Diese Arbeit wurde von der National Aeronautics and Space Administration West Virginia Raum Zuschuss Consortium (NASA WVSGC), Cystic Fibrosis Foundation (CFF-YU11G0) und NIH P20RR016477 und P20GM103434 an die West Virginia IDeA Netzwerk für Biomedical Research Excellence unterstützt. Wir danken Vonya M. Eisinger für die technische Unterstützung bei dieser Arbeit.

1. Vorbereitung der Bakterienstämme und biparental Konjugation <ol><li> Impfen E. coli SM10/λpir/pFAC in 5 ml Luria Broth (LB) mit 15 ug / ml Gentamicin und in einem Schüttelinkubator über Nacht bei 37 ° C ergänzt </li><li> Impfen P. aeruginosa Stamm PAO1 in 5 ml LB, und in einem Schüttelinkubator über Nacht bei 42 ° C </li><li> Messen OD 600 von Nacht-Kulturen und mischen gleiche Mengen von PAO1 und E. coli PFAC so daß das Endvolumen zwischen 1-1,4 ml. </li><li> Zentrifuge Mischung bei 6.000 × g für 5 min. </li><li> Inzwischen trocknen LB-Platten für die Konjugation: Lassen Platten in Inkubator offen bei 37 ° C für 10-15 min. </li><li> Entfernen Sie alle 50 ul Überstand von Zellgemisch. </li><li> Zellpellet in den verbleibenden 50 ul Überstand und Pipette auf eine trockene LB-Platte in einem kompakten Tröpfchen. </li><li> Die Platte vorsichtig in einem Abzug zu (IMPO trocknenRTANT Hinweis: Lassen Sie sich nicht Zellen über die Platte verteilt, wird dies deutlich die Effizienz der Konjugation verringern). </li><li> Sobald der Tropfen trocken ist, kehren die LB-Platte und bei 37 ° C für 4-6 Stunden. </li><li> Während die Zellgemisch inkubiert, bereiten große (150 mm x 15 mm) PIA-Platten mit 300 ug / ml Gentamycin. Vor der Verwendung die Restfeuchte zu entfernen, indem sie in einem Inkubator bei 37 ° C für 15-20 min. </li><li> Nach der Inkubation der Zellmischung vollständig ist, sammelt die Zellen mit einer sterilen Impföse und in ein Mikrozentrifugenröhrchen mit 1 ml LB-und Wirbel oder Pipette, um gründlich zu mischen. </li><li> Verbreiten Sie die Zellen gleichmäßig auf die großen Platten enthalten PIA 300 ug / ml Gentamicin. (WICHTIG: Bei diesem Schritt ist es am besten, steigenden Volumina der Zellgemisch in den Platten zu trennen (zB Plate 1: 10 ul, Platte 2: 50 ul, Teller 3: 100 ul, Teller 4: 500 ul, etc.) . </li><li> Inkubieren über Nacht bei 37° C. </li></ol> 2. Erkennung und Isolierung von Kolonien Schleimige <ol><li> Platten entfernen und untersuchen Inkubator für schleimige Kolonien. </li><li> Isolieren einer schleimigen Kolonie und Streifen für die Isolierung auf kleinen Tellern (100 mm x 10 mm) mit PIA und 300 ug / ml Gentamycin. </li><li> Inkubieren über Nacht bei 37 ° C. </li><li> Wiederholen Sie Schritt 2.2 auf der vorherigen Nacht-Kultur. </li><li> Wiederholen Sie die Schritte 2.2-2.4 zwei weitere Male um die Stabilität des schleimigen Isolats zu bestimmen. </li><li> Nach dem letzten Schritt Isolat, impfen 4,5 ml LB mit einer einzigen schleimige Kolonie und Inkubation über Nacht im Schüttler bei 37 ° C </li><li> Am nächsten Tag, Label 3 Mikrozentrifugenröhrchen für jede schleimige Mutante. </li><li> Bereiten Sie zwei 1,25 ml Aliquots von Übernachtkultur in 2 Röhren für genomische DNA-Extraktion und Identifizierung der Transposon-Insertion-Website (siehe Protokoll Nr. 3). </li><li> Darüber hinaus archiviert jede schleimige Mutante durch Pipettieren von 1 ml Übernachtkultur in ein ANGEMESSENEly-markierten Kryoröhrchen, das ein gleiches Volumen von 10% Magermilch. Lagerung bei -86 ° C. </li></ol> 3. gDNA Restriktionsverdau und Ligation <ol><li> Extrahieren aus der gDNA schleimige Mutante mit einer beliebigen Methode (zB. Phenol-Chloroform-Spin-Säule, etc.). </li><li> Bestimmung der Konzentration der gDNA, Digest insgesamt 2 ug mit 1 &amp;mgr; l der Restriktionsendonuklease SalI, 0,5 &amp;mgr; l Rinderserumalbumin, 5 ul Enzym SalI-Puffer (100 mM NaCl, 50 mM Tris-HCl, 10 mM MgCl 2 , 1 mM Dithiothreitol (DTT), pH 7,9 bei Raumtemperatur), und das entsprechende Volumen von dH 2 O auf ein Gesamtvolumen von 50 &amp;mgr; l zu erreichen. </li><li> Digest-DNA über Nacht bei 37 ° C (HINWEIS:. Abhängig von der Effizienz des Restriktionsenzyms kann es notwendig sein, eine zusätzliche 1 &amp;mgr; l der über Nacht zu verdauen und inkubieren bei 37 ° C für 1-2 h Dies ist zusätzlich zu dem Verdau über Nacht.) </li><li> Reinige den digeSTED-DNA unter Verwendung einer beliebigen Methode (z. B. Agarosegel-Reinigung, Spin-Säulen) und Eluieren mit 25 ul Puffer. </li><li> Ligation der verdauten DNA durch Mischen von 11 ul der gereinigten DNA mit einer bevorzugten Konzentration von ~ 10-20 ng / ul, 1,5 ul Ligationspuffer (330 mM Tris-Acetat pH 7,5, 660 mM Kaliumacetat, 100 mM Magnesiumacetat, 5 mM DTT), 1,5 ul 100 mM ATP und 1 ul DNA-Ligase. </li><li> Inkubieren der Mischung für 15 min bei Raumtemperatur und dann inaktiviert das Enzym durch Inkubieren für 15 min bei 70 ° C. (Anmerkung: Die Inkubation der Mischung bei Raumtemperatur für längere kann den Erfolg der Ligation zu erhöhen). </li></ol> 4. Inverse PCR (iPCR) und Sequenzanalyse <ol><li> Führen iPCR auf Ligationsprodukt mit dem folgenden Vor-und Rückwärts-Primer und Thermocycling Bedingungen: -Forward Primer (Gm3OUT): GGGCATACGGGAAGAAGTGA -Reverse Primer (Gm5OUT) GACTGCCCTGCTGCGTAACA Thermocycler Condigen: 1. 94 ° C für 1 min. 2. 94 ° C für 1 min. 3. 58 ° C für 2 min. 4. 72 ° C für 2 min. 5. 72 ° C für 8 min. 6. 10 ° C halten. Wiederholen Sie die Schritte 2-4 für 34 Zyklen. (HINWEIS: Amplified iPCR Produkte können bei 4 ° C aufbewahrt werden) </li><li> Führen Agarose-Gelelektrophorese zur erfolgreichen iPCR Verstärkung bestätigen. </li><li> Führen Sie auf der Sequenzierung iPCR Produkt unter Verwendung der Gm3OUT Gm5OUT und Grundierungen. Die Insertionsstelle und die Orientierung himar1 werden zeichnet. </li></ol>

