وأيد هذا العمل من المنح المقدمة CRUK 15043 وCRUK 14251. نشكر دانيال Wetterskog وكا كى هو للمساعدة التقنية وقراءة نقدية للمخطوطة.

1. التجريبية التشويش وصفها الخليوي لعلامات الاستجابة (عكس ترنسفكأيشن سيرنا الشاشة) <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> في غطاء نسيج الثقافة العقيمة ماصة 70 ميكرولتر من 200 نانومتر سيرنا في المخزن 1X سيرنا في الآبار لمعقمة، سهل 96 لوحة جيدا. تمييع ترنسفكأيشن الدهون في 40 مجلدا من وسائل الاعلام DMEM المصل خالية والاستغناء 105 ميكرولتر في كل منها يحتوي أيضا سيرنا. ملاحظة: تمييع 262.5 ميكرولتر من المادة الدهنية إلى 10.5 مل من المصل خالية DMEM ينتج مزيج الرئيسي مناسبة لكامل 96 لوحة جيدا من سيرنا، وتقديم 2.6 ميكرولتر من الدهون لكل بئر. واستخدام 200 نانومتر سيرنا تركيز ابتداء من الساعة هذه الخطوة تقديم تركيز العمل من 20 نانومتر في الخطوة 1.3، ولكن إجراءات العمل لتركيزات العمل وصولا الى 5 نانومتر، مع تركيز بدءا تبعا لذلك (أي 50 نانومتر). انخفاض تركيز العمل قد يقلل من خارج الهدف عشرات إيجابية كاذبة، على الرغم من أنها يمكن أن تقلل من حجم رد على الهدف، مما يؤدي إلى زيادة من على targeر معدلات سلبية كاذبة. </li><li style=";text-align:right;direction:rtl"> مزيج من لوحة عن طريق الاهتزاز لطيف لمدة عشر دقائق في درجة حرارة الغرفة. تقسيم الفرعي مما أدى 175 ميكرولتر إلى ثلاثة 50 ميكرولتر يعيد لكل هدف على ومبهمة، وزراعة الأنسجة المعالجة، لوحة 96-جيدا مع قاعدة شفافة. </li><li style=";text-align:right;direction:rtl"> بالنقل العكسي التي كتبها الاستغناء 8،000 خلايا لكل بئر في 150 ميكرولتر DMEM تحتوي على 10٪ مصل مباشرة على مجمعات للدهن سيرنا 50 ميكرولتر. استخدام HCT116 خلايا القولون والمستقيم الإنسان يعبرون عن مستقر علامة GFP الموسومة الإبلاغ عن النشاط CDK2 5،8. لا مزيد من الخلط هو ضروري. ختم لوحة مع لاصقة غشاء تنفس معقم للسيطرة على الرطوبة ومنع لوحة &quot;حافة الآثار&quot; ووضع لوحة في حاضنة ترطيب عند 37 درجة مئوية، و 5٪ CO 2 لمدة 48 ساعة. </li><li style=";text-align:right;direction:rtl"> نضح في وسائل الإعلام بحيث كمية صغيرة متبقية من وسائل الإعلام لا يزال في الآبار. إصلاح الخلايا عن طريق إضافة 100 ميكرولتر من 4٪ الفورمالديهايد مخزنة إلى كل بئر واحتضان في غطاء الدخان لمدة 10 دقيقة في غرفة رemperature. </li><li style=";text-align:right;direction:rtl"> إزالة الحل تحديد بواسطة الشفط لوحة. عند هذه النقطة إما إيقاف التجربة عن طريق غسل لوحة ثلاث مرات مع 100 ميكرولتر الفوسفات مخزنة المالحة (PBS) ومن ثم تخزين مختومة، وأقل من 100 ميكرولتر من برنامج تلفزيوني في الظلام في 4 درجة مئوية لمدة تصل إلى أسبوع، أو المضي قدما في permeabilization من الخلايا. ملاحظة: نوصي لوحات المعالجة في أقرب وقت ممكن بعد التثبيت، وبشكل عام نفضل تخزين لوحات المجهزة بالكامل. يمكن إضافة المواد الحافظة مبيد الأحياء مثل ثيميروسال، أزيد الصوديوم، أو البدائل التجارية لمنع نمو micoroganismal. إضافة مثبطات إنزيم الفوسفاتيز يساعد على الحفاظ على الفوسفات-الحواتم، وغيرها من الوسائل للحفاظ على الدول تعديل البروتين قد تكون مفيدة في سياقات فحص ذات الصلة </li><li style=";text-align:right;direction:rtl"> إزالة PBS من لوحة وpermeabilize الخلايا بإضافة 100 ميكرولتر من حل permeabilization. احتضان لمدة 10 دقيقة في درجة حرارة الغرفة دون أن تهتز. نضح حل permeabilization باستخدام multichannel ماصة. كرر هذه الخطوة ثلاث مرات. </li><li style=";text-align:right;direction:rtl"> منع الخلايا من خلال إضافة 100 ميكرولتر حل كتلة لكل بئر لمدة 30 دقيقة في درجة حرارة الغرفة. إزالة حل كتلة بواسطة الشفط لوحة، ثم التحقيق مع 50 ميكرولتر من مكافحة P-S780 RB1 الأجسام المضادة المخففة 500 أضعاف في حل كتلة لمدة 2 ساعة في الظلام في درجة حرارة الغرفة. </li><li style=";text-align:right;direction:rtl"> غسل لوحة ثلاث مرات مع 100 ميكرولتر حل لوحة غسل، وترك الحل على طبق من ذهب لمدة 5 دقائق في كل مرة. بحث لوحة بين عشية وضحاها في الظلام في 4 درجة مئوية مع 50 ميكرولتر fluorescently الموسومة الأجسام المضادة الثانوية المخفف 1،000 أضعاف في حل كتلة تستكمل مع 2 ميكرومتر من لونين محددة DNA صبغ Bisbenzimide. غسل لوحة ثلاث مرات كما كان من قبل، ومتجر مختومة، وأقل من 100 ميكرولتر PBS في الظلام في 4 درجات مئوية. صورة لوحة في غضون أسبوعين. </li></ol> 2. التصوير وتقطيع الصورة <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> استخدام المجهر مبائر أو الغزل القرص مضان مع الهدف 20X لاتخاذ منفصلة 16بت والصور TIFF اللون الرمادي في ثلاث قنوات المقابلة لصبغ DNA، GFP وfluorophores المناعية تلطيخ. القبض على العديد من مجموعات صورة غير متداخلة، المشار إليها هنا كما الإطارات، لصورة ما يقرب من 1،000-2،000 خلايا لكل بئر. </li><li style=";text-align:right;direction:rtl"> تسمية ملفات الصور بشكل منتظم بحيث يكون كل اسم الملف هو مزيج فريد من &#39;اسم التجربة&#39;، &#39;عنوان جيدا&#39;، &#39;رقم الإطار &quot;و&quot; معرف القناة، في هذا النظام (الشكل 3). مجموعة البيانات المثال يستخدم &quot;الأزرق&quot; (الكروماتين تلطيخ DNA) أو &quot;الخضراء&quot; (GFP) أو &quot;الأحمر&quot; (وfluorophore الملطخة المناعية)، ومعرفات القناة. وكذلك على المشار عنوان جيدا، ورقم الإطار وقناة المعرف باسم الفوقية الصورة. استخدام الرمز تسطير لتجنب الخلط جيدا والإطار الفوقية. </li><li style=";text-align:right;direction:rtl"> تسمية الملفات مع هذه العناصر الوصفية في الترتيب المحدد. وهذا أمر ضروري لضمان أن الخطوات اللاحقة البرمجيات كورمجموعات مجموعة ctly من الصور للتحليل. </li><li style=";text-align:right;direction:rtl"> تحميل وتثبيت التعريف خلية مجانية، النشطة بيرل الجماعة الطبعة، R بيئة البرمجة الإحصائية وRStudio. قبول كافة الخيارات الافتراضية أثناء التثبيت. يجب على المستخدمين PC تركيب أحدث بيرل تمكين جميع الخيارات المتعلقة PATH وتكوين الجمعيات ملحق الملف ورسم الخرائط النصي حيث يطلب منك ذلك. نشط بيرل هو اختياري لمستخدمي ماك، لكنها لن تحتاج إلا لتشغيل البرنامج النصي بيرل في الخطوة 3.2 من سطر الأوامر المحطة الطرفية بدلا من استخدام رمز النقر. </li><li style=";text-align:right;direction:rtl"> فتح برنامج التعريف الخلية، انقر فوق &#39;ملف&#39;، &#39;استيراد خط أنابيب&#39; ثم &#39;من ملف&#39; وحدد 