Este trabalho foi apoiado pelo Aeronautics and Space Administration West Virginia Space Grant Consortium Nacional (NASA WVSGC), Cystic Fibrosis Foundation (CFF-YU11G0) e NIH P20RR016477 e P20GM103434 à Rede IDeA West Virginia for Biomedical Research Excellence. Agradecemos Vonya M. Eisinger para a assistência técnica com este trabalho.

1. Preparação de Estirpes Bacterianas e biparentais Conjugação <ol><li> Inocular E. coli SM10/λpir/pFAC em 5 ml de caldo de Luria (LB) suplementado com 15 ug / ml de gentamicina e colocar num incubador com agitação durante a noite a 37 ° C. </li><li> Inocular P. aeruginosa PAO1 tensão em 5 ml de LB, e coloque em uma incubadora de agitação durante a noite a 42 ° C. </li><li> Meça OD 600 de culturas durante a noite e misture quantidades iguais de PAO1 e E. coli PFAC de tal modo que o volume final é entre 1-1,4 ml. </li><li> Centrifuga-se a mistura de 6000 g durante 5 min. </li><li> Por outro lado, secar as placas de LB para conjugação: deixar abertas as placas na incubadora a 37 ° C durante 10-15 min. </li><li> Remova todos, mas 50 ul de sobrenadante de mistura de células. </li><li> Ressuspender o sedimento de células nos restantes 50 ul de sobrenadante e pipeta para uma placa de LB seco em uma gotícula compacto. </li><li> Com cuidado, coloque a placa em um exaustor para secar (IMPONota RTANT: Não deixe que as células se espalham sobre a placa, isso vai diminuir significativamente a eficiência da conjugação). </li><li> Uma vez que a gotícula é seco, inverter a placa LB e incubar a 37 ° C durante 4-6 horas. </li><li> Enquanto a mistura de células é a incubação, preparar grandes placas PIA (150 x 15 mm OD) com 300 ug / ml de gentamicina. Antes da utilização, remover a humidade residual por colocar numa incubadora a 37 ° C durante 15-20 min. </li><li> Após a incubação da mistura de células está concluída, a colheita das células utilizando uma ansa de inoculação estéril e de um tubo de microcentrífuga contendo 1 ml de LB e vórtice, ou pipeta, para misturar completamente. </li><li> Espalhe as células uniformemente sobre as grandes placas PIA contém 300 mg / ml de gentamicina. (IMPORTANTE: Para este passo, é melhor adicionar volumes crescentes de a mistura de células para separar as placas (por exemplo, placa de 1: 10 ul, Placa 2: 50 ul, Placa 3: 100 ul, Placa 4: 500 ul, etc) . </li><li> Incubar durante a noite a 37° C. </li></ol> 2. Detecção e isolamento de colónias mucóides <ol><li> Remover placas da incubadora e examinar para colônias mucóides. </li><li> Isolar uma única colônia de muco e estrias para isolamento em pequenas placas (100 OD x 10 mm) com PIA e 300 mg / ml de gentamicina. </li><li> Incubar durante a noite a 37 ° C. </li><li> Repetir a etapa 2.2 em cultura durante a noite anterior. </li><li> Repita os passos de 2,2-2,4, mais duas vezes, para determinar a estabilidade do isolado mucóide. </li><li> Após o passo final de