<ol>
	<li>Govan, J. R., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+pathogenesis+in+cystic+fibrosis:+mucoid+Pseudomonas+aeruginosa+and+Burkholderia+cepacia.">Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia.</a> Microbiol. Rev. 60, 539-574 (1996).</li><li>Chitnis, C. E., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+analysis+of+the+alginate+biosynthetic+gene+cluster+of+Pseudomonas+aeruginosa+shows+evidence+of+an+operonic+structure.">Genetic analysis of the alginate biosynthetic gene cluster of Pseudomonas aeruginosa shows evidence of an operonic structure.</a> Mol. Microbiol. 8, 583-593 (1993).</li><li>Franklin, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+AlgG+is+a+polymer+level+alginate+C5-mannuronan+epimerase.">Pseudomonas aeruginosa AlgG is a polymer level alginate C5-mannuronan epimerase.</a> J. Bacteriol. 176, 1821-1830 (1994).</li><li>Franklin, M. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutant+analysis+and+cellular+localization+of+the+AlgI,+AlgJ,+and+AlgF+proteins+required+for+O+acetylation+of+alginate+in+Pseudomonas+aeruginosa.">Mutant analysis and cellular localization of the AlgI, AlgJ, and AlgF proteins required for O acetylation of alginate in Pseudomonas aeruginosa.</a> J. Bacteriol. 184, 3000-3007 (2002).</li><li>Deretic, V., Gill, J. F., Chakrabarty, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+algD+coding+for+GDPmannose+dehydrogenase+is+transcriptionally+activated+in+mucoid+Pseudomonas+aeruginosa.">Gene algD coding for GDPmannose dehydrogenase is transcriptionally activated in mucoid Pseudomonas aeruginosa.</a> J. Bacteriol. 169, 351-358 (1987).</li><li>Mathee, K., McPherson, C. J., Ohman, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+the+algT+(algU)-encoded+sigma22+for+expression+of+the+alginate+regulon+in+Pseudomonas+aeruginosa+and+localization+of+its+antagonist+proteins+MucA+and+MucB+(AlgN)..">Posttranslational control of the algT (algU)-encoded sigma22 for expression of the alginate regulon in Pseudomonas aeruginosa and localization of its antagonist proteins MucA and MucB (AlgN)..</a> J. Bacteriol. 179, 3711-3720 (1997).</li><li>Boucher, J. C., Schurr, M. J., Yu, H., Rowen, D. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pseudomonas+aeruginosa+in+cystic+fibrosis:+role+of+mucC+in+the+regulation+of+alginate+production+and+stress+sensitivity.">Pseudomonas aeruginosa in cystic fibrosis: role of mucC in the regulation of alginate production and stress sensitivity.</a> Microbiology. 143, 3473-3480 (1997).</li><li>Martin, D. W., Holloway, B. W., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+locus+determining+the+mucoid+status+of+Pseudomonas+aeruginosa:+AlgU+shows+sequence+similarities+with+a+Bacillus+sigma+factor.">Characterization of a locus determining the mucoid status of Pseudomonas aeruginosa: AlgU shows sequence similarities with a Bacillus sigma factor.</a> J. Bacteriol. 175, 1153-1164 (1993).</li><li>Damron, F. H., Goldberg, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Proteolytic+regulation+of+alginate+overproduction+in+Pseudomonas+aeruginosa.">Proteolytic regulation of alginate overproduction in Pseudomonas aeruginosa.</a> Mol. Microbiol. 84 (4), 595-607 (2012).</li><li>Browne, P., Barret, M., O'Gara, F., Morrissey, J. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Computational+prediction+of+the+Crc+regulon+identifies+genus-wide+and+species-specific+targets+of+catabolite+repression+control+in+Pseudomonas+bacteria.">Computational prediction of the Crc regulon identifies genus-wide and species-specific targets of catabolite repression control in Pseudomonas bacteria.</a> BMC Microbiol. 10, 300 (2010).</li><li>Damron, F. H., Qiu, D., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Pseudomonas+aeruginosa+sensor+kinase+KinB+negatively+controls+alginate+production+through+AlgW-dependent+MucA+proteolysis.">The Pseudomonas aeruginosa sensor kinase KinB negatively controls alginate production through AlgW-dependent MucA proteolysis.</a> J. Bacteriol. 191, 2285-2295 (2009).</li><li>Damron, F. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+Pseudomonas+aeruginosa+regulon+controlled+by+the+sensor+kinase+KinB+and+sigma+factor+RpoN.">Analysis of the Pseudomonas aeruginosa regulon controlled by the sensor kinase KinB and sigma factor RpoN.</a> J. Bacteriol. 194, 1317-1330 (2012).</li><li>Qiu, D., Eisinger, V. M., Rowen, D. W., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulated+proteolysis+controls+mucoid+conversion+in+Pseudomonas+aeruginosa.">Regulated proteolysis controls mucoid conversion in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 104, 8107-8112 (2007).</li><li>Schurr, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Which+bacterial+biofilm+exopolysaccharide+is+preferred,+Psl+or+alginate.">Which bacterial biofilm exopolysaccharide is preferred, Psl or alginate.</a> J. Bacteriol. 195, 1623-1626 (2013).</li><li>Wong, S. M., Mekalanos, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+footprinting+with+mariner-based+transposition+in+Pseudomonas+aeruginosa.">Genetic footprinting with mariner-based transposition in Pseudomonas aeruginosa.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 10191-10196 (2000).</li><li>Lampe, D. J., Akerley, B. J., Rubin, E. J., Mekalanos, J. J., Robertson, H. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hyperactive+transposase+mutants+of+the+Himar1+mariner+transposon.">Hyperactive transposase mutants of the Himar1 mariner transposon.</a> Proc. Natl. Acad. Sci. U.S.A. 96, 11428-11433 (1999).</li></ol>