3_channels_pipeline.cppipe الملف (أرقام S1A وS1B). يحتوي ملف التعليمات اللازمة للبرنامج لتفسير البيانات الوصفية للصورة الملف من الاتفاقية اسم الملف وصفها. التعريف خلية يتعلق الآن الصور، ومقتطفات DNA النووي وشدة الأجسام المضادة من عشرويستخدم جنوب شرقي القناة GFP لحساب نسبة النووية مقابل كثافة السيتوبلازم لكل خلية الكشف عن (أرقام 4 و 5). </li><li style=";text-align:right;direction:rtl"> انقر على الزر &quot;عرض إعدادات إخراج&quot; في الزاوية السفلى اليسرى من النافذة التعريف الخلية. في الجزء العلوي من الشاشة الجديدة ومربعات النص المسمى &quot;المجلد الافتراضي الإدخال&quot; و &quot;مجلد الإخراج الافتراضي&quot;. في وقت واحد، انقر فوق-الرموز المجلد إلى حق هذه الصناديق وحدد موقع الملفات صورة للتحليل وجهة للبيانات المستخرجة، على التوالي (الشكل S1C). </li><li style=";text-align:right;direction:rtl"> بدء تحليل الصور عن طريق الضغط على زر &quot;تحليل الصور&quot; في الزاوية اليسرى السفلى من التعريف الخلية. في الجزء السفلي من الشاشة مراقبة الوقت المتبقي لاستخراج البيانات، و&quot;تحليل وقف &#39;وأزرار&quot; وقفة &quot;. إذا لزم الأمر وقفة تحليل عن طريق اختيار زر &#39;وقفة&#39; في أي وقت، وهو مفيدعند مشاهدة الصور التي يجري تحليلها (موضح في الخطوة 2.8). </li><li style=";text-align:right;direction:rtl"> اختياريا، فتح النوافذ لأي من الخطوات تحليل الصور عن طريق النقر على العين الرموز في لوحة على اليسار المتطرف من إطار البرنامج (الشكل S1D). مراقبة النافذة &quot;IdentifyPrimaryObjects&quot; وتلك ل&quot;الثانوية&quot; و &quot;كائنات العالي&quot; للتأكد من أن الإعدادات الحالية في التعريف خلية لأداء تقطيع الصورة هي مناسبة (انظر الشكل 1 ومناقشة لتقديم المشورة بشأن تعديل هذه الإعدادات). </li><li style=";text-align:right;direction:rtl"> انقر فوق &quot;موافق&quot; في مربع الرسالة التي تظهر عند تحليل كامل. الذهاب إلى &#39;افتراضي المجلد الإخراج &quot;الموقع حيث يتم حفظ كافة ملفات البيانات مع النتائج على النحو مفصولة بفواصل ذات القيمة (CSV) الملفات (الشكل S2A). </li></ol> 3. استخراج البيانات <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> العثور على الملف الجديد &quot;Nuclei.csv&quot;، والتي يتم تضمينها بينالإخراج من التعريف الخلية. هذا الملف يحتوي على بيانات الخلية الفردية لالفلورسنت كثافة الأجسام المضادة النووي، وكثافة DNA النووية وGFP CDK2 القيم نسبة مراسل (أرقام 6A و S2A). ملاحظة: سوف مختبرات مختلفة يريدون لمعالجة هذا النوع من البيانات لتتناسب مع طبيعة المقايسات الخاصة بهم. اقترح للبيانات الحالية هي النابضة من خلايا من كل شرط المعاملة وفقا للبيانات الأجسام المضادة والقيم مراسل GFP CDK2 باستخدام بيرل النصي المقدمة &quot;2_gate_classifier.pl&quot;. </li><li style=";text-align:right;direction:rtl"> نسخ بيرل ملف البرنامج النصي المقدمة &quot;2_gate_classifier.pl&quot; في نفس المجلد مثل ملف بيانات &quot;Nuclei.csv&quot; (الشكل S2A). انقر نقرا مزدوجا فوق الرمز للبرنامج النصي بيرل، وعند المطالبة، اكتب الاسم الكامل للملف بيانات تليها &quot;. CSV &#39;اسم اسم الملف للملف الذي كانت الخلايا ليتم بوابات وأخيرا القيم بوابة للأجسام المضادةمضان والبيانات مراسل GFP CDK2. ملاحظة: كيفية تحديد أساسا إعدادات بوابة وتطبيق هذه لتحليل البيانات وتناقش أدناه في قسم البيانات الممثل والشكل 6 (لتحليل المقدمة على بيانات عن استخدام &quot;0.004&quot; و &quot;1.5&quot;، على التوالي). يجب على المستخدمين ماك تشغيل البرنامج النصي بيرل من سطر الأوامر المحطة الطرفية بكتابة: &quot;بيرل 2_gate_classifier.pl&quot;. </li><li style=";text-align:right;direction:rtl"> لاحظ الملف الذي تم إنشاؤه حديثا والذي يجمع بين القيم الفردية فحص خلية الخام من بيانات التعريف الخلية الأصلية مع تسميات الفئات السكانية الفرعية التي تظهر كيف أن كل خلية من كل بئر ينفذ ضد كل من بوابات (الشكل 6C). </li><li style=";text-align:right;direction:rtl"> رسم البيانات لكل حالة تجريبية باستخدام الفردية تسميات حيوانية الخلية عن طريق فتح البرنامج RStudio. انقر فوق &quot;ملف&quot; و &quot;فتح ملف&quot;، ثم حدد &quot;analysis.r&quot; ملف المقدمة. مراقبة الأوامر لرسم الأرقام 6B، <sترونج&gt; 7 و 8 في الإطار الأيسر العلوي من RStudio (الشكل S2B). في الإطار الأيسر العلوي، وبين رموز اقتباس مزدوجة على خطوط 5 و 6، اكتب عنوان الكمبيوتر من المجلد الذي يحتوي على البيانات بوابات. تتضمن حرف محرك الأقراص واسم الملف نفسه، على التوالي (على سبيل المثال، &quot;C: / مجلد تحليل / تحليل المخرجات&quot; و &quot;nuclei_gated.csv&quot;). ملاحظة: إذا تم استخدام RStudio لأول مرة على جهاز كمبيوتر معين، فإن حزمة الرسومات R &#39;ggplot2 &quot;تحتاج ليتم تثبيتها أولا. وهذه خطوة مرة واحدة فقط لتثبيت جديد من RStudio، وبعد ذلك تصبح هذه خطوة زائدة عن الحاجة. لتثبيت &quot;ggplot2&quot;، انقر فوق علامة التبويب يسمى &quot;الحزم&quot; فوق النافذة في الزاوية اليمنى السفلى من RStudio، انقر فوق الزر &#39;تثبيت الحزم &quot;الذي يظهر أسفل هذه. سوف تظهر نافذة جديدة. نوع &#39;ggplot2 &quot;(اقتباسات حذف) في&quot; الحزم الصورةوتيرة في هذا الإطار الجديد وأخيرا انقر على زر &quot;التثبيت&quot; لإغلاق النافذة، وتثبيت وظائف ggplot2 اللازمة والعودة إلى إطار RStudio الرئيسي لمواصلة من الخطوة 3.6. </li><li style=";text-align:right;direction:rtl"> خطوط تسليط الضوء من 1 إلى 17 في الإطار الأيسر العلوي من RStudio، ثم انقر فوق الزر &#39;تشغيل&#39;. هذا وسوف إدخال البيانات التجريبية، والقيم عتبة وتفاصيل المكان جيدا إلى R (الشكل S2C). سوف R الآن اجراء مؤقتا البيانات ذات الصلة بتهمة التآمر. </li><li style=";text-align:right;direction:rtl"> تسليط الضوء على كتل الفردية من قانون المتبقية تحت خط 17 وخلق المؤامرات المقابلة عن طريق النقر على زر &#39;تشغيل&#39; كما كان من قبل. مراقبة المؤامرات في الإطار في الزاوية اليمنى السفلى من RStudio وحفظ عدد من الأشكال عن طريق النقر على زر &#39;تصدير&#39; (الشكل S2D). </li><li style=";text-align:right;direction:rtl"> في حين إغلاق RStudio، انقر فوق &quot;لا إنقاذ&quot; عند المطالبة. وهذا ما يمنع التشويش على استخدام المقبل من RStudio، التي ستعقد البيانات غير ذلكعن الجلسة السابقة. </li></ol>