isolamento, o inocular 4,5 ml de LB com uma única colónia mucóide e incubar no agitador durante a noite a 37 ° C. </li><li> No dia seguinte, etiqueta 3 microtubos para cada mutante mucóide. </li><li> Prepare dois 1,25 ml alíquotas de cultura durante a noite em dois tubos para extração de DNA genômico e identificação do local de inserção do transposon (ver protocolo 3). </li><li> Adicionalmente, arquivar cada mutante mucóide pipetando 1 ml da cultura durante a noite em um DOTAÇÕEScriotubo ely-marcado contendo um volume igual de 10% de leite desnatado. Guarde-o em -86 ° C. </li></ol> 3. gDNA Restrição Digestão e ligadura <ol><li> Extrair ADNg do mutante mucóide usando qualquer método preferido (fenol-clorofórmio, a coluna de centrifugação, por exemplo., Etc.) </li><li> Determinar a concentração do ADNg, digerir com um total de 2 mg com 1 ul da endonuclease de restrição Sall, 0,5 ul de albumina de soro de bovino, 5 uL de tampão de enzima Sall (100 mM de NaCl, 50 mM Tris-HCl, 10 mM de MgCl2 , ditiotreitol 1 mM (DTT), pH 7,9 à temperatura ambiente), e o volume adequado de dH2O para obter um volume total de 50 ul. </li><li> Digerir o ADN durante a noite a 37 ° C. (IMPORTANTE:. Dependendo da eficiência do enzima de restrição, pode ser necessário adicionar um adicional de 1 ml para a digestão durante a noite e incubar a 37 ° C durante 1-2 hr Isto é em adição à digestão durante a noite.) </li><li> Purifica-se o DigeADN STED usando qualquer método preferido (por exemplo, purificação em gel de agarose, coluna de spin) e elui-se com 25 mL de tampão. </li><li> Ligar o DNA digerido, misturando 11 ul de ADN purificado com uma concentração preferida de ~ 10-20 ng / mL, 1,5 mL de ligadura Buffer (330 mM de Tris-acetato, pH 7,5, 660 mM acetato de potássio, 100 mM de acetato de magnésio, 5 mM DTT), 1,5 ul de ATP 100 mM e 1 uL de ligase de ADN. </li><li> Incubar a mistura durante 15 minutos à temperatura ambiente, e, em seguida, desactivar a enzima por incubação durante 15 min a 70 ° C. (Nota: A incubação da mistura à temperatura ambiente durante mais longa pode aumentar o sucesso da ligação). </li></ol> 4. PCR Inverso (IPCR) e Análise de Sequência <ol><li> Realizar IPCR no produto de ligação com a seguinte iniciadores directos e inversos e termociclagem condições: -Forward Primer (Gm3OUT): GGGCATACGGGAAGAAGTGA -Reverse Primer (Gm5OUT): GACTGCCCTGCTGCGTAACA Termociclador Condições: 1. 94 ° C durante 1 min. 2. 94 ° C durante 1 min. 3. 58 ° C durante 2 min. 4. 72 ° C durante 2 min. 5. 72 ° C durante 8 min. 6. 10 ° C preensão. Repita os passos 2-4 para 34 ciclos. (NOTA: Os produtos amplificados IPCR pode ser armazenado a 4 ° C.) </li><li> Realizar a electroforese em gel de agarose para confirmar a amplificação de IPCR bem sucedida. </li><li> Realizar a sequenciação do produto de IPCR utilizando os iniciadores Gm3OUT e Gm5OUT. O local de inserção e orientação de himar1 são mapeados. </li></ol>

