This work has been funded in part with Federal funds from the National Institutes of Health, Office of Director, Innovator (No.: DP2OD06514) (PCS) and from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health and Human Services, under Contracts (No:HHSN272200900018C, HHSN272200900049C and U19AI110818).

<ol>
	<li>Stremlau, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+novel+rhabdoviruses+in+the+blood+of+healthy+individuals+from+West+Africa.">Discovery of novel rhabdoviruses in the blood of healthy individuals from West Africa.</a> PLoS Negl Trop Dis. 9, e0003631 (2015).</li><li>Gire, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+surveillance+elucidates+Ebola+virus+origin+and+transmission+during+the+2014+outbreak.">Genomic surveillance elucidates Ebola virus origin and transmission during the 2014 outbreak.</a> Science. 345, 1369-1372 (2014).</li><li>Morlan, J. D., Qu, K., Sinicropi, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+depletion+of+rRNA+enables+whole+transcriptome+profiling+of+archival+fixed+tissue.">Selective depletion of rRNA enables whole transcriptome profiling of archival fixed tissue.</a> PLoS One. 7, e42882 (2012).</li><li>Park, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ebola+Virus+Epidemiology,+Transmission,+and+Evolution+during+Seven+Months+in+Sierra+Leone.">Ebola Virus Epidemiology, Transmission, and Evolution during Seven Months in Sierra Leone.</a> Cell. 161, 1516-1526 (2015).</li><li>Andersen, K. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+Sequencing+Uncovers+Origins+and+Evolution+of+Lassa+Virus.">Clinical Sequencing Uncovers Origins and Evolution of Lassa Virus.</a> Cell. 162, 738-750 (2015).</li><li>Matranga, C. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+methods+for+unbiased+deep+sequencing+of+Lassa+and+Ebola+RNA+viruses+from+clinical+and+biological+samples.">Enhanced methods for unbiased deep sequencing of Lassa and Ebola RNA viruses from clinical and biological samples.</a> Genome Biol. 15, 519 (2014).</li><li>Tang, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Seq+analysis+to+capture+the+transcriptome+landscape+of+a+single+cell.">RNA-Seq analysis to capture the transcriptome landscape of a single cell.</a> Nat Protoc. 5, 516-535 (2010).</li><li>Jiang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+spike-in+standards+for+RNA-seq+experiments.">Synthetic spike-in standards for RNA-seq experiments.</a> Genome Res. 21, 1543-1551 (2011).</li><li>. Kapa Biosystems Available from: <a target="_blank" href="https://www.kapabiosystems.com/product-applications/products/next-generation-sequencing-2/library-quantification/">https://www.kapabiosystems.com/product-applications/products/next-generation-sequencing-2/library-quantification/</a> (2015)</li><li>. Illumina Technologies Available from: <a target="_blank" href="https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/preparing-libraries-for-sequencing-on-miseq-15039740-d.pdf">https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/preparing-libraries-for-sequencing-on-miseq-15039740-d.pdf</a> (2015)</li><li>Kircher, M., Sawyer, S., Meyer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double+indexing+overcomes+inaccuracies+in+multiplex+sequencing+on+the+Illumina+platform.">Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform.</a> Nucleic Acids Res. 40, 3 (2012).</li><li>Trombley, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+panel+of+real-time+TaqMan+polymerase+chain+reaction+assays+for+detection+and+absolute+quantification+of+filoviruses,+arenaviruses,+and+New+World+hantaviruses.">Comprehensive panel of real-time TaqMan polymerase chain reaction assays for detection and absolute quantification of filoviruses, arenaviruses, and New World hantaviruses.</a> Am J Trop Med Hyg. 82, 954-960 (2010).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serial+high-resolution+analysis+of+blood+virome+and+host+cytokines+expression+profile+of+a+patient+with+fatal+H7N9+infection+by+massively+parallel+RNA+sequencing.">Serial high-resolution analysis of blood virome and host cytokines expression profile of a patient with fatal H7N9 infection by massively parallel RNA sequencing.</a> Clin Microbiol Infect. 21, 713 (2015).</li><li>Simon-Loriere, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lineages+of+Ebola+virus+in+Guinea+during+the+2014+West+African+epidemic.">Distinct lineages of Ebola virus in Guinea during the 2014 West African epidemic.</a> Nature. 524, 102-104 (2015).</li><li>Folarin, O. A., Happi, A. N., Happi, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empowering+African+genomics+for+infectious+disease+control.">Empowering African genomics for infectious disease control.</a> Genome Biol. 15, 515 (2014).</li><li>Blainey, P. C., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+MDA+for+enumeration+of+total+nucleic+acid+contamination.">Digital MDA for enumeration of total nucleic acid contamination.</a> Nucleic Acids Res. 39, 19 (2011).</li><li>Malboeuf, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+viral+RNA+genome+sequencing+of+ultra-low+copy+samples+by+sequence-independent+amplification.">Complete viral RNA genome sequencing of ultra-low copy samples by sequence-independent amplification.</a> Nucleic Acids Res. 41, 13 (2013).</li><li>Gonzalez, I. L., Sylvester, J. E., Smith, T. F., Stambolian, D., Schmickel, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosomal+RNA+gene+sequences+and+hominoid+phylogeny.">Ribosomal RNA gene sequences and hominoid phylogeny.</a> Mol Biol Evol. 7, 203-219 (1990).</li><li>Adiconis, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+RNA+sequencing+methods+for+degraded+or+low-input+samples.">Comparative analysis of RNA sequencing methods for degraded or low-input samples.</a> Nat Methods. 10, 623-629 (2013).</li></ol>

The authors have no competing financial interests.

