for the repair process. The injury was resolved 7 days from the initiation of P. aeruginosa injection. This model mimics the sequential course of lung inflammation, injury and repair during pneumonia. This clinically relevant animal model is suitable for studying pathology, mechanism of repair, following acute lung injury, and also can be used to test potential therapeutic agents for this disease.

Pseudomonas aeruginosa Induced Lung Injury Model

We have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa. This model mimics lung injury during pneumonia and is clinically relevant.

Pseudomonas aeruginosa lésion pulmonaire induite par modèle

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Réplication de l’ordonné, bibliothèque non redondante de la souche Pseudomonas aeruginosa PA14 Transposon Mutants d’Insertion

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary tissue during pneumonia results in the production of long-lived cytotoxins that can lead to subsequent end organ failure. We have developed in vitro assays to test the hypothesis that cytotoxins are produced during pulmonary infection. Isolated rat pulmonary endothelial cells and the bacterium Pseudomonas aeruginosa are used as model systems, and the production of cytoxins following infection of the endothelial cells by the bacteria is demonstrated using cell culture followed by direct quantitation using lactate dehydrogenase assays and a novel microscopic method utilizing ImageJ technology. The amyloid nature of these cytotoxins was demonstrated by thioflavin T binding assays and by immunoblotting and immunodepletion using A11 anti-amyloid antibody. Further analyses using immunoblotting demonstrated that oligomeric tau and A&#946; were produced and released by endothelial cells following infection by P. aeruginosa. These methods should be readily adaptable to analyses of human clinical samples.

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Simple methods are described for demonstrating the production of cytotoxic amyloids following infection of pulmonary endothelium by Pseudomonas aeruginosa.

Méthodes pour détecter les cytotoxiques amyloïdes suivant Infection de pulmonaire cellules endothéliales par Pseudomonas aeruginosa

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

Génération de mutants de suppression de gène dans le cadre dans Pseudomonas aeruginosa et essai pour l'atténuation de virulence dans un modèle simple de souris de l'infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...