<ol>
	<li>Govan, J. R., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+pathogenesis+in+cystic+fibrosis:+mucoid+Pseudomonas+aeruginosa+and+Burkholderia+cepacia.">Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.</a> Microbiol. Rev. 60, 539-574 (1996).</li><li>Chitnis, C. E., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+the+alginate+biosynthetic+gene+cluster+of+Pseudomonas+aeruginosa+shows+evidence+of+an+operonic+structure.">Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure.</a> Mol. Microbiol. 8, 583-593 (1993).</li><li>Franklin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+AlgG+is+a+polymer+level+alginate+C5-mannuronan+epimerase.">Pseudomonas aeruginosa AlgG is a polymer level alginate C5-mannuronan epimerase.</a> J. Bacteriol. 176, 1821-1830 (1994).</li><li>Franklin, M. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutant+analysis+and+cellular+localization+of+the+AlgI,+AlgJ,+and+AlgF+proteins+required+for+O+acetylation+of+alginate+in+Pseudomonas+aeruginosa.">Mutant analysis and cellular localization of the AlgI, AlgJ, and AlgF proteins required for O acetylation of alginate in Pseudomonas aeruginosa.</a> J. Bacteriol. 184, 3000-3007 (2002).</li><li>Deretic, V., Gill, J. F., Chakrabarty, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+algD+coding+for+GDPmannose+dehydrogenase+is+transcriptionally+activated+in+mucoid+Pseudomonas+aeruginosa.">Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.</a> J. Bacteriol. 169, 351-358 (1987).</li><li>Mathee, K., McPherson, C. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+the+algT+(algU)-encoded+sigma22+for+expression+of+the+alginate+regulon+in+Pseudomonas+aeruginosa+and+localization+of+its+antagonist+proteins+MucA+and+MucB+(AlgN)..">Posttranslational control of the algT (algU)-encoded sigma22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN)..</a> J. Bacteriol. 179, 3711-3720 (1997).</li><li>Boucher, J. C., Schurr, M. J., Yu, H., Rowen, D. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+in+cystic+fibrosis:+role+of+mucC+in+the+regulation+of+alginate+production+and+stress+sensitivity.">Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity.</a> Microbiology. 143, 3473-3480 (1997).</li><li>Martin, D. W., Holloway, B. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+locus+determining+the+mucoid+status+of+Pseudomonas+aeruginosa:+AlgU+shows+sequence+similarities+with+a+Bacillus+sigma+factor.">Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: AlgU shows sequence similarities with a Bacillus sigma factor.</a> J. Bacteriol. 175, 1153-1164 (1993).</li><li>Damron, F. H., Goldberg, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteolytic+regulation+of+alginate+overproduction+in+Pseudomonas+aeruginosa.">Proteolytic regulation of alginate overproduction in Pseudomonas aeruginosa.</a> Mol. Microbiol. 84 (4), 595-607 (2012).</li><li>Browne, P., Barret, M., O'Gara, F., Morrissey, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+prediction+of+the+Crc+regulon+identifies+genus-wide+and+species-specific+targets+of+catabolite+repression+control+in+Pseudomonas+bacteria.">Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria.</a> BMC Microbiol. 10, 300 (2010).</li><li>Damron, F. H., Qiu, D., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pseudomonas+aeruginosa+sensor+kinase+KinB+negatively+controls+alginate+production+through+AlgW-dependent+MucA+proteolysis.">The Pseudomonas aeruginosa sensor kinase KinB negatively controls alginate production through AlgW-dependent MucA proteolysis.</a> J. Bacteriol. 191, 2285-2295 (2009).</li><li>Damron, F. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pseudomonas+aeruginosa+regulon+controlled+by+the+sensor+kinase+KinB+and+sigma+factor+RpoN.">Analysis of the Pseudomonas aeruginosa regulon controlled by the sensor kinase KinB and sigma factor RpoN.</a> J. Bacteriol. 194, 1317-1330 (2012).</li><li>Qiu, D., Eisinger, V. M., Rowen, D. W., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+proteolysis+controls+mucoid+conversion+in+Pseudomonas+aeruginosa.">Regulated proteolysis controls mucoid conversion in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 104, 8107-8112 (2007).</li><li>Schurr, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Which+bacterial+biofilm+exopolysaccharide+is+preferred,+Psl+or+alginate.">Which bacterial biofilm exopolysaccharide is preferred, Psl or alginate.</a> J. Bacteriol. 195, 1623-1626 (2013).</li><li>Wong, S. M., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+footprinting+with+mariner-based+transposition+in+Pseudomonas+aeruginosa.">Genetic footprinting with mariner-based transposition in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 10191-10196 (2000).</li><li>Lampe, D. J., Akerley, B. J., Rubin, E. J., Mekalanos, J. J., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hyperactive+transposase+mutants+of+the+Himar1+mariner+transposon.">Hyperactive transposase mutants of the Himar1 mariner transposon.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 11428-11433 (1999).</li></ol>