<ol>
	<li>Carpenter, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CellProfiler:+image+analysis+software+for+identifying+and+quantifying+cell+phenotypes.">CellProfiler: image analysis software for identifying and quantifying cell phenotypes.</a> Genome Biol. 7 (10), 100 (2006).</li><li>Khan, A., Eldaly, H., Rajpoot, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+gamma-gaussian+mixture+model+for+detection+of+mitotic+cells+in+breast+cancer+histopathology+images.">A gamma-gaussian mixture model for detection of mitotic cells in breast cancer histopathology images.</a> J Pathol Inform. 4, 11 (2013).</li><li>Selzer, P., Beibel, M., Gubler, H., Parker, C. N., Gabriel, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+multivariate+data+analysis+strategies+for+high-content+screening.">Comparison of multivariate data analysis strategies for high-content screening.</a> J Biomol Screen. 16 (3), 338-347 (2011).</li><li>Lyman, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+content,+high-throughput+analysis+of+cell+cycle+perturbations+induced+by+the+HSP90+inhibitor+XL888.">High content, high-throughput analysis of cell cycle perturbations induced by the HSP90 inhibitor XL888.</a> PLoS One. 6 (3), e17692 (2011).</li><li>Richardson, E., Stockwell, S. R., Li, H., Aherne, W., Cuomo, M. E., Mittnacht, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism-based+screen+establishes+signalling+framework+for+DNA+damage-associated+G1+checkpoint+response.">Mechanism-based screen establishes signalling framework for DNA damage-associated G1 checkpoint response.</a> PLoS One. 7 (2), e17692 (2012).</li><li>Heynen-Genel, S., Pache, L., Chanda, S. K., Rosen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomic+and+high-content+screening+for+target+discovery+and+deconvolution.">Functional genomic and high-content screening for target discovery and deconvolution.</a> Expert Opin Drug Discov. 7 (10), 955-968 (2012).</li><li>Krausz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-content+siRNA+screening.">High-content siRNA screening.</a> Mol Biosyst. 3 (4), 232-240 (2007).</li><li>Gu, J., Xia, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+Cycle-dependent+Regulation+of+a+Human+DNA+Helicase+That+Localizes+in.">Cell Cycle-dependent Regulation of a Human DNA Helicase That Localizes in.</a> DNA Damage Foci. Mol Biol Cell. 15 (7), 3320-3332 (2004).</li><li>Mittnacht, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Control+of+pRB+phosphorylation.">Control of pRB phosphorylation.</a> Curr Opin Genet Dev. 8 (1), 21-27 (1998).</li><li>Mittnacht, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+retinoblastoma+protein--from+bench+to+bedside.">The retinoblastoma protein--from bench to bedside.</a> Eur J Cell Biol. 84 (2-3), 97-107 (2005).</li><li>Nybo, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GFP+imaging+in+fixed+cells.">GFP imaging in fixed cells.</a> BioTechniques. 52 (6), 359-360 (2012).</li><li>Schwartz, R. L., Foy, B. D., Phoenix, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Learning Perl - Making Easy Things Easy and Hard Things Possible. , 1-363 (2011).</li><li>Wickham, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> ggplot2: Elegant Graphics for Data Analysis. , 978-970 (2009).</li></ol>

الكتاب ليس لديهم ما تكشف

سير العمل صفه يشكل اجراءات لperturbance multiwell من الخلايا باستخدام سيرنا، كشف علامة لاحق واستخدامها في نهاية المطاف من سلسلة من الخطوات التي تدعمها البرمجيات لتسهيل استخراج البيانات الكمية من الناتج الصور فلوري المجهر. ويركز المنهج على تقديم قيم الكثافة النووية وحشوية عن الخلايا الفردية، التي لديها التطبيق العملي واسع في العديد من التطبيقات المستندة إلى الخلية. تم إنشاء البيانات المثال المستخدمة هنا في الإعداد الشاشة سيرنا التي يتم اختبارها تحليلين الفلورية للمرحلة G1 دورة الخلية العبور والمترابطة إلى مقياس فيزيائي حيوي أكثر مباشرة من المحتويات DNA النووي. استخدام وصمة عار DNA الفلورسنت لصورة DNA النووي هو خطوة لا غنى عنها في عملية تقطيع الصورة لأنها تتيح تحديد الخلايا الفردية وما نتج عن ذلك &quot;قناع نوى&quot; بمثابة نقطة انطلاق لتحديد المقابلة cytoplasmiمناطق ج. مراسل CDK2 الموسومة GFP، وهو ما يعبر عنه مستقر في الخلايا، ويعطي متغير بعد أعلى باستمرار من إشارة الخلفية في السيتوبلازم التي يمكن أن توضح هذه المقصورة. يجب أن يكون خط أنابيب التحليل نفسه ينطبق على تحليل الأحداث البروتين إزفاء باستخدام آخرين للصحفيين المرتبطة مضان مناسبة واستجابتها لperturbance. أيضا، فإن استبدال مراسل GFP CDK2 مع السيتوبلازم محددة الأصباغ الفلورية تسمح باستخدام بديل من هذه الخوارزمية لقياس أبعاد السيتوبلازم والأحجام النسبية للخلايا في الصور. آخر الاعتبار تصميم في استراتيجية تجزئة الصورة الموضحة هنا هو استخدام التعريف خلية لتقديم قيم الكثافة متكاملة لتقدير DNA. التكامل من شدة قيم DNA النووي البيانات تلطيخ تسمح التغيرات المحتملة في حجم النواة، ويمثل مباراة وثيقة لمحات الكمي ينظرليوديد propidium الملون FACS البيانات. ومع ذلك، وكثافة متكاملة قد لا توفر وسيلة مناسبة لتقييم وظيفة البروتين حيث متوسط ​​تركيز، ومن أمثلته كثافة متوسط ​​للمستضد مضان، هو أكثر أهمية من الناحية البيولوجية المبلغ الإجمالي متكاملة من البروتين (ومضان المرتبطة بها) داخل حجرة الخلية. لذلك يعني استخدمت قيم الكثافة لP-S780 RB1 والبيانات GFP. الخيار لتغيير بين وضعي (يعني أو متكاملة) تقييم البيانات يتم العثور على لوحة &quot;ExportToSpreadsheet&quot; من البرنامج التعريف الخلية. يتم تحسين إعدادات تحليل في ملف 3_channels_pipeline.cppipe للصور في مجموعة البيانات المثال. وتحليل الصور مجموعات جديدة مع هذا البروتوكول يتطلب أن أسماء الملفات تعتمد صفت اصطلاح التسمية فوق (الشكل 3). أيضا، تقدر حساسية لتتناسب مع سطوع تلطيخ DNA النووي وعتبات الخلفيةقد تحتاج شدة في مجموعات الصور الجديدة التي سيتم تعديلها ضمن إعدادات التعريف الخلية. نظرا للدور الرئيسي يحمل تلطيخ DNA لبناء مختلف الأقنعة تقطيع الصورة، وتطبيق الإعدادات حساسية الصحيحة لهذه القناة هو المفتاح لتحليل البيانات الناجح لصورة جديدة مع برنامج التعريف الخلية. ملف الإعدادات المقدمة التعريف خلية (3_channels_pipeline.cppipe) يحتوي الملاحظات على المعلمات الأكثر فائدة في كثير من الأحيان للتكيف مع تحليل لبيانات جديدة. هذه الملاحظات هي في مربع النص في أعلى الشاشة في خلية التعريف النافذة الرئيسية وتشمل توجيهات بشأن تغيير إعدادات حساسية وضبط عدد من القنوات ليتم تحليلها. كما اتهم في بروتوكول القسم 2.8، لاختبار إعدادات البيانات صورة جديدة قد يكون من الضروري لمراقبة تجزئة الصورة خلال تحليل الصور عن طريق النقر مفتوحة الرموز &#39;العين&#39; لكل من &#39;تحديد ... كائنات &quot;خطوات بروتوكول (الشكل S1D </strong&gt;). على وجه الخصوص، والتصور من بيانات الصورة من خلال &quot;IdentifyPrimaryOjects&quot; تظهر إذا تم تحديد قناع النواة بشكل صحيح من الصور من تلطيخ DNA. على الصفحة برنامج التعريف الخليوي لوحدة في &quot;IdentifyPrimaryOjects &#39;هو معامل التصحيح العتبة. سوف التجربة والخطأ تعديل هذه القيمة إصلاح معظم الأخطاء الاعتراف النووية. قيم توازن القناة DNA ضد كثافة الخلفية لكل صورة. قيم معامل التصحيح عتبة تتوقف حوالي 1، حيث يزيد هذا هو أكثر صرامة (جيد للصور واضحة) وأقل من 1 وتساهلا (مناسبة إلى صور مع تباين أقل بين تلطيخ والخلفية). الناتج الخام من بيانات الخلية الفردية من التعريف خلية يمكن تحليلها بطرق لتتناسب مع احتياجات دراسات أخرى متفاوتة. المبين هنا هو استخدام برنامج نصي بيرل لتطبيق البوابات لاثنين من المعلمات قياس لكل خلية من أجل مساعدة استخراج الاتجاهات البيولوجية من أحد البياناتتصريح د المراجع المتصالبة من القطعان التي تم تحديدها مع قياسات إضافية. على الرغم من أنه من الممكن بالتساوي لتشمل عناصر النابضة في إطار التعريف خلية، والطريق البديل المستخدم هنا يوفر قدرا أكبر من المرونة والسرعة، وتحديدا إذا تحتاج مجموعات كبيرة من البيانات ليتم تقييمها. أبطأ مرحلة في مراحل ما بعد الاستحواذ صورة البروتوكول الحالي هي قيد التشغيل للبرنامج التعريف الخلية. التعريف خلية هنا يتم تشغيل دون فرض البوابات لإنتاج الخام مجموعة البيانات بوابات الامم المتحدة والتي يمكن أعادوا تحليل مع بيرل النصي لاحق بسرعة أكبر، وإذا لزم الأمر، تكرارا مع القيم بوابة مختلفة. ليست كل الدراسات سوف نعرف مقدما القيم بوابة مناسبة لأن هذا قد تختلف مع الكواشف على أي مجموعة معينة من البيانات، وربما مع مرور الوقت. ولذا، ينصح لتوليد رسوم بيانية تصور توزيع البيانات الخام التي تم الحصول عليها من التعريف الخليوي لالضوابط الإيجابية وخلايا وهمية-إرتباك من أجل تحديد مناسبة بوابة VALUوفاق للمعلمات في المصالح. يتم كتابة البرامج النصية Perl لقبول هيكل عمود تعريف صارم من البيانات من التعريف خلية وقد تتوقف عن العمل إذا كان المستخدم بتعديل عدد من إخراج المعلمات من قبل خلية التعريف باستخدام إعدادات &quot;ExportToSpreadsheet&quot;. للمساعدة في تنفيذ تعديل الإعدادات يتم تضمين الملاحظات داخل ملفات البرامج النصية بيرل. لرؤية هذه عرض النصي في محرر النص، ويفضل تعيين محرر نصوص مبرمج لرمز اللون عناصر بيرل (على سبيل المثال، http://www.activestate.com/komodo-edit). هذه الملاحظات تشير إلى حيث لضبط النصي على التكيف مع التغيرات في تنسيق البيانات. وعلى غرار البرامج النصية بيرل، ملف R-كود المقدمة (analysis.r)، التي تحتوي على تعليمات بتهمة التآمر الأرقام من بيانات تحليل الصور، ويمكن أن تقرأ في محرر نص أو برنامج RStudio لمعرفة الملاحظات الإضافية عن استخدام والتكيف. ويمكن استكمال هذه الملاحظات مع التفاصيل حول التعابير العادية وبيرل &lt;سوب&gt; 12 وحزمة ggplot2 13 لR، وكلاهما تشكل الأساس لكيفية قراءة البيانات، المشروح وتآمر على التوالي. دراسات جديدة باستخدام المجهر مضان فضلا عن البيانات الأولية المودعة لدى منشورات مفتوحة المصدر قابلة للطرق التحليل مثل تلك التي وصفها هنا. طبيعة البيانات العالية المحتوى يفسح المجال لتحليل العودية مع التركيز تحليلية مختلفة تبعا لاهتماماته البحثية من أي مراقب معين. على الرغم من أن الأسئلة التي يمكن أن يطلب من بيانات محدودة بسبب تحقيقات المستخدمة في الأصل، بيانات الصورة كثيرا ما يمكن أعادوا تحليل هادف خارج نطاق الدراسات التي ولدت فيها.