Der Autor Yu Hongwei D. ist der Chief Science Officer und Mitbegründer von Progenesis Technologies, LLC.

Es ist wichtig zu beachten, dass diese Methode auch in anderen Pseudomonas-Arten mit diesen Änderungen verwendet werden: P. inkubieren fluorescens und P. putida bei 30 ° C und P. stutzeri bei 42 ° C; P. stuzeri sollte auf LB-Platten mit 150 ug / ml Gentamycin ergänzt kultiviert werden; Schritt auf 1.11 P. stutzeri Zellen sollten in 500 ul LB statt 1 ml übertragen. Zusätzlich gibt es zwei kritische Schritte für dieses Protokoll. Erstens sollte der Empf...

Die Fähigkeit des opportunistischen, Gram-negative Erreger Pseudomonas aeruginosa zu Alginat überproduzieren ist ein wichtiger Faktor in der Fähigkeit, einen Biofilm zu schaffen. Die Überproduktion von Alginat ein Phänotyp oft als mucoidy bezeichnet. Die Isolierung der schleimigen Kolonien von der Sputum von Patienten mit zystischer Fibrose (CF) betroffen ist, der eine chronische Infektion, und ist direkt mit einem generellen Rückgang in der Gesundheits 1 des Patienten verbunden. Gegenwärtig ist zu verstehen, daß die Regelung und die Produktion von Alginat in P. aeruginosa tritt vor allem bei zwei Operonen. Die erste ist die Alginat-Biosynthese-Operon, die 12 Gene enthält (ALGD - alg8 - alg44 - algK - ALGE - algG - algX - algL - ALGI - algJ - algF - Alge), die für die Synthese und den Export des Alginatpolymer über verantwortlich sind das Periplasma der extrazellulären environment 5.2. Die zweite Operon ist ein Cluster von Genen, beginnend mit dem alternativen Sigmafaktor Algu / T und Weiterbildung mit Muça, mucB und mucD. Algu / T ist ein positiver Regulator, während mucAB-D werden als negative Regulatoren der Alginat-Produktion 8.6 eingestuft. Zusätzlich Transkriptionsregulatoren, wie ALGB, AlgQ, ALGR und RpoN sowie post-Transkriptions-und post-translationale Modifikation von Katabolitrepression Kontrolle, Kinase-Aktivität (Kinb) und Intramembranproteolyse haben auch gezeigt, dass in Alginat einbezogen werden Regulierung 14.09. Die Mini-himar1 Transposon-Vektor als PFAC bekannt wurde ursprünglich in Dr. Mekalanos &#39;Labor an der Harvard Medical School 15 erstellt. Die PFAC Plasmid besteht aus einem transponierbaren Element von zwei invertierten Wiederholungen von 27 bps und einem Gentamycin-Resistenzkassette in der Mitte (aacC1: 534 bp) flankiert, die ein Gen kodiert, hyperactive mariner Transposase 16, und ein Gen β-Lactamase (bla) (Abbildung 1). Sequenzinformationen für das Element des Transposons PFAC ist an der GenBank-Zugangsnummer zur Verfügung: DQ366300 13. In PFAC gibt es eine multiple Klonierungsstelle (MCS) hinter dem aacC1-Gen, das für die Identifizierung des chromosomalen Insertionsstelle mit inversen PCR verwendet. Ein großer Vorteil bei der Verwendung des Mini-himar1 Transposon keine spezifischen Wirtsfaktoren sind für die Umsetzung (Mutagenese) erforderlich. Darüber hinaus besteht eine hohe Häufigkeit der TA-Dinukleotid Insertionsstellen im gesamten Genom von P. gefunden aeruginosa. Zum Beispiel, TA-Dinukleotid Insertionsstellen auftritt 94.404 und 100.229 mal in der PAO1 (6.264.404 bps, GenBank-Zugangsnummer NC_002516.2) und PA14 (6.537.648 bps; GenBank Zugangsnummer NC_008463) Genome sind. Aufgrund der Fülle von TA-Dinukleotid im Genom, Mini himar1 </em&gt; Transposon kann die hohe Dichte und zufällige Mutagenese, die besonders geeignet für die Analyse der Virulenz-Gene und die Gene, die stark reguliert ist, verursachen. Theoretisch kann die Mini-himar1 Transposons in jeder nicht-essentiellen Gens im Genom von P. einfügen aeruginosa. Dies bietet etwa 18 TA Insertionsstellen pro offene Leserahmen in der PAO1 Genom. Hier ein Protokoll mit Mini-himar1 Transposon-vermittelte Mutagenese neue Regulatoren der mucoidy in P. identifizieren beschreiben wir aeruginosa. Genauer gesagt, wir biparentally konjugiert PFAC den Vektor, der ein Mini-Transposon aus E. himar1 coli SM10/λpir in die nonmucoid prototrophen Stamm PAO1. Nachdem das Transposon in das Genom integriert ist, ist die Empfängerstamm kultiviert auf Pseudomonas Isolation Agar (PIA), die Triclosan, die das Wachstum von E. hemmt coli. Somit wird eine Bibliothek von Mutanten <em&gt; P. aeruginosa durch das Wachstum auf PIA Platte mit Gentamycin und die Anwesenheit des schleimigen ergänzt Phänotyp ausgewählt werden. Beachten Sie, dass eine wahre Transposon-vermittelte gegen eine Integration Mutante eine Gentamicin resistent