O autor Hongwei D. Yu é a Ciência Officer e co-fundador da progênese Technologies, LLC Chefe.

É importante notar que este método pode ser utilizado em outras espécies de Pseudomonas com essas alterações: incubar P. e P. fluorescens putida a 30 ° C, e P. stutzeri a 42 ° C; p stuzeri devem ser cultivadas em placas de LB suplementadas com 150 ug / ml de gentamicina; no passo 1.11, P. células stutzeri deve ser transferido para 500 mL de LB em vez de 1 ml. Para além disso, existem dois passos críticos para este protocolo. Em primeiro lugar, a es...

A capacidade do oportunista, patógeno Gram-negativa Pseudomonas aeruginosa a produzir alginato é um fator importante na sua capacidade de estabelecer um biofilme. A superprodução de alginato é um fenótipo muitas vezes referida como mucoidy. O isolamento das colônias mucóides de amostras de escarro de indivíduos que sofrem de fibrose cística (FC) é indicativo de uma infecção crônica, e está diretamente associado a um declínio geral na saúde do paciente 1. Atualmente, entende-se que a regulamentação e produção de alginato em P. aeruginosa ocorre principalmente em dois operões. O primeiro é o operon biossintética alginato, que contém 12 genes (algD - alg8 - alg44 - algK - Alge - algG - algX - algL - ALGI - algJ - algF - alga) que são responsáveis ​​pela síntese e exportação do polímero alginato através periplasma para o Environme extracelularnt 2-5. A segunda operon é um conjunto de genes que começa com o fator sigma alternativo Algu / T e continuando com Muca, mucB e mucD. Algu / T é um regulador positivo, enquanto mucAB-D são classificados como reguladores negativos da produção de alginato de 6-8. Além disso, reguladores de transcrição, tais como ALGB, AlgQ, AlgR, e RPON, bem como pós-transcricional e modificação pós-tradução pela repressão catabólica de controlo, a actividade da cinase (KinB) e proteólise intramembrane, têm também sido mostrado para ser envolvido em alginato regulação 9-14. O vetor de transposon mini-himar1 conhecido como PFAC foi originalmente criado em laboratório Dr. Mekalanos &#39;na Harvard Medical School 15. O plasmídeo PFAC consiste de um elemento transponível flanqueado por duas repetições invertidas de 27 pb e uma cassete de resistência à gentamicina no meio (aacC1: 534 pb), um gene que codifica para a hyperactive transposase marinheiro 16, e um gene que codifica a β-lactamase (bla) (Figura 1). A informação da sequência para o elemento transponível de PFAC está disponível com o número de acesso do GenBank: DQ366300 13. Em PFAC, há um local de clonagem múltipla (MCS) atrás do gene aacC1 que é utilizado para a identificação do local de inserção cromossómico utilizando PCR inversa. Uma grande vantagem com o uso do transposon mini-himar1 há fatores do hospedeiro específicas são necessárias para a transposição (mutagênese). Além disso, existe uma grande abundância de sítios de inserção dinucleotidicos TA encontrados em todo o genoma de P. aeruginosa. Por exemplo, locais de inserção dinucleotide TA ocorre 94.404 e 100.229 vezes no PAO1 (6.264.404 bps, GenBank número de acesso NC_002516.2) e PA14 (6.537.648 bps; número de acesso GenBank NC_008463) genomas, respectivamente. Devido à abundância de TA dinucleotide no genoma, mini-himar1 </em&gt; Transposão pode causar a maior densidade e mutagénese aleatória, que é particularmente adequada para a análise de genes de virulência e os genes que são altamente regulados. Teoricamente, o transposão mini-himar1 pode inserir qualquer gene não essencial no genoma de P. aeruginosa. Isto fornece cerca de 18 locais de inserção TA por quadro de leitura aberta no genoma PAO1. Aqui, nós descrevemos um protocolo usando a mutagênese mediada por transposon mini-himar1 para identificar novos reguladores de mucoidy em P. aeruginosa. Mais especificamente, o vector biparentally conjugado PFAC contendo um transposão mini-himar1 de E. coli SM10/λpir no PAO1 tensão prototrófico nonmucoid. Após o transposão está integrado no genoma, a estirpe receptora é cultivado em Pseudomonas isolamento de agar (AIP) contendo triclosan, que inibe o crescimento de E. coli. Assim, uma biblioteca de mutantes de <em&gt; P. aeruginosa podem ser seleccionados pelo crescimento na placa PIA suplementado com gentamicina e a presença do fenótipo mucóide. Note-se, um contra um mutante integração mediada por transposon verdadeiro terá um fenótipo resistente e sensível à carbenicilina gentamicina. Neste estudo, aproximadamente 80.000 mutantes de inserção de PAO1 foram isolados por meio de quatro conjugações separadas. Em seguida, rastreados para isolados mucóides, e determinado o local de inserção por digestão com enzimas de restrição, ligação e PCR inversa. Foram realizadas análises de Southern blot utilizando a cassete de resistência a gentamicina como uma sonda para ver o número de inserção por genoma. Determinou-se que mais de 90% de mutantes obtidos por conjugação utilizando este protocolo tinha uma única cópia do himar1 no genoma e exibido o fenótipo de resistência à carbenicilina e sensíveis à gentamicina. Foi identificado um total de 32 isolados mucóides, 22 deles foram mapeados para diferentes loci da P. aeruginosa PAO1cromossomo. Esta taxa de inserção fornece uma cobertura adequada para identificar vários novos reguladores de superprodução alginato.