العمل المقدم هنا يصف استخدام متاحة بحرية التعريف البرمجيات خلية لأداء انهيار الموجهة الخوارزمية من الصور المجهري الفلورسنت من الخلايا الملتصقة لتحديد الخلايا الفردية والمناطق التحت خلوية محددة. هذا النهج، ويشار إلى تقطيع الصورة، يسمح لاحق التحليل متعدد حدودي من الخلايا المصورة عن طريق قياس علامات fluorescently المسمى المترجمة إلى كل خلية أو المنطقة التحت خلوية (يشار إلى كائنات مجزأة ع). ويشكل هذا العمل أساسا لتمكين تحليل عالية المحتوى، ويقصد لتكون بمثابة الأداة التي يمكن تطويرها وتعديلها لتناسب متعددة حدودي، ويحلل الخلايا الفردية في المختبرات دون الوصول إلى أدوات عالية المحتوى المتخصصة أو البرمجيات الاحتكارية. وتشمل الملفات المرفقة مع هذه المخطوطة مجموعة اختبار بيانات الصورة الخام ذات الصلة، وإعدادات خوارزمية والكتابات الداعمة لتوليد تحليل وصفها. وقدمت إعدادات خوارزمية وأو هي الأمثل التعريف خلية للبيانات المثال الذي والتفاصيل القسم مناقشة ما قد يكون التعديلات اللازمة لتمكين استخدام بيانات الصورة من الدراسات الأخرى. مرة واحدة وقد تم استخراج البيانات الكمية باستخدام التعريف خلية، قد يكون مختبرات مختلفة متطلبات مختلفة عن كيفية استخدام المعلومات المقدمة من القيم خلية فردية في البيانات الخام. المبين هنا هو نهج واحد التي يتم من خلالها تطبيق البوابات إلى البيانات الخام لكل الفحص. باستخدام هذه البوابات، يتم تحويل البيانات إلى حيث ثنائية الاستجابة، مما يسمح التصور من الاتجاهات التي تربط بين العلاجات المختلفة مع مجموعات سكانية فرعية من الخلايا التي تمر استجابة محددة من الابواب. يتم تعيين بوابات بناء على ملاحظات توزيعات البيانات التي تم الحصول عليها لضوابط السلبية والإيجابية المناسبة لكل قياس ذات الصلة. استخدام البوابات هو مجرد مثال واحد من كيفية إدارة، والقياسات المعتمدة على الخلايا الخام. كما هو موضح هنا هو استخدام كثافة DNA النووية ليasurements في شكل الخام على أنها مجموعة من القيم المستمر في تركيبة مع البيانات بوابات. وينبغي النظر في المناهج الأخرى لإدارة البيانات تحليل الصور، وهذا يتوقف على طبيعة الدراسة؛ تم الإبلاغ عن بدائل إحصائية لاستخدام بوابات لتعيين الخلايا لمجموعات سكانية فرعية 2 ومنهجية المقارنات استراتيجيات لتلخيص البيانات عالية المحتوى عبر تم الإبلاغ عن أعداد كبيرة من المعلمات 3. وقد وجدت تحليلات عالية المحتوى من بيانات الصورة استخدامها في الدراسات الخلوية من الاستجابة المخدرات، عكس الوراثة والإجهاد البيئي يشير 4-6. ميزة تحليل عالية المحتوى تنبع من حقيقة أن تحليل حسابي من البيانات مضان المجهر يسمح المعلمات الكمية والمكانية التي سينظر فيها في وقت واحد عبر الخلايا الفردية (7). وبهذه الطريقة، يمكن للنتائج الخلوية لفحوصات متعددة يكون، والسلوك التفاضلي عبر المشار إليها من فحص-ديمكن تتبع القطعان خلية efined ضمن الظروف التجريبية وفحوصات يمكن أن تشمل النظر في المتغيرات المورفولوجية. الاستراتيجيات وتحليل سير العمل تناقش هنا، كما لنهج عالية المحتوى الأخرى، هي قادرة على تقديم البيانات المضاعفة التي يتم الرجوع إليها العابرة إلى الخلايا الفردية. دراسات عالية المحتوى أساليب الدعوى التي تولد الصور المجهر الفلورسنت وتنطبق على تحليل البيانات التي تتراوح بين عشرات الصور التي تنتج في انخفاض الإنتاجية التقليدية المجهري القائم على مضان من خلال لآلاف من الصور المنتجة باستخدام منصات فحص عالية المحتوى الآلي. ويتضح سير العمل هنا مع البيانات المثال من الذي تقاس فحوصات منفصلة سواء من حيث شدة النووية علامة فلوري أو النبات حشوية / النووي من البروتين مراسل الفلورسنت، على التوالي. سير العمل يتسم بالمرونة في ذلك يمكن اعتبار هذه المقايسات على حدة أو مجتمعة تبعا EACح نظرا سؤال البحث من قبل المحققين مختلف. ويتم إنتاج البيانات المثال كجزء من التدخل RNA (رني) تجربة (الشكل 1). وتستخدم التدخل أليغنوكليوتيد] RNA الصغيرة (سيرنا) لضربة قاضية بروتينات معينة في HCT116 القولون البشري خلايا سرطان التي تؤدي إلى تغييرات لاثنين من الصحفيين الفلورسنت من التي تعتمد على السيكلين كيناز (للمعلمين) النشاط. ويتم تقييم الفسفرة التي تعتمد على CDK6 من البروتين الشبكية النووي في سيرين 780 (P-S780 RB1) من خلال تلوين الأجسام المضادة. في نفس الخلايا، ويتم تقييم الفلورسنت مراسل البروتين الموسومة الأخضر من النشاط CDK2 (مراسل GFP CDK2) من خلال برنامجها النووي إلى نسبة حشوية حيث في غياب النشاط CDK2 مراسل يقيم في النواة، وبناء على المكوكات تفعيل CDK2 إلى السيتوبلازم 8. بالإضافة إلى ذلك، ملطخة DNA النووي من كل خلية باستخدام صبغ الإقحام DNA، Bisbenzimide، والتي هي بمثابة وسيلة لتحديد الخلايا وتحديد الحدود النوى في الصور بالإضافة لمقياس سا من وفرة DNA توفير المعلومات عن موقف دورة الخلية للخلية (الشكل 2). أنشطة CDK6 وCDK2 يتم كشفها كخلايا العبور من G1 إلى S مرحلة من مراحل دورة الخلية 5 وينجح بعضها 9،10 الآخرين، وعلى هذا النحو، ومن المتوقع التوافق الوثيق بين صحفيين اثنين في الخلايا الفردية. مجموعة البيانات مظاهرة المستخدمة هنا يحلل كمثال تأثير سيرنا يستهدف CDK6 والبروتين الشبكية (RB1) والسيطرة السلبية عدم استهداف (الجدول 1). ضربة قاضية من CDK6 يجب أن يثير على حد سواء انخفاضا من RB1 حاتمة P-S780 وتراكم الخلايا في المرحلة G1 من دورة الخلية. تخدم ضربة قاضية RB1 كعنصر تحكم كاشف لخصوصية الأجسام المضادة الفوسفات-S780. صور المجهر مضان من الفورمالين ثابتة 11، وتستخدم الخلايا زراعة الأنسجة HCT116 الملون fluorescently لتحليل الصور حسابي. ثم يتم استخدام البيانات الرقمية مما أدى إلىترافقي للصحفيين وقياس تأثير الدول ضربة قاضية مختلفة. الحجم المحتمل للبيانات التي ينتجها هذا النوع من التحليل يمكن أن يمثل تحديا لأدوات التحليل العادية. على سبيل المثال، يمكن للبيانات خلية فردية يكون أكبر من بعض البرامج جدول سوف تستوعب. وشملت هي مخطوطات برل التي تؤدي بسيطة، ودرجة عالية من التكرار، وتجهيز أشرف من البيانات لمساعدة تحليل مجموعات البيانات الكبيرة. تتم كتابة البرامج النصية بيرل خصيصا لملفات الإخراج التي تنتجها التعريف الخلية، عند معالجة ملفات الصور مع ملف تسمية اتفاقية محددة (الشكل 3)، والسماح لأعداد متفاوتة من الحقول لكل بئر لاستخدامها في التحليل. ومن المهم في كثير من الأحيان إلى فحص البيانات خلية فردية بوابة لتتبع الاتجاهات فى فئة خلية 5 والمبين هنا هو استخدام برنامج نصي بيرل لعلم كل خلية على أساس البوابة مجموعة محددة سلفا لكل نوع الفحص. كما شملت البرامج النصية بيرل اختياريالتي تلخص نتائج البيانات للآبار الفردية (أو الشروط)، وتقديم: النسبة المئوية للخلايا داخل البوابة مجموعة والقيم المتوسطة من عشرات فحص الخام. وهذا الأخير الطريقة، أكثر تجانسا من عرض البيانات، غير صالح حيث تؤثر على استجابات كل أو غالبية الخلايا داخل البئر. وكما ذكر أعلاه، فإن هذا التقييم هو أقل فائدة من تلك الممنوحة من قبل الأفراد النابضة بيانات الخلية حيث ينحصر ردا على مجموعة فرعية من الخلايا داخل السكان. الأداة المساعدة من العمل صفه لا يقتصر على اضطراب من قبل سيرنا أو المقايسات علامة وصفها. وقد استخدمت دراسات هذا النهج لفحص الاستجابات في تجارب زراعة الأنسجة باستخدام مزيج من سيرنا، مثبطات الكيميائية والعلاج الإشعاعي وللتقييم من علامات أخرى من CDK6 والنشاط CDK2 5. من الناحية النظرية، فإن استراتيجية تجريبية تسمح مجموعة متنوعة من المناطق التحت خلوية مفيدة من الناحية البيولوجية أن تكون مسجلة تلقائيافي الخلايا الفردية الموجودة في الصور المجهر الفلورسنت. على هذا النحو، يمكن لهذا النهج تسفر الكمية والبيانات المضاعفة الكشف عن المعلومات البيولوجية التي قد تضيع من خلال التقنيات التي تركز على السكان بدلا من الخلايا الفردية. مع تعديلات طفيفة، وسير العمل النهج وتحليل ووصف يمكن أن تسفر عن كمية بيانات الخلية، الفردية لأي مخرجات فحص القائم على مضان واستجابات الخلايا البيولوجية، حيث التقييم الكمي للمحتوى الحمض النووي، الكمي لمضان النووي أو حشوية أو مكوكية من علامات بين هذه اثنين من مقصورات إما بشكل فردي أو بطريقة المضاعفة هي التي تهم. كما تميل متطلبات النشر بشكل متزايد نحو تقديم البيانات الخام يمكن الوصول إليها بشكل علني، والوصول إلى والألفة مع أدوات مجانية لتحليل الصور المجهري مثل تلك الموصوفة هنا سيكون أيضا من مصلحة مباشرة إلى مختبرات تبحث لreanalyze البيانات المنشورة.