und Carbenicillin-sensitiven Phänotyp haben. In dieser Studie wurden rund 80.000 Insertionsmutanten von PAO1 durch vier separaten Konjugationen isoliert. Wir dann gesiebt für schleimige Isolate und bestimmt die Stelle der Insertion mittels Restriktionsenzym-Verdau, Ligation und inverse PCR. Wir führten Southern-Blot-Analyse unter Verwendung des Gentamycin-Resistenz-Kassette als eine Sonde, die Anzahl der Einführungs pro Genom zu sehen. Wir haben festgestellt, dass mehr als 90% der Mutanten pro Konjugation mit diesem Protokoll erhalten hatte nur eine einzige Kopie des himar1 im Genom und angezeigt die Gentamicin resistent und Carbenicillin-sensitiven Phänotyp. Insgesamt 32 schleimige Isolate wurden identifiziert, von denen 22 wurden zu verschiedenen Loci des P. zugeordnet aeruginosa PAO1Chromosom. Diese Rate der Einführung bietet eine ausreichende Abdeckung zu mehreren neuartigen Regulatoren der Alginat-Überproduktion zu identifizieren.

<table border="0" cellpadding="0" cellspacing="0" width="780">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="22">
			<td height="22" style="height:22px;width:267px;">Luria Broth</td>
			<td style="width:187px;">Difco</td>
			<td style="width:125px;">240230</td>
			<td style="width:203px;">via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Pseudomonas isolation agar</td>
			<td>Difco</td>
			<td>292710</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Small Plates (100 O.D. x 10 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-13</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Large Plates (150 O.D. x 15 mm)</td>
			<td>Fisher Scientific</td>
			<td>08-757-14</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Glycerol</td>
			<td>Fisher Scientific</td>
			<td>BP229-4</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Shaking Incubator</td>
			<td>New Brunswick Scientific</td>
			<td>Innova 4080</td>
			<td>shake at 200 rpm</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cabinet Incubator</td>
			<td>VWR</td>
			<td>1540</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Benchtop Microcentrifuge</td>
			<td>Sorvall</td>
			<td>75-003-287</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">SmartSpec Plus Spectrophotometer</td>
			<td>Bio-Rad</td>
			<td>170-2525</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Diposable Inoculation Loops</td>
			<td>Fisher Scientific</td>
			<td>22-363-597</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">1.5 mL Microcentrifuge Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-408-129</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">15 mL Tubes</td>
			<td>Fisher Scientific</td>
			<td>05-539-12</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Skim Milk</td>
			<td>Difco</td>
			<td>DF0032-17-3</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNeasy Blood and Tissue (250)&#160;</td>
			<td>Qiagen</td>
			<td>69506</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAquick PCR Purification Kit (250)</td>
			<td>Qiagen</td>
			<td>28106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">QIAprep Spin Miniprep Kit (250)&#160;</td>
			<td>Qiagen</td>
			<td>27106</td>
			<td>or preferred method/vendor</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FastLink II DNA Ligation Kit</td>
			<td>Epicentre Technologies</td>
			<td>LK6201H</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accu block Digital Dry Bath&#160;</td>
			<td>Labnet</td>
			<td>NC0205808</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Sal1, restriction endonuclease</td>
			<td>New England BioLabs</td>
			<td>R0138L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">EasyStart Micro 50</td>
			<td>Molecular BioProducts</td>
			<td>6020</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Taq DNA Polymerase</td>
			<td>New England BioLabs</td>
			<td>M0267L</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">iCycler, Thermocycler</td>
			<td>Bio-Rad</td>
			<td>170-8740</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">LE agarose</td>
			<td>Genemate</td>
			<td>3120-500</td>
			<td>via Fisher Scientific</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gentamycin Sulfate</td>
			<td>Fisher Scientific</td>
			<td>BP918-1</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">2.0 mL Cryogenic Vials</td>
			<td>Corning</td>
			<td>430659</td>
			<td>via Fisher Scientific</td>
		</tr>
	</tbody>
</table>