<table border="0" cellpadding="0" cellspacing="0" width="780">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:267px;">Luria Broth</td>
			<td style="width:187px;">Difco</td>
			<td style="width:125px;">240230</td>
			<td style="width:203px;">via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pseudomonas isolation agar</td>
			<td>Difco</td>
			<td>292710</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Small Plates (100 O.D. x 10 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-13</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Large Plates (150 O.D. x 15 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-14</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycerol</td>
			<td>Fisher Scientific</td>
			<td>BP229-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Shaking Incubator</td>
			<td>New Brunswick Scientific</td>
			<td>Innova 4080</td>
			<td>shake at 200 rpm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cabinet Incubator</td>
			<td>VWR</td>
			<td>1540</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Microcentrifuge</td>
			<td>Sorvall</td>
			<td>75-003-287</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SmartSpec Plus Spectrophotometer</td>
			<td>Bio-Rad</td>
			<td>170-2525</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Diposable Inoculation Loops</td>
			<td>Fisher Scientific</td>
			<td>22-363-597</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1.5 mL Microcentrifuge Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-408-129</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">15 mL Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-539-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Skim Milk</td>
			<td>Difco</td>
			<td>DF0032-17-3</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNeasy Blood and Tissue (250)&#160;</td>
			<td>Qiagen</td>
			<td>69506</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAquick PCR Purification Kit (250)</td>
			<td>Qiagen</td>
			<td>28106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAprep Spin Miniprep Kit (250)&#160;</td>
			<td>Qiagen</td>
			<td>27106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastLink II DNA Ligation Kit</td>
			<td>Epicentre Technologies</td>
			<td>LK6201H</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accu block Digital Dry Bath&#160;</td>
			<td>Labnet</td>
			<td>NC0205808</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sal1, restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0138L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EasyStart Micro 50</td>
			<td>Molecular BioProducts</td>
			<td>6020</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq DNA Polymerase</td>
			<td>New England BioLabs</td>
			<td>M0267L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iCycler, Thermocycler</td>
			<td>Bio-Rad</td>
			<td>170-8740</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LE agarose</td>
			<td>Genemate</td>
			<td>3120-500</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gentamycin Sulfate</td>
			<td>Fisher Scientific</td>
			<td>BP918-1</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
	</tbody>
</table>

identification of novel genes associated with alginate production in pseudomonas aeruginosa using mini-himar1 mariner transposon-mediated mutagenesis

Pseudomonas aeruginosa é uma bactéria Gram-negativa, do meio ambiente com as capacidades metabólicas versáteis. P aeruginosa é uma bactéria patogênica oportunista que estabelece infecções pulmonares crônicas em pacientes com fibrose cística (FC). O excesso de produção de um polissacarídeo capsular chamado alginato, também conhecido como mucoidy, promove a formação de biofilmes mucóides que são mais resistentes que as células planctônicas a quimioterapia antibiótico e as defesas do hospedeiro. Além disso, a conversão do nonmucoid para fenótipo mucóide é um marcador clínico para o início da infecção crónica em CF. Superprodução alginato por P. aeruginosa é um processo endergonic que tributa pesadamente energia celular. Portanto, a produção de alginato é altamente regulado em P. aeruginosa. Para compreender melhor regulação alginato, nós descrevemos um protocolo utilizando a mutagénese de transposões mini-himar1 para a identificação de novos regulador alginatos em um PAO1 cepa protótipo. O processo consiste em duas etapas principais. Em primeiro lugar, nós transferimos o transposon mini-himar1 (PFAC) do host E. coli SM10/λpir em destinatário P. aeruginosa PAO1 por conjugação entre parentes para criar uma biblioteca de mutantes de inserção de alta densidade, que foram seleccionados em placas de agar de isolamento Pseudomonas suplementado com gentamicina. Em segundo lugar, nós analisamos e isoladas as colónias mucóides para mapear o local de inserção por meio de PCR inversa utilizando iniciadores de ADN que apontam para fora a partir da cassete de gentamicina e sequenciação de ADN. Usando este protocolo, foram identificados dois reguladores novas alginato, Muce (PA4033) e kinB (PA5484), em PAO1 tensão com um tipo selvagem Muca que codifica o fator anti-sigma MUCA para o alginato regulador mestre Algu (ALGT, σ 22) . Este protocolo de mutagénese de alto rendimento podem ser modificados para a identificação de outros genes de virulência causando alterações no colomorfologia ny.

Tal como ilustrado na Figura 1, o vector de mariner transposão mini-himar1, PFAC, contém duas repetições invertidas com 27 pb que flanqueia os locais de inserção de TA a cassete de resistência à gentamicina aacC1, com o seu promotor σ 70-dependente, e um local de clonagem múltipla (MCS). Além disso, o vector contém os genes que codificam PFAC transposase altamente activa himar1, β-lactamase (bla), e o operão transferência tra. Os loc...

Watch this Scientific Journal Video about Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis at JoVE.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Aqui nós descrevemos um protocolo com o marinheiro mutagênese mini-himar1 mediada por transposon para gerar uma biblioteca de mutantes de inserção de alta densidade para a tela, isolar e identificar novos reguladores de alginato no protótipo PAO1 cepa Pseudomonas aeruginosa.

Identificação de novos genes associados com alginato de Produção em<em&gt; Pseudomonas aeruginosa</em&gt; Usando Mini-<em&gt; Himar1</em&gt; Mutagênese Mariner Transposon mediada

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

identification-novel-genes-associated-with-alginate-production

Research

JoVE Journal

Immunology and Infection

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

12.2K visualizações.  Marshall University.  Aqui nós descrevemos um protocolo com o marinheiro mutagênese mini-himar1 mediada por transposon para gerar uma biblioteca de mutantes de inserção de alta densidade para a tela, isolar e identificar novos reguladores de alginato no protótipo PAO1 cepa Pseudomonas aeruginosa. 