<table border="0" cellpadding="0" cellspacing="0" width="604">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Name of Material/ Equipment</td>
			<td style="width:103px;">Company</td>
			<td style="width:119px;">Catalog Number</td>
			<td style="width:167px;">Comments/Description</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">AllStars negative control siRNA</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right" style="width:119px;">1027280</td>
			<td style="width:167px;">Negative control siRNA.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">CDK6 siRNA</td>
			<td style="width:103px;">Dharmacon/ Custom synthesis</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">Antisense sequence: 5&#39; CUCUAGGCCAGUCUUCUUCUU</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">RB1 siRNA</td>
			<td style="width:103px;">Dharmacon/ Custom synthesis</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">Antisense sequence: 5&#39; GGUUCAACUACGCGUGUAATT</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">5x siRNA buffer</td>
			<td style="width:103px;">Thermo Scientific</td>
			<td>B-002000-UB-100</td>
			<td style="width:167px;">To be diluted with nuclease-free, non-DEPC treated water.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Nulcease-free water (non-DEPC)</td>
			<td style="width:103px;">Applied Biosystems</td>
			<td>AM9937</td>
			<td style="width:167px;">For dilution of siRNA buffer.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Hiperfect</td>
			<td style="width:103px;">Qiagen</td>
			<td align="right">301705</td>
			<td style="width:167px;">Transfection lipid.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">DMEM</td>
			<td style="width:103px;">Life Technologies</td>
			<td align="right">41966052</td>
			<td style="width:167px;">Pyruvate and high-glucose supplemented tissue culture media.</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">96 well tissue culture plate</td>
			<td style="width:103px;">Falcon</td>
			<td align="right">3072</td>
			<td style="width:167px;">Plain, 96-well tissue culture plate for the parallel, compartmentalized mixing of transfection complexes.</td>
		</tr>
		<tr height="189">
			<td height="189" style="height:189px;width:216px;">Packard Viewplate</td>
			<td style="width:103px;">Perkin Elmer LAS</td>
			<td align="right">6005182</td>
			<td style="width:167px;">96 well TC plate with optical base on which cells are transfected, grown, fixed and eventually imaged. Supplied with opaque, adhesive plate seals, which are used during storage of used plates.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Breathable membrane</td>
			<td style="width:103px;">Alpha Labs</td>
			<td style="width:119px;">LW2783</td>
			<td style="width:167px;">Sterile, gas-permeable, adhesive membrane.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Neutral buffered formalin, 10%</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td>HT5012-1CS</td>
			<td style="width:167px;">10% Formalin (4% formaldehyde) fixative used neat in protocol.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Triton X-100</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td>X100PC</td>
			<td>Non-ionic detergent</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Tris</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td style="width:119px;">T1503</td>
			<td style="width:167px;">Trizma base (tris(hydroxymethyl)aminomethane)</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Tween 20</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td style="width:119px;">P2287</td>
			<td style="width:167px;">For plate wash solution.</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Anti-P-S780 RB1 antibody</td>
			<td style="width:103px;">Abcam</td>
			<td>ab32513</td>
			<td>Rabbit monoclonal</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">AlexaFluor647 Anti-rabbit</td>
			<td style="width:103px;">Invitrogen</td>
			<td>A21245</td>
			<td style="width:167px;">Highly cross-adsorbed, fluorescently labelled secondary antibody.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Hoechst 33342 (Bisbenzimide)</td>
			<td style="width:103px;">Sigma-Aldrich</td>
			<td>B2261</td>
			<td style="width:167px;">Fluorescent, chromatin-intercalating, DNA dye.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Permeabilization solution</td>
			<td style="width:103px;">NA</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">0.1% Triton X-100 in 50 mM Tris-buffered saline, pH 8.0.</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">Plate wash solution</td>
			<td style="width:103px;">NA</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">Tris-buffered saline containing 0.1 % Tween-20.</td>
		</tr>
		<tr height="126">
			<td height="126" style="height:126px;width:216px;">Block solution</td>
			<td style="width:103px;">NA</td>
			<td style="width:119px;">NA</td>
			<td style="width:167px;">5% powdered milk in Tris-buffered saline and 0.1% Tween-20. For blocking plate prior to immuno-staining and dilution of antibodies.</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Cell Profiler 2.1</td>
			<td style="width:103px;">Broad Institute</td>
			<td style="width:119px;"></td>
			<td>http://www.cellprofiler.org/download.shtml</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Active Perl Community Edition</td>
			<td style="width:103px;">ActiveState</td>
			<td style="width:119px;"></td>
			<td>http://www.activestate.com/activeperl/downloads</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">R programming environment</td>
			<td style="width:103px;">The R Foundation</td>
			<td style="width:119px;"></td>
			<td>http://www.r-project.org</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Rstudio</td>
			<td style="width:103px;">Rstudio</td>
			<td style="width:119px;"></td>
			<td>http://www.rstudio.com/</td>
		</tr>
	</tbody>
</table>

workflow for high-content, individual cell quantification of fluorescent markers from universal microscope data, supported by open source software

التقدم في فهم آليات الرقابة التي تحكم سلوك الخلايا في ملتصقة نماذج زراعة الأنسجة الثديية أصبحت تعتمد بشكل متزايد على وسائل التحليل وحيدة الخلية. طرق التي توفر بيانات المركبة يعكس متوسط ​​قيم المؤشرات الحيوية من السكان الخلية خطر فقدان ديناميات حيوانية التي تعكس عدم التجانس في النظام البيولوجي دراستها. وتمشيا مع هذا، يجري استبدال الأساليب التقليدية التي كتبها، أو دعمها مع، أشكال أكثر تطورا من الفحص الخلوي المتقدمة للسماح للتقييم بواسطة المجهر عالية المحتوى. هذه المقايسات يحتمل توليد أعداد كبيرة من الصور من المؤشرات الحيوية الفلورسنت، والتي مكنت من المرافق حزم البرمجيات الاحتكارية، ويسمح لقياسات متعددة حدودي لكل خلية. ومع ذلك، فقد منعت التكاليف الرأسمالية العالية نسبيا وزيادة التخصص في العديد من هذه الأجهزة إتاحتها للكثير من المحققين. الموصوفة هنا هوسير العمل المعمول به عالميا لتقدير حجم متعددة شدة علامة فلوري من المناطق التحت خلوية معينة من الخلايا الفردية مناسبة للاستخدام مع الصور من معظم المجاهر الفلورية. المفتاح لهذا العمل هو تنفيذ متاحة بحرية البرمجيات التعريف خلية 1 إلى التمييز بين الخلايا الفردية في هذه الصور، وجزء منهم في المناطق التحت خلوية محددة وتقديم كثافة مضان علامة قيم محددة لهذه المناطق. استخراج قيم الكثافة خلية فردية من بيانات الصورة هو الهدف الرئيسي لهذا العمل وسوف يتضح مع تحليل البيانات التحكم من شاشة سيرنا لG1 المنظمين تفتيش في الخلايا البشرية ملتصقة. ومع ذلك، فإن العمل المقدمة هنا يمكن تطبيقها على تحليل بيانات من وسائل أخرى للاضطراب خلية (على سبيل المثال، وشاشات المركبة) وغيرها من أشكال مضان مقرها علامات الخلوية، وبالتالي يجب أن تكون مفيدة لمجموعة واسعة من المختبرات.

Watch this Scientific Journal Video about Workflow for High-content, Individual Cell Quantification of Fluorescent Markers from Universal Microscope Data, Supported by Open Source Software at JoVE.com

Workflow for High-content, Individual Cell Quantification of Fluorescent Markers from Universal Microscope Data, Supported by Open Source Software

قدم هو المعلوماتية سير العمل المرن تمكين المضاعفة التحليل القائم على الصورة من خلايا fluorescently المسمى. سير العمل الكمي علامات النووية وحشوية ويحسب علامة النبات بين هذه الأجزاء. يتم توفير إجراءات اضطراب الخلايا باستخدام سيرنا ومنهجية موثوقة لكشف علامة المناعي غير المباشر في أشكال 96-جيدا.

سير العمل عالية المحتوى، الكمي خلية فردية من نيون علامات من المجاهر البيانات العالمي، بدعم من برمجيات المصدر المفتوح

Advances in understanding the control mechanisms governing the behavior of cells in adherent mammalian tissue culture models are becoming increasingly ...

workflow-for-high-content-individual-cell-quantification-fluorescent

Research

JoVE Journal

Biology

12.9K Views.  UCL Cancer Institute.  قدم هو المعلوماتية سير العمل المرن تمكين المضاعفة التحليل القائم على الصورة من خلايا fluorescently المسمى. سير العمل الكمي علامات النووية وحشوية ويحسب علامة النبات بين هذه الأجزاء. يتم توفير إجراءات اضطراب الخلايا باستخدام سيرنا ومنهجية موثوقة...

Video: Workflow for High-content, Individual Cell Quantification of Fluorescent Markers from Universal Microscope Data, Supported by Open Source Software

A Neuronal and Astrocyte Co-Culture Assay for High Content Analysis of Neurotoxicity

High Content Analysis (HCA) assays combine cells and detection reagents with automated imaging and powerful image analysis algorithms, allowing measurement of multiple cellular phenotypes within a single assay. In this study, we utilized HCA to develop a novel assay for neurotoxicity. Neurotoxicity assessment represents an important part of drug safety evaluation, as well as being a significant focus of environmental protection efforts. Additionally, neurotoxicity is also a well-accepted in vitro marker of the development of neurodegenerative diseases such as Alzheimer's and Parkinson's diseases. Recently, the application of HCA to neuronal screening has been reported. By labeling neuronal cells with &beta;III-tubulin, HCA assays can provide high-throughput, non-subjective, quantitative measurements of parameters such as neuronal number, neurite count and neurite length, all of which can indicate neurotoxic effects. However, the role of astrocytes remains unexplored in these models. Astrocytes have an integral role in the maintenance of central nervous system (CNS) homeostasis, and are associated with both neuroprotection and neurodegradation when they are activated in response to toxic substances or disease states. GFAP is an intermediate filament protein expressed predominantly in the astrocytes of the CNS. Astrocytic activation (gliosis) leads to the upregulation of GFAP, commonly accompanied by astrocyte proliferation and hypertrophy. This process of reactive gliosis has been proposed as an early marker of damage to the nervous system. The traditional method for GFAP quantitation is by immunoassay. This approach is limited by an inability to provide information on cellular localization, morphology and cell number. We determined that HCA could be used to overcome these limitations and to simultaneously measure multiple features associated with gliosis - changes in GFAP expression, astrocyte hypertrophy, and astrocyte proliferation - within a single assay. In co-culture studies, astrocytes have been shown to protect neurons against several types of toxic insult and to critically influence neuronal survival. Recent studies have suggested that the use of astrocytes in an in vitro neurotoxicity test system may prove more relevant to human CNS structure and function than neuronal cells alone. Accordingly, we have developed an HCA assay for co-culture of neurons and astrocytes, comprised of protocols and validated, target-specific detection reagents for profiling &beta;III-tubulin and glial fibrillary acidic protein (GFAP). This assay enables simultaneous analysis of neurotoxicity, neurite outgrowth, gliosis, neuronal and astrocytic morphology and neuronal and astrocytic development in a wide variety of cellular models, representing a novel, non-subjective, high-throughput assay for neurotoxicity assessment. The assay holds great potential for enhanced detection of neurotoxicity and improved productivity in neuroscience research and drug discovery.

This article describes a novel protocol and reagent set designed for sensitive measurement of neurotoxic effects of compounds and treatments on co-cultures of neurons and astrocytes using high content analysis. Results demonstrate that high content analysis represents an exciting novel technology for neurotoxicity assessment.

والخلايا العصبية ونجمية المشارك الثقافة الفحص لتحليل محتوى عال من العصبية

High Content Analysis (HCA) assays combine cells and detection reagents with automated imaging and powerful image analysis algorithms, allowing ...

Imaging C. elegans Embryos using an Epifluorescent Microscope and Open Source Software

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using fluorescent-labeled reporter proteins or differential interference contrast (DIC) microscopy, allows for the examination of the temporal progression of these dynamic events which is otherwise inferred from analysis of fixed samples1,2. Moreover, the study of the developmental regulations of cellular processes necessitates conducting time-lapse experiments on an intact organism during development. The Caenorhabiditis elegans embryo is light-transparent and has a rapid, invariant developmental program with a known cell lineage3, thus providing an ideal experiment model for studying questions in cell biology4,5and development6-9. C. elegans is amendable to genetic manipulation by forward genetics (based on random mutagenesis10,11) and reverse genetics to target specific genes (based on RNAi-mediated interference and targeted mutagenesis12-15). In addition, transgenic animals can be readily created to express fluorescently tagged proteins or reporters16,17. These traits combine to make it easy to identify the genetic pathways regulating fundamental cellular and developmental processes in vivo18-21. In this protocol we present methods for live imaging of C. elegans embryos using DIC optics or GFP fluorescence on a compound epifluorescent microscope. We demonstrate the ease with which readily available microscopes, typically used for fixed sample imaging, can also be applied for time-lapse analysis using open-source software to automate the imaging process.

Imaging C. elegans Embryos using an Epifluorescent Microscope and Open Source Software

The C. elegans embryo is a powerful system for studying cell biology and development. We present a protocol for live imaging of C. elegans embryos utilizing DIC optics or fluorescence using readily available epifluorescent microscopes and open-source software.

التصوير C. ايليجانس الأجنة باستخدام مجهر Epifluorescent وبرمجيات المصدر المفتوح

Cellular processes, such as chromosome assembly, segregation and cytokinesis,are inherently dynamic. Time-lapse imaging of living cells, using ...

A High-content Imaging Workflow to Study Grb2 Signaling Complexes by Expression Cloning

Signal transduction by growth factor receptors is essential for cells to maintain proliferation and differentiation and requires tight control. Signal transduction is initiated by binding of an external ligand to a transmembrane receptor and activation of downstream signaling cascades. A key regulator of mitogenic signaling is Grb2, a modular protein composed of an internal SH2 (Src Homology 2) domain flanked by two SH3 domains that lacks enzymatic activity. Grb2 is constitutively associated with the GTPase Son-Of-Sevenless (SOS) via its N-terminal SH3 domain. The SH2 domain of Grb2 binds to growth factor receptors at phosphorylated tyrosine residues thus coupling receptor activation to the SOS-Ras-MAP kinase signaling cascade. In addition, other roles for Grb2 as a positive or negative regulator of signaling and receptor endocytosis have been described. The modular composition of Grb2 suggests that it can dock to a variety of receptors and transduce signals along a multitude of different pathways1-3.
	Described here is a simple microscopy assay that monitors recruitment of Grb2 to the plasma membrane. It is adapted from an assay that measures changes in sub-cellular localization of green-fluorescent protein (GFP)-tagged Grb2 in response to a stimulus4-6. Plasma membrane receptors that bind Grb2 such as activated Epidermal Growth Factor Receptor (EGFR) recruit GFP-Grb2 to the plasma membrane upon cDNA expression and subsequently relocate to endosomal compartments in the cell. In order to identify in vivo protein complexes of Grb2, this technique can be used to perform a genome-wide high-content screen based on changes in Grb2 sub-cellular localization. The preparation of cDNA expression clones, transfection and image acquisition are described in detail below. Compared to other genomic methods used to identify protein interaction partners, such as yeast-two-hybrid, this technique allows the visualization of protein complexes in mammalian cells at the sub-cellular site of interaction by a simple microscopy-based assay. Hence both qualitative features, such as patterns of localization can be assessed, as well as the quantitative strength of the interaction.

A high-content screening method for the identification of novel signaling competent transmembrane receptors is described. This method is amenable to large-scale automation and allows predictions about in vivo protein binding and the sub-cellular localization of protein complexes in mammalian cells.

سير عمل التصوير عالي المحتوى لدراسة Grb2 مجمعات اشارة عن طريق الاستنساخ التعبير

Signal  transduction by growth factor receptors is essential for cells to maintain  proliferation and differentiation and requires tight control. Signal  ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

التنميط الفردية الخلايا الجذعية الجنينية البشرية من خلال الكمي RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Tracking and Quantifying Developmental Processes in C. elegans Using Open-source Tools

Quantitatively capturing developmental processes is crucial to derive mechanistic models and key to identify and describe mutant phenotypes. Here protocols are presented for preparing embryos and adult C. elegans animals for short- and long-term time-lapse microscopy and methods for tracking and quantification of developmental processes. The methods presented are all based on C. elegans strains available from the Caenorhabditis Genetics Center and on open-source software that can be easily implemented in any laboratory independently of the microscopy system used. A reconstruction of a 3D cell-shape model using the modelling software IMOD, manual tracking of fluorescently-labeled subcellular structures using the multi-purpose image analysis program Endrov, and an analysis of cortical contractile flow using PIVlab (Time-Resolved Digital Particle Image Velocimetry Tool for MATLAB) are shown. It is discussed how these methods can also be deployed to quantitatively capture other developmental processes in different models, e.g., cell tracking and lineage tracing, tracking of vesicle flow.

Tracking and Quantifying Developmental Processes in C. elegans Using Open-source Tools

Here it is shown how to track and quantify developmental processes in C. elegans. The methods presented are based on open-source tools that can be easily implemented. It is demonstrated how to reconstruct 3D cell-shape models, how to manually track subcellular structures, and how to analyze cortical contractile flow.

تتبع وقياس العمليات التنموية في<em&gt; C. ايليجانس</em&gt; استخدام أدوات المصدر المفتوح

Quantitatively capturing developmental processes is crucial to derive mechanistic models and key to identify and describe mutant phenotypes. Here ...

Open Source High Content Analysis Utilizing Automated Fluorescence Lifetime Imaging Microscopy

We present an open source high content analysis instrument utilizing automated fluorescence lifetime imaging (FLIM) for assaying protein interactions using F&#246;rster resonance energy transfer (FRET) based readouts of fixed or live cells in multiwell plates. This provides a means to screen for cell signaling processes read out using intramolecular FRET biosensors or intermolecular FRET of protein interactions such as oligomerization or heterodimerization, which can be used to identify binding partners. We describe here the functionality of this automated multiwell plate FLIM instrumentation and present exemplar data from our studies of HIV Gag protein oligomerization and a time course of a FRET biosensor in live cells. A detailed description of the practical implementation is then provided with reference to a list of hardware components and a description of the open source data acquisition software written in &#181;Manager. The application of FLIMfit, an open source MATLAB-based client for the OMERO platform, to analyze arrays of multiwell plate FLIM data is also presented. The protocols for imaging fixed and live cells are outlined and a demonstration of an automated multiwell plate FLIM experiment using cells expressing fluorescent protein-based FRET constructs is presented. This is complemented by a walk-through of the data analysis for this specific FLIM FRET data set.

We present an open source high content analysis (HCA) instrument utilizing automated fluorescence lifetime imaging (FLIM) for assaying protein interactions using F&#246;rster resonance energy transfer (FRET) based readouts. Data acquisition for this openFLIM-HCA instrument is controlled by software written in &#181;Manager and data analysis is undertaken in FLIMfit.

المصدر المفتوح تحليل عالية المحتوى الاستفادة الآلي الإسفار مدى الحياة التصوير المجهري

We present an open source high content analysis instrument utilizing automated fluorescence lifetime imaging (FLIM) for assaying protein interactions ...

Cellular Redox Profiling Using High-content Microscopy

Reactive oxygen species (ROS) regulate essential cellular processes including gene expression, migration, differentiation and proliferation. However, excessive ROS levels induce a state of oxidative stress, which is accompanied by irreversible oxidative damage to DNA, lipids and proteins. Thus, quantification of ROS provides a direct proxy for cellular health condition. Since mitochondria are among the major cellular sources and targets of ROS, joint analysis of mitochondrial function and ROS production in the same cells is crucial for better understanding the interconnection in pathophysiological conditions. Therefore, a high-content microscopy-based strategy was developed for simultaneous quantification of intracellular ROS levels, mitochondrial membrane potential (&#916;&#936;m) and mitochondrial morphology. It is based on automated widefield fluorescence microscopy and image analysis of living adherent cells, grown in multi-well plates, and stained with the cell-permeable fluorescent reporter molecules CM-H2DCFDA (ROS) and TMRM (&#916;&#936;m and mitochondrial morphology). In contrast with fluorimetry or flow-cytometry, this strategy allows quantification of subcellular parameters at the level of the individual cell with high spatiotemporal resolution, both before and after experimental stimulation. Importantly, the image-based nature of the method allows extracting morphological parameters in addition to signal intensities. The combined feature set is used for explorative and statistical multivariate data analysis to detect differences between subpopulations, cell types and/or treatments. Here, a detailed description of the assay is provided, along with an example experiment that proves its potential for unambiguous discrimination between cellular states after chemical perturbation.

This paper presents a high-content microscopy workflow for simultaneous quantification of intracellular ROS levels, as well as mitochondrial membrane potential and morphology &#8211; jointly referred to as mitochondrial morphofunction &#8211; in living adherent cells using the cell-permeant fluorescent reporter molecules 5-(and-6)-chloromethyl-2&#39;,7&#39;-dichlorodihydrofluorescein diacetate, acetyl ester (CM-H2DCFDA) and tetramethylrhodamine methylester (TMRM).

الخلوية الأكسدة التنميط باستخدام عالية المحتوى المجهري

Reactive oxygen species (ROS) regulate essential cellular processes including gene expression, migration, differentiation and proliferation. However, ...

Open-source Single-particle Analysis for Super-resolution Microscopy with VirusMapper

Super-resolution fluorescence microscopy is currently revolutionizing cell biology research. Its capacity to break the resolution limit of around 300 nm allows for the routine imaging of nanoscale biological complexes and processes. This increase in resolution also means that methods popular in electron microscopy, such as single-particle analysis, can readily be applied to super-resolution fluorescence microscopy. By combining this analytical approach with super-resolution optical imaging, it becomes possible to take advantage of the molecule-specific labeling capacity of fluorescence microscopy to generate structural maps of molecular elements within a metastable structure. To this end, we have developed a novel algorithm &#8212; VirusMapper &#8212; packaged as an easy-to-use, high-performance, and high-throughput ImageJ plugin. This article presents an in-depth guide to this software, showcasing its ability to uncover novel structural features in biological molecular complexes. Here, we present how to assemble compatible data and provide a step-by-step protocol on how to use this algorithm to apply single-particle analysis to super-resolution images.

This manuscript uses the Fiji-based open-source software package VirusMapper to apply single-particle analysis to super-resolution microscopy images in order to generate precise models of nanoscale structure.

المصدر المفتوح تحليل واحد الجسيمات لسوبر قرار المجهري مع VirusMapper

Super-resolution fluorescence microscopy is currently revolutionizing cell biology research. Its capacity to break the resolution limit of around 300 nm ...

IR-TEx: An Open Source Data Integration Tool for Big Data Transcriptomics Designed for the Malaria Vector Anopheles gambiae

IR-TEx is an application written in Shiny (an R package) that allows exploration of the expression of (as well as assigning functions to) transcripts whose expression is associated with insecticide resistance phenotypes in Anopheles gambiae mosquitoes. The application can be used online or downloaded and used locally by anyone. The local application can be modified to add new insecticide resistance datasets generated from multiple -omics platforms. This guide demonstrates how to add new datasets and handle missing data. Furthermore, IR-TEx can be completely and easily recoded to use-omics datasets from any experimental data, making it a valuable resource to many researchers. The protocol illustrates the utility of IR-TEx in identifying new insecticide resistance candidates using the the microsomal glutathione transferase, GSTMS1, as an example. This transcript is upregulated in multiple pyrethroid resistant populations from C&#244;te D&#39;Ivoire and Burkina Faso. The identification of co-correlated transcripts provides further insight into the putative roles of this gene.

IR-TEx: An Open Source Data Integration Tool for Big Data Transcriptomics Designed for the Malaria Vector Anopheles gambiae

IR-TEx explores insecticide resistance-related transcriptional profiles in the species Anopheles gambiae. Provided here are full instructions for using the application, modifications for exploring multiple transcriptomic datasets, and using the framework to build an interactive database for collections of transcriptomic data from any organism, generated in any platform.

IR-تكس: أداه تكامل البيانات المفتوحة المصدر لنسخ البيانات الكبيرة المصممة لمكافحه ناقلات الملاريا

IR-TEx is an application written in Shiny (an R package) that allows exploration of the expression of (as well as assigning functions to) transcripts ...

Worm-align and Worm_CP, Two Open-Source Pipelines for Straightening and Quantification of Fluorescence Image Data Obtained from Caenorhabditis elegans

An issue often encountered when acquiring image data from fixed or anesthetized C. elegans is that worms cross and cluster with their neighbors. This problem is aggravated with increasing density of worms and creates challenges for imaging and quantification. We developed a FIJI-based workflow, Worm-align, that can be used to generate single- or multi-channel montages of user-selected, straightened and aligned worms from raw image data of C. elegans. Worm-align is a simple and user-friendly workflow that does not require prior training of either the user or the analysis algorithm. Montages generated with Worm-align can aid the visual inspection of worms, their classification and representation. In addition, the output of Worm-align can be used for subsequent quantification of fluorescence intensity in single worms, either in FIJI directly, or in other image analysis software platforms. We demonstrate this by importing the Worm-align output into Worm_CP, a pipeline that uses the open-source CellProfiler software. CellProfiler&#8217;s flexibility enables the incorporation of additional modules for high-content screening.&#160;As a practical example, we have used the pipeline on two datasets: the first dataset are images of heat shock reporter worms that express green fluorescent protein (GFP) under the control of the promoter of a heat shock inducible gene hsp-70, and the second dataset are images obtained from fixed worms, stained for fat-stores with a fluorescent dye.

Worm-align and Worm_CP, Two Open-Source Pipelines for Straightening and Quantification of Fluorescence Image Data Obtained from Caenorhabditis elegans

Worm-align/Worm_CP is a simple FIJI/CellProfiler workflow that can be used to straighten and align Caenorhabditis elegans samples and to score whole-worm image-based assays without the need for prior training steps. We have applied Worm-align/Worm_CP to the quantification of&#160;heat-shock induced expression in live animals or lipid droplets&#160;in fixed samples.

دودة الانحياز Worm_CP، خطين أنابيب مفتوحة المصدر لتقويم و كمية بيانات صورة الفلوريسنس التي تم الحصول عليها من Elegans Caenorhabditis

An issue often encountered when acquiring image data from fixed or anesthetized C. elegans is that worms cross and cluster with their neighbors. This ...