identification of novel genes associated with alginate production in pseudomonas aeruginosa using mini-himar1 mariner transposon-mediated mutagenesis

Pseudomonas aeruginosa ist ein Gram-negatives, Umwelt Bakterium mit vielfältigen Stoffwechselfunktionen. P. aeruginosa ist ein opportunistischer bakteriellen Krankheitserreger, der chronische Lungeninfektionen bei Patienten mit zystischer Fibrose (CF) herstellt. Die Überproduktion von Kapsel-Polysaccharid Alginat genannt, die auch als mucoidy bekannt, fördert die Bildung von schleimigen Biofilms, die resistenter als Planktonzellen antibiotische Chemotherapie und Wirtsabwehr sind. Außerdem ist die Umwandlung von der nonmucoid zu schleimige Phänotyp ein klinischer Marker für die Entstehung von chronischen Infektionen bei Mukoviszidose. Alginat Überproduktion von P. aeruginosa ist ein Prozess, der endergonische Zellenergie stark besteuert. Deshalb wird Alginat Produktion hoch in P. geregelt aeruginosa. Alginat Regulation besser verstehen, ein Protokoll unter Verwendung des Mini-himar1 Transposon-Mutagenese für die Identifizierung von neuen Alginat Regler beschreiben wirs in einer prototypischen Stamm PAO1. Das Verfahren besteht aus zwei Schritten. Zuerst vom Host E. übertragen wir die Mini-Transposon himar1 (PFAC) coli SM10/λpir in Empfänger P. aeruginosa PAO1 über biparental Konjugation an ein High-Density-Insertionsmutante-Bibliothek, die auf Pseudomonas Isolation Agar-Platten mit Gentamycin ergänzt ausgewählt wurden, erstellen. Zweitens, gesiebt und isoliert die schleimige Kolonien, um die Einstichstelle durch inverse PCR Karte mit DNA-Primer zeigt vom Gentamycinkassette und DNA-Sequenzierung nach außen wir. Über dieses Protokoll haben wir zwei neue Alginat-Regulatoren, mucE (PA4033) und Kinb (PA5484), in Stamm PAO1 mit einem Wildtyp-Muça Codieren der Anti-Sigma-Faktor Muça für die Master-Alginat Regler Algu (ALGT, σ 22) identifiziert . Dieses High-Throughput-Mutagenese-Protokoll kann für die Identifizierung von anderen Virulenz-Genen verursacht Änderung Colo modifiziert werdenny Morphologie.

Wie in Fig. 1 dargestellt, der Mini-Transposon-Vektor himar1 mariner, PFAC enthält zwei 27 bp invertierten Wiederholungen mit TA Insertion flankieren das aacC1 Gentamycin-Resistenz-Kassette, mit σ 70-abhängigen Promotor und eine multiple Klonierungsstelle (MCS). Zusätzlich enthält der Vektor Gene PFAC die hochaktiven himar1 Transposase, β-Lactamase (bla) und das Übertragungs tra-Operon codiert. Die TA Einführungsstellen ermöglichen eine ef...

Watch this Scientific Journal Video about Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis at JoVE.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Hier beschreiben wir ein Protokoll, mit dem Mini-himar1 mariner Transposon-vermittelte Mutagenese zur Erzeugung einer hohen Dichte Insertionsmutante Bibliothek-Bildschirm, zu isolieren und zu identifizieren Roman Alginat-Regulatoren in der prototypischen Pseudomonas aeruginosa Stamm PAO1.

Identifizierung neuer Gene, die mit Alginat-Produktion verbunden in<em&gt; Pseudomonas aeruginosa</em&gt; Mit Mini-<em&gt; Himar1</em&gt; Mariner Transposon-vermittelte Mutagenese

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

identification-novel-genes-associated-with-alginate-production

Research

JoVE Journal

Immunology and Infection

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

12.2K Aufrufe.  Marshall University.  Hier beschreiben wir ein Protokoll, mit dem Mini-himar1 mariner Transposon-vermittelte Mutagenese zur Erzeugung einer hohen Dichte Insertionsmutante Bibliothek-Bildschirm, zu isolieren und zu identifizieren Roman Alginat-Regulatoren in der prototypischen Pseudomonas aeruginosa Stamm PAO1. 

Serie: Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living surfaces. In this paper, we describe protocols for forming Pseudomonas aeruginosa biofilms on human airway epithelial cells (CFBE cells) grown in culture. In the first method (termed the Static Co-culture Biofilm Model), P. aeruginosa is incubated with CFBE cells grown as confluent monolayers on standard tissue culture plates. Although the bacterium is quite toxic to epithelial cells, the addition of arginine delays the destruction of the monolayer long enough for biofilms to form on the CFBE cells. The second method (termed the Flow Cell Co-culture Biofilm Model), involves adaptation of a biofilm flow cell apparatus, which is often used in biofilm research, to accommodate a glass coverslip supporting a confluent monolayer of CFBE cells. This monolayer is inoculated with P. aeruginosa and a peristaltic pump then flows fresh medium across the cells. In both systems, bacterial biofilms form within 6-8 hours after inoculation. Visualization of the biofilm is enhanced by the use of P. aeruginosa strains constitutively expressing green fluorescent protein (GFP). The Static and Flow Cell Co-culture Biofilm assays are model systems for early P. aeruginosa infection of the Cystic Fibrosis (CF) lung, and these techniques allow different aspects of P. aeruginosa biofilm formation and virulence to be studied, including biofilm cytotoxicity, measurement of biofilm CFU, and staining and visualizing the biofilm.

Co-culture Models of Pseudomonas aeruginosa Biofilms Grown on Live Human Airway Cells

This paper describes different methods of growing Pseudomonas aeruginosa biofilms on cultured human airway epithelial cells. These protocols can be adapted to study different aspects of biofilm formation, including visualization of the biofilm, staining of the biofilm, measuring the colony forming units (CFU) of the biofilm, and studying biofilm cytotoxicity.

Co-Kultur Modelle Pseudomonas aeruginosa Biofilme auf lebenden menschlichen Zellen gezüchtet Airway

Bacterial biofilms have been associated with a number of different human diseases, but biofilm development has generally been studied on non-living ...

Forschung

Immunologie und Infektion

Transfection and Mutagenesis of Target Genes in Mosquito Cells by Locked Nucleic Acid-modified Oligonucleotides

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new infections each year. Despite decades of research, there is still no vaccine against malaria, highlighting the need for novel control strategies. One innovative approach is the use of genetically modified mosquitoes to effectively control malaria parasite transmission. Deliberate alterations of cell signaling pathways in the mosquito, via targeted mutagenesis, have been found to regulate parasite development 1. From these studies, we can begin to identify potential gene targets for transformation. Targeted mutagenesis has traditionally relied upon the homologous recombination between a target gene and a large DNA molecule. However, the construction and use of such complex DNA molecules for generation of stably transformed cell lines is costly, time consuming and often inefficient. Therefore, a strategy using locked nucleic acid-modified oligonucleotides (LNA-ONs) provides a useful alternative for introducing artificial single nucleotide substitutions into episomal and chromosomal DNA gene targets (reviewed in 2). LNA-ON-mediated targeted mutagenesis has been used to introduce point mutations into genes of interest in cultured cells of both yeast and mice 3,4. We show here that LNA-ONs can be used to introduce a single nucleotide change in a transfected episomal target that results in a switch from blue fluorescent protein (BFP) expression to green fluorescent protein (GFP) expression in both Anopheles gambiae and Anopheles stephensi cells. This conversion demonstrates for the first time that effective mutagenesis of target genes in mosquito cells can be mediated by LNA-ONs and suggests that this technique may be applicable to mutagenesis of chromosomal targets in vitro and in vivo.

Oligonucleotides can be used to site specifically substitute a single nucleotide of transfected target genes in both Anopheles gambiae and Anopheles stephensi cells.

Transfektion und Mutagenese von Zielgenen in Mosquito-Zellen durch Locked Nucleic Acid-modifizierte Oligonukleotide

Plasmodium parasites, the causative agent of malaria, are transmitted through the bites of infected Anopheles mosquitoes resulting in over 250 million new ...

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological properties compared to free living microorganisms. Biofilms in nature are often difficult to investigate and reside under poorly defined conditions1. Using a transparent substratum it is possible to device a system where simple biofilms can be examined in a non-destructive way in real-time: here we demonstrate the assembly and operation of a flow cell model system, for in vitro 3D studies of microbial biofilms generating high reproducibility under well-defined conditions2,3.
The system consists of a flow cell that serves as growth chamber for the biofilm. The flow cell is supplied with nutrients and oxygen from a medium flask via a peristaltic pump and spent medium is collected in a waste container. This construction of the flow system allows a continuous supply of nutrients and administration of e.g. antibiotics with minimal disturbance of the cells grown in the flow chamber. Moreover, the flow conditions within the flow cell allow studies of biofilm exposed to shear stress. A bubble trapping device confines air bubbles from the tubing which otherwise could disrupt the biofilm structure in the flow cell.
The flow cell system is compatible with Confocal Laser Scanning Microscopy (CLSM) and can thereby provide highly detailed 3D information about developing microbial biofilms. Cells in the biofilm can be labeled with fluorescent probes or proteins compatible with CLSM analysis. This enables online visualization and allows investigation of niches in the developing biofilm. Microbial interrelationship, investigation of antimicrobial agents or the expression of specific genes, are of the many experimental setups that can be investigated in the flow cell system.

Pseudomonas aeruginosa and Saccharomyces cerevisiae Biofilm in Flow Cells

Protocol describing the application of a flow cell system for growing and analyzing microbial biofilms for Confocal Laser Scanning Microscopy (CLSM).

Pseudomonas aeruginosa und Saccharomyces cerevisiae Biofilm im Flow Cells

Many microbial cells have the ability to form sessile microbial communities defined as biofilms that have altered physiological and pathological ...

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with leukemia, severe burn wounds, or organ transplants1. In patients at high-risk for developing PA bloodstream infections, the gastrointestinal (GI) tract is the main reservoir for colonization2, but the mechanisms by which PA transitions from an asymptomatic colonizing microbe to an invasive, and often deadly, pathogen are unclear. Previously, we performed in vivo transcription profiling experiments by recovering PA mRNA from bacterial cells residing in the cecums of colonized mice 3 in order to identify changes in bacterial gene expression during alterations to the host&#x2019;s immune status.
As with any transcription profiling experiment, the rate-limiting step is in the isolation of sufficient amounts of high quality mRNA. Given the abundance of enzymes, debris, food residues, and particulate matter in the GI tract, the challenge of RNA isolation is daunting. Here, we present a method for reliable and reproducible isolation of bacterial RNA recovered from the murine GI tract. This method utilizes a well-established murine model of PA GI colonization and neutropenia-induced dissemination4. Once GI colonization with PA is confirmed, mice are euthanized and cecal contents are recovered and flash frozen. RNA is then extracted using a combination of mechanical disruption, boiling, phenol/chloroform extractions, DNase treatment, and affinity chromatography. Quantity and purity are confirmed by spectrophotometry (Nanodrop Technologies) and bioanalyzer (Agilent Technologies) (Fig 1). This method of GI microbial RNA isolation can easily be adapted to other bacteria and fungi as well.

RNA Isolation of Pseudomonas aeruginosa Colonizing the Murine Gastrointestinal Tract

A reliable method for the RNA isolation of Pseudomonas aeruginosa recovered from murine cecums is described. The RNA recovered is of sufficient quantity and quality for subsequent qPCR, transcription profiling, and RNA Seq experiments. This technique can be adapted for RNA isolation of other intestinal microbes.

RNA Isolierung von Pseudomonas aeruginosa Kolonisierung der Murine Gastrointestinaltrakt

Pseudomonas aeruginosa (PA) infections result in significant morbidity and mortality in hosts with compromised immune systems, such as patients with ...

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

There is growing concern about the relevance of in vitro antimicrobial susceptibility tests when applied to isolates of P. aeruginosa from cystic fibrosis (CF) patients. Existing methods rely on single or a few isolates grown aerobically and planktonically. Predetermined cut-offs are used to define whether the bacteria are sensitive or resistant to any given antibiotic1. However, during chronic lung infections in CF, P. aeruginosa populations exist in biofilms and there is evidence that the environment is largely microaerophilic2. The stark difference in conditions between bacteria in the lung and those during diagnostic testing has called into question the reliability and even relevance of these tests3.
 Artificial sputum medium (ASM) is a culture medium containing the components of CF patient sputum, including amino acids, mucin and free DNA. P. aeruginosa growth in ASM mimics growth during CF infections, with the formation of self-aggregating biofilm structures and population divergence4,5,6. The aim of this study was to develop a microtitre-plate assay to study antimicrobial susceptibility of P. aeruginosa based on growth in ASM, which is applicable to both microaerophilic and aerobic conditions.
 An ASM assay was developed in a microtitre plate format. P. aeruginosa biofilms were allowed to develop for 3 days prior to incubation with antimicrobial agents at different concentrations for 24 hours. After biofilm disruption, cell viability was measured by staining with resazurin. This assay was used to ascertain the sessile cell minimum inhibitory concentration (SMIC) of tobramycin for 15 different P. aeruginosa isolates under aerobic and microaerophilic conditions and SMIC values were compared to those obtained with standard broth growth. Whilst there was some evidence for increased MIC values for isolates grown in ASM when compared to their planktonic counterparts, the biggest differences were found with bacteria tested in microaerophilic conditions, which showed a much increased resistance up to a &gt;128 fold, towards tobramycin in the ASM system when compared to assays carried out in aerobic conditions.
 The lack of association between current susceptibility testing methods and clinical outcome has questioned the validity of current methods3. Several in vitro models have been used previously to study P. aeruginosa biofilms7, 8. However, these methods rely on surface attached biofilms, whereas the ASM biofilms resemble those observed in the CF lung9 . In addition, reduced oxygen concentration in the mucus has been shown to alter the behavior of P. aeruginosa2 and affect antibiotic susceptibility10. Therefore using ASM under microaerophilic conditions may provide a more realistic environment in which to study antimicrobial susceptibility.

Use of Artificial Sputum Medium to Test Antibiotic Efficacy Against Pseudomonas aeruginosa in Conditions More Relevant to the Cystic Fibrosis Lung

Current diagnostic antimicrobial susceptibility testing relies on the planktonic growth of isolates in nutrient rich, aerobic conditions. Here, we employ an alternative artificial sputum medium to study antimicrobial susceptibility of Pseudomonas aeruginosa biofilms under both aerobic and microaerophilic conditions more representative of the cystic fibrosis lung.

Einsatz von künstlichen Sputum Mittlere bis antibiotische Wirkung gegen die getestet<em&gt; Pseudomonas aeruginosa</em&gt; AGB in einen engeren Bezug zu den Mukoviszidose-Lunge

There  is growing concern about the relevance of in vitro antimicrobial  susceptibility tests when applied to isolates of P. aeruginosa from  cystic ...

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model itself. Early phases of inflammation and infection have been widely studied by using the Pseudomonas aeruginosa agar-beads mouse model, while only few reports have focused on the long-term chronic infection in vivo. The main challenge for long term chronic infection remains the low bacterial burden by P. aeruginosa and the low percentage of infected mice weeks after challenge, indicating that bacterial cells are progressively cleared by the host.
This paper presents a method for obtaining efficient long-term chronic infection in mice. This method is based on the embedding of the P. aeruginosa clinical strains in the agar-beads in vitro, followed by intratracheal instillation in C57Bl/6NCrl mice. Bilateral lung infection is associated with several measurable read-outs including weight loss, mortality, chronic infection, and inflammatory response. The P. aeruginosa RP73 clinical strain was preferred over the PAO1 reference laboratory strain since it resulted in a comparatively lower mortality, more severe lesions, and higher chronic infection. P. aeruginosa colonization may persist in the lung for over three months. Murine lung pathology resembles that of CF patients with advanced chronic pulmonary disease.
This murine model most closely mimics the course of the human disease and can be used both for studies on the pathogenesis and for the evaluation of novel therapies.

Long Term Chronic Pseudomonas aeruginosa Airway Infection in Mice

We describe the agar-beads method to establish persistent long-term chronic Pseudomonas aeruginosa airway infection in the mouse model.

Langzeitchronik<em&gt; Pseudomonas aeruginosa</em&gt; Airway-Infektion bei Mäusen

A mouse model of chronic airway infection is a key asset in cystic fibrosis (CF) research, although there are a number of concerns regarding the model ...

Pseudomonas aeruginosa Induced Lung Injury Model

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. Here we have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa (P. aeruginosa or PA). Using this model, we were able to show lung inflammation at the early phase of injury. In addition, alveolar epithelial barrier leakiness was observed by analyzing bronchoalveolar lavage (BAL); and alveolar cell death was observed by Tunel assay using tissue prepared from injured lungs. At a later phase following injury, we observed cell proliferation required for the repair process. The injury was resolved 7 days from the initiation of P. aeruginosa injection. This model mimics the sequential course of lung inflammation, injury and repair during pneumonia. This clinically relevant animal model is suitable for studying pathology, mechanism of repair, following acute lung injury, and also can be used to test potential therapeutic agents for this disease.

Pseudomonas aeruginosa Induced Lung Injury Model

We have developed a mouse lung injury model by intra-tracheal injection of bacteria Pseudomonas aeruginosa. This model mimics lung injury during pneumonia and is clinically relevant.

Pseudomonas aeruginosa induzierte Lungenschädigung-Modell

In order to study human acute lung injury and pneumonia, it is important to develop animal models to mimic various pathological features of this disease. ...

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. typhimurium bacteria are quickly detected and phagocytized by macrophages, and contained in vesicles known as phagosomes in order to be degraded. Isolation of S. typhimurium-containing phagosomes have been widely used to study how S. typhimurium infection alters the process of phagosome maturation to prevent bacterial degradation. Classically, the isolation of bacteria-containing phagosomes has been performed by sucrose gradient centrifugation. However, this process is time-consuming, and requires specialized equipment and a certain degree of dexterity. Described here is a simple and quick method for the isolation of S. typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin-streptavidin-conjugated magnetic beads. Phagosomes obtained by this method can be suspended in any buffer of choice, allowing the utilization of isolated phagosomes for a broad range of assays, such as protein, metabolite, and lipid analysis. In summary, this method for the isolation of S. typhimurium-containing phagosomes is specific, efficient, rapid, requires minimum equipment, and is more versatile than the classical method of isolation by sucrose gradient-ultracentrifugation.

Isolation of Salmonella typhimurium-containing Phagosomes from Macrophages

We describe here a simple and quick method for the isolation of Salmonella typhimurium-containing phagosomes from macrophages by coating the bacteria with biotin and streptavidin.

Isolierung von Salmonella Typhimurium-mit Phagosom von Makrophagen

Salmonella typhimurium is a facultative intracellular bacterium that causes gastroenteritis in humans. After invasion of the lamina propria, S. ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Replikation von bestellt, Nonredundant Bibliothek von Pseudomonas Aeruginosa Stamm PA14 Transposon Insertion Mutanten

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary tissue during pneumonia results in the production of long-lived cytotoxins that can lead to subsequent end organ failure. We have developed in vitro assays to test the hypothesis that cytotoxins are produced during pulmonary infection. Isolated rat pulmonary endothelial cells and the bacterium Pseudomonas aeruginosa are used as model systems, and the production of cytoxins following infection of the endothelial cells by the bacteria is demonstrated using cell culture followed by direct quantitation using lactate dehydrogenase assays and a novel microscopic method utilizing ImageJ technology. The amyloid nature of these cytotoxins was demonstrated by thioflavin T binding assays and by immunoblotting and immunodepletion using A11 anti-amyloid antibody. Further analyses using immunoblotting demonstrated that oligomeric tau and A&#946; were produced and released by endothelial cells following infection by P. aeruginosa. These methods should be readily adaptable to analyses of human clinical samples.

Methods for Detecting Cytotoxic Amyloids Following Infection of Pulmonary Endothelial Cells by Pseudomonas aeruginosa

Simple methods are described for demonstrating the production of cytotoxic amyloids following infection of pulmonary endothelium by Pseudomonas aeruginosa.

Methoden zur Erkennung von zytotoxischen amyloiden folgende Infektion der pulmonalen Endothelzellen durch Pseudomonas aeruginosa

Patients who survive pneumonia have elevated death rates in the months following hospital discharge. It has been hypothesized that infection of pulmonary ...

Identifizierung neuer Gene, die mit Alginat-Produktion verbunden in

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video