Vídeo: Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living surfaces. In this paper, we describe protocols for forming Pseudomonas aeruginosa biofilms on human airway epithelial cells (CFBE cells) grown in culture. In the first method (termed the Static Co-culture Biofilm Model), P. aeruginosa is incubated with CFBE cells grown as confluent monolayers on standard tissue culture plates. Although the bacterium is quite toxic to epithelial cells, the addition of arginine delays the destruction of the monolayer long enough for biofilms to form on the CFBE cells. The second method (termed the Flow Cell Co-culture Biofilm Model), involves adaptation of a biofilm flow cell apparatus, which is often used in biofilm research, to accommodate a glass coverslip supporting a confluent monolayer of CFBE cells. This monolayer is inoculated with P. aeruginosa and a peristaltic pump then flows fresh medium across the cells. In both systems, bacterial biofilms form within 6-8 hours after inoculation. Visualization of the biofilm is enhanced by the use of P. aeruginosa strains constitutively expressing green fluorescent protein (GFP). The Static and Flow Cell Co-culture Biofilm assays are model systems for early P. aeruginosa infection of the Cystic Fibrosis (CF) lung, and these techniques allow different aspects of P. aeruginosa biofilm formation and virulence to be studied, including biofilm cytotoxicity, measurement of biofilm CFU, and staining and visualizing the biofilm.

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

This paper describes different methods of growing Pseudomonas aeruginosa biofilms on cultured human airway epithelial cells. These protocols can be adapted to study different aspects of biofilm formation, including visualization of the biofilm, staining of the biofilm, measuring the colony forming units (CFU) of the biofilm, and studying biofilm cytotoxicity.

Co-cultura de Modelos Pseudomonas aeruginosa Biofilmes Grown no Live Células Airway Humanos

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living ...

Imunologia e Infecção

Transfection and Mutagenesis of Target Genes in Mosquito Cells by Locked Nucleic Acid-modified Oligonucleotides

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new infections each year. Despite decades of research, there is still no vaccine against malaria, highlighting the need for novel control strategies. One innovative approach is the use of genetically modified mosquitoes to effectively control malaria parasite transmission. Deliberate alterations of cell signaling pathways in the mosquito, via targeted mutagenesis, have been found to regulate parasite development 1. From these studies, we can begin to identify potential gene targets for transformation. Targeted mutagenesis has traditionally relied upon the homologous recombination between a target gene and a large DNA molecule. However, the construction and use of such complex DNA molecules for generation of stably transformed cell lines is costly, time consuming and often inefficient. Therefore, a strategy using locked nucleic acid-modified oligonucleotides (LNA-ONs) provides a useful alternative for introducing artificial single nucleotide substitutions into episomal and chromosomal DNA gene targets (reviewed in 2). LNA-ON-mediated targeted mutagenesis has been used to introduce point mutations into genes of interest in cultured cells of both yeast and mice 3,4. We show here that LNA-ONs can be used to introduce a single nucleotide change in a transfected episomal target that results in a switch from blue fluorescent protein (BFP) expression to green fluorescent protein (GFP) expression in both Anopheles gambiae and Anopheles stephensi cells. This conversion demonstrates for the first time that effective mutagenesis of target genes in mosquito cells can be mediated by LNA-ONs and suggests that this technique may be applicable to mutagenesis of chromosomal targets in vitro and in vivo.

Oligonucleotides can be used to site specifically substitute a single nucleotide of transfected target genes in both Anopheles gambiae and Anopheles stephensi cells.

Transfecção e Mutagênese de genes alvo em células de mosquito por Locked de ácido nucléico modificados Oligonucleotídeos

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new ...

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological properties compared to free living microorganisms. Biofilms in nature are often difficult to investigate and reside under poorly defined conditions1. Using a transparent substratum it is possible to device a system where simple biofilms can be examined in a non-destructive way in real-time: here we demonstrate the assembly and operation of a flow cell model system, for in vitro 3D studies of microbial biofilms generating high reproducibility under well-defined conditions2,3.
The system consists of a flow cell that serves as growth chamber for the biofilm. The flow cell is supplied with nutrients and oxygen from a medium flask via a peristaltic pump and spent medium is collected in a waste container. This construction of the flow system allows a continuous supply of nutrients and administration of e.g. antibiotics with minimal disturbance of the cells grown in the flow chamber. Moreover, the flow conditions within the flow cell allow studies of biofilm exposed to shear stress. A bubble trapping device confines air bubbles from the tubing which otherwise could disrupt the biofilm structure in the flow cell.
The flow cell system is compatible with Confocal Laser Scanning Microscopy (CLSM) and can thereby provide highly detailed 3D information about developing microbial biofilms. Cells in the biofilm can be labeled with fluorescent probes or proteins compatible with CLSM analysis. This enables online visualization and allows investigation of niches in the developing biofilm. Microbial interrelationship, investigation of antimicrobial agents or the expression of specific genes, are of the many experimental setups that can be investigated in the flow cell system.

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Protocol describing the application of a flow cell system for growing and analyzing microbial biofilms for Confocal Laser Scanning Microscopy (CLSM).

Pseudomonas aeruginosa e Saccharomyces cerevisiae Biofilme em Células de Fluxo

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological ...

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with leukemia, severe burn wounds, or organ transplants1. In patients at high-risk for developing PA bloodstream infections, the gastrointestinal (GI) tract is the main reservoir for colonization2, but the mechanisms by which PA transitions from an asymptomatic colonizing microbe to an invasive, and often deadly, pathogen are unclear. Previously, we performed in vivo transcription profiling experiments by recovering PA mRNA from bacterial cells residing in the cecums of colonized mice 3 in order to identify changes in bacterial gene expression during alterations to the host&#x2019;s immune status.
As with any transcription profiling experiment, the rate-limiting step is in the isolation of sufficient amounts of high quality mRNA. Given the abundance of enzymes, debris, food residues, and particulate matter in the GI tract, the challenge of RNA isolation is daunting. Here, we present a method for reliable and reproducible isolation of bacterial RNA recovered from the murine GI tract. This method utilizes a well-established murine model of PA GI colonization and neutropenia-induced dissemination4. Once GI colonization with PA is confirmed, mice are euthanized and cecal contents are recovered and flash frozen. RNA is then extracted using a combination of mechanical disruption, boiling, phenol/chloroform extractions, DNase treatment, and affinity chromatography. Quantity and purity are confirmed by spectrophotometry (Nanodrop Technologies) and bioanalyzer (Agilent Technologies) (Fig 1). This method of GI microbial RNA isolation can easily be adapted to other bacteria and fungi as well.

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

A reliable method for the RNA isolation of Pseudomonas aeruginosa recovered from murine cecums is described. The RNA recovered is of sufficient quantity and quality for subsequent qPCR, transcription profiling, and RNA Seq experiments. This technique can be adapted for RNA isolation of other intestinal microbes.

Isolamento de RNA Pseudomonas aeruginosa Colonizar o trato gastrointestinal Murino

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with ...

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

There is growing concern about the relevance of in vitro antimicrobial susceptibility tests when applied to isolates of P. aeruginosa from cystic fibrosis (CF) patients. Existing methods rely on single or a few isolates grown aerobically and planktonically. Predetermined cut-offs are used to define whether the bacteria are sensitive or resistant to any given antibiotic1. However, during chronic lung infections in CF, P. aeruginosa populations exist in biofilms and there is evidence that the environment is largely microaerophilic2. The stark difference in conditions between bacteria in the lung and those during diagnostic testing has called into question the reliability and even relevance of these tests3.
 Artificial sputum medium (ASM) is a culture medium containing the components of CF patient sputum, including amino acids, mucin and free DNA. P. aeruginosa growth in ASM mimics growth during CF infections, with the formation of self-aggregating biofilm structures and population divergence4,5,6. The aim of this study was to develop a microtitre-plate assay to study antimicrobial susceptibility of P. aeruginosa based on growth in ASM, which is applicable to both microaerophilic and aerobic conditions.
 An ASM assay was developed in a microtitre plate format. P. aeruginosa biofilms were allowed to develop for 3 days prior to incubation with antimicrobial agents at different concentrations for 24 hours. After biofilm disruption, cell viability was measured by staining with resazurin. This assay was used to ascertain the sessile cell minimum inhibitory concentration (SMIC) of tobramycin for 15 different P. aeruginosa isolates under aerobic and microaerophilic conditions and SMIC values were compared to those obtained with standard broth growth. Whilst there was some evidence for increased MIC values for isolates grown in ASM when compared to their planktonic counterparts, the biggest differences were found with bacteria tested in microaerophilic conditions, which showed a much increased resistance up to a &gt;128 fold, towards tobramycin in the ASM system when compared to assays carried out in aerobic conditions.
 The lack of association between current susceptibility testing methods and clinical outcome has questioned the validity of current methods3. Several in vitro models have been used previously to study P. aeruginosa biofilms7, 8. However, these methods rely on surface attached biofilms, whereas the ASM biofilms resemble those observed in the CF lung9 . In addition, reduced oxygen concentration in the mucus has been shown to alter the behavior of P. aeruginosa2 and affect antibiotic susceptibility10. Therefore using ASM under microaerophilic conditions may provide a more realistic environment in which to study antimicrobial susceptibility.