النهج المبين تمكن قوية وعالمية، والتسلسل السريع، وكان يستخدم لتسلسل فيروس إيبولا خلال 2،4 2014 انتشار المرض. وذلك بربط نضوب انتقائية والتوليف [كدنا مع بناء مكتبة tagmentation، تم تخفيض الوقت عملية الشامل التي كتبها ~ 2 أيام من وسائل محول ربط السابقة. وفي الآونة الأخيرة، كان يعمل هذا البروتوكول من قبل المتعاونين الدوليين وغيرهم مع نجاحا كبيرا 15،16 وسيتم نشر إلى مختبرات في غرب أفريقيا لدعم البحوث والدراسات القائمة على علم الجينوم المحلية وتشخيص 17. بروتوكول الموصوفة هنا يستخدم البادئات العشوائية لإعداد كدنا] للمكتبات الحمض النووي الريبي وما يليها الفيروسية. على عكس النهج RNA وما يليها الفيروسية السابقة، أنه لا يتطلب أي معرفة مسبقة من تسلسل البيانات أو تفصيلا وتستغرق وقتا طويلا التصميم التمهيدي للفيروس أو كليد محددة. ويمكن تطبيق هذا الأسلوب على أي عينة الحمض النووي الريبي الفيروسية. على سبيل المثال، كان يستخدم لتوليد محتوى الفيروسي من كل من الايبولاوعينات لاسا 6. ويمكن أيضا أن تستخدم بروتوكول لtranscriptomic المضيف، مشاريع التسلسل metagenomic واكتشاف الممرض 1. ويستهدف خطوة حاسمة للبروتوكول ريبونوكلياز H الهضم، والإنتاجية العالية، وطريقة منخفضة التكلفة لإزالة الناقل غير المرغوب فيها والجيش الملكي النيبالي المضيف من العينات الفيروسية. الخطوة نضوب انتقائية للبروتوكول يستخدم العديد من المكونات، ويتطلب مهارة ودقة. ينبغي أن تؤخذ الوقت الاضافي والرعاية أثناء الإعداد الأولي. حيث أن معظم مصل الدم والبلازما العينات السريرية غالبا ما يكون قليلا جدا مادة الحمض النووي والتلوث وفقدان العينة شائعة. لتجنب هذه المشاكل، يجب توخي الحذر خاصة عند استخدام هذا البروتوكول. أولا، RNA هو عرضة للتدهور. وبالتالي كل المناطق يجب أن تكون نظيفة وخالية من nucleases. ثانيا، لتحديد عينات مناسبة للاستخدام في هذا البروتوكول، المقايسات QRT-PCR RNA لكلا المضيف وفيروس ينبغي أن تستخدم لتقدير 5،6 </suص&gt;. عند المقارنة بين المدخلات يرقى مع نتائج التسلسل من البروتوكول، والنجاح التسلسل (أي جيل من بيانات كافية لتجميع الفيروسي الكامل) المترابطة مع العينات التي تحتوي على ما لا يقل عن 100 خريج الحمض النووي الريبي مجموع و1،000 نسخة من الفيروس. وينبغي تجنب الثالث، والتعرض للمصادر البيئية من الأحماض النووية. يتم البروتوكول المذكورة هنا في مجلس الوزراء للسلامة الأحيائية لاحتياطات السلامة والحد من الملوثات البيئية. وعلاوة على ذلك، لدينا مجموعة والآخرون يلاحظون أن الإنزيمات التجارية قد تكون مصدرا آخر للتلوث الأحماض النووية البكتيرية في عينات المدخلات المنخفضة 6،18. استخدام مساحة عمل نظيفة (على سبيل المثال، PCR غطاء محرك السيارة، ومجلس الوزراء للسلامة الأحيائية) والضوابط السلبية (على سبيل المثال، الماء أو عازلة) سوف تساعد على التخفيف من وتتبع التلوث، على التوالي. للعينات مع &lt;100 خريج من الحمض النووي الريبي مجموع، بولي فقط (RA) RNA الناقل، وليس الريباسي، ينبغي المنضب لضمان تحقيق نتائج التسلسل عالية الجودة مع الحد من فقدان المواد. للغايةعينات المدخلات المنخفضة، قد تكون أساليب كدنا] التضخيم أكثر ملاءمة 19، على الرغم من بولي (RA) الناقل يجب إزالة قبل تركيب كدنا]. استنزاف المضيف الريباسي يثري المحتوى الفيروسي في المكتبات التسلسل وينطبق على مجموعات عينة مختلفة بما في ذلك المصل أو البلازما، وأنواع متعددة من الأنسجة من القوارض والرئيسيات غير البشرية 5،6. في الكائنات غير البشرية، يقرأ محاذاة إلى 28S الريباسي بقيت بعد نضوب، مما يشير إلى 28S الريباسي أقل محفوظ بين البشر والأنواع الأخرى 6،20. عند استخدام هذا الأسلوب مع العزلات غير البشرية، قد يكون من الضروري لتكملة مع oligos الحمض النووي مكملة لتسلسل الريباسي المتباينة لل3،21 المضيف المحدد. منذ البروتوكول هو غير متحيز، الفيروسية يقرأ قد لا تمثل سوى جزء صغير من المحتوى الكلي للمكتبة. على الرغم من أن الريباسي هو النوع الأكثر وفرة من الحمض النووي الريبي المضيفة وفقط نسبة صغيرة من الريباسي يقرأ (0؛ 1٪) وجدت بعد نضوب انتقائية، وجميع RNA المضيفة الأخرى (على سبيل المثال، مرنا) تبقى بعد نضوب وقد تكون مسؤولة عن يقرأ العديد من تسلسل من العينة. لذلك &quot;الإفراط&quot; (أي oversequencing) مكتبات فردية مطلوب من أجل الحصول على ما يكفي من التغطية للمكالمات التجمع والبديل الفيروسية. لدراستنا، ونحن نحاول تسلسل ~ 20 مليون يقرأ في عينة لدينا ما يكفي من العمق لتحليل الفيروسي المتغيرات الجيني وما يرتبط بها فضلا عن المحتوى metagenomic 2،5. لدراسات اكتشاف metagenomic والممرض، من المهم أن نلاحظ أن تتم إزالة تلويث الحمض النووي المضيف الدناز الهضم. لذلك قد تفقد الفيروسات ومسببات الأمراض الأخرى التي تحتوي على جينوم الحمض النووي خلال هذه العملية، ولكن قد لا يزال تكون متسلسلة وسيطة الحمض النووي الريبي.

الجيل القادم التسلسل الفيروسات من مصادر السريرية يمكن أن تبلغ نقل وبائيات الأمراض، فضلا عن المساعدة في دعم رواية التشخيص، وتطوير اللقاحات العلاجية. وقد سمح التوليف [كدنا باستخدام بادئات عشوائية للكشف والتجمع من الجينوم من المتباينة، وشارك في إصابة أو حتى الفيروسات الجديدة 1،2. كما هو الحال مع أساليب مشاركات أخرى، والملوثات غير المرغوب فيها وتشغل العديد من التسلسل يقرأ ويؤثر سلبا على نتائج التسلسل. المضيف وبولي (RA) RNA الناقل والملوثات الموجودة في العديد من مجموعات عينة الفيروسية الحالية. يصف بروتوكول وسيلة فعالة وفعالة من حيث التكلفة لجينوم الفيروس تسلسل الحمض النووي الريبي عميقة على أساس غير