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

Current diagnostic antimicrobial susceptibility testing relies on the planktonic growth of isolates in nutrient rich, aerobic conditions. Here, we employ an alternative artificial sputum medium to study antimicrobial susceptibility of Pseudomonas aeruginosa biofilms under both aerobic and microaerophilic conditions more representative of the cystic fibrosis lung.

Uso de meio de escarro Artificial para testar a eficácia antibiótica contra<em&gt; Pseudomonas aeruginosa</em&gt; Em condições mais relevantes para o Pulmão Fibrose Cística

There  is growing concern about the relevance of in vitro antimicrobial  susceptibility tests when applied to isolates of P. aeruginosa from  cystic ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

Crônica de Longo Prazo<em&gt; Pseudomonas aeruginosa</em&gt; Infecção das vias aéreas em ratos

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

Pseudomonas aeruginosa Induced Lung Injury Model

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. Here we have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa (P. aeruginosa or PA). Using this model, we were able to show lung inflammation at the early phase of injury. In addition, alveolar epithelial barrier leakiness was observed by analyzing bronchoalveolar lavage (BAL); and alveolar cell death was observed by Tunel assay using tissue prepared from injured lungs. At a later phase following injury, we observed cell proliferation required for the repair process. The injury was resolved 7 days from the initiation of P. aeruginosa injection. This model mimics the sequential course of lung inflammation, injury and repair during pneumonia. This clinically relevant animal model is suitable for studying pathology, mechanism of repair, following acute lung injury, and also can be used to test potential therapeutic agents for this disease.

Pseudomonas aeruginosa Induced Lung Injury Model

We have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa. This model mimics lung injury during pneumonia and is clinically relevant.

Pseudomonas aeruginosa Lesão Pulmonar Induzida Modelo

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. ...

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. typhimurium bacteria are quickly detected and phagocytized by macrophages, and contained in vesicles known as phagosomes in order to be degraded. Isolation of S. typhimurium-containing phagosomes have been widely used to study how S. typhimurium infection alters the process of phagosome maturation to prevent bacterial degradation. Classically, the isolation of bacteria-containing phagosomes has been performed by sucrose gradient centrifugation. However, this process is time-consuming, and requires specialized equipment and a certain degree of dexterity. Described here is a simple and quick method for the isolation of S. typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin-streptavidin-conjugated magnetic beads. Phagosomes obtained by this method can be suspended in any buffer of choice, allowing the utilization of isolated phagosomes for a broad range of assays, such as protein, metabolite, and lipid analysis. In summary, this method for the isolation of S. typhimurium-containing phagosomes is specific, efficient, rapid, requires minimum equipment, and is more versatile than the classical method of isolation by sucrose gradient-ultracentrifugation.

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

We describe here a simple and quick method for the isolation of Salmonella typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin and streptavidin.

Isolamento de Salmonella typhimurium-contendo Phagosomes de macrófagos

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Replicação do requisitado, biblioteca não redundante de estirpe Pseudomonas aeruginosa PA14 Transposon mutantes de inserção

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary tissue during pneumonia results in the production of long-lived cytotoxins that can lead to subsequent end organ failure. We have developed in vitro assays to test the hypothesis that cytotoxins are produced during pulmonary infection. Isolated rat pulmonary endothelial cells and the bacterium Pseudomonas aeruginosa are used as model systems, and the production of cytoxins following infection of the endothelial cells by the bacteria is demonstrated using cell culture followed by direct quantitation using lactate dehydrogenase assays and a novel microscopic method utilizing ImageJ technology. The amyloid nature of these cytotoxins was demonstrated by thioflavin T binding assays and by immunoblotting and immunodepletion using A11 anti-amyloid antibody. Further analyses using immunoblotting demonstrated that oligomeric tau and A&#946; were produced and released by endothelial cells following infection by P. aeruginosa. These methods should be readily adaptable to analyses of human clinical samples.

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Simple methods are described for demonstrating the production of cytotoxic amyloids following infection of pulmonary endothelium by Pseudomonas aeruginosa.

Métodos para detecção de citotóxicos amiloides seguir infecção de pulmonar células endoteliais por Pseudomonas aeruginosa

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary ...

Identificação de novos genes associados com alginato de Produção em

Resumo

Explore mais vídeos

Capítulos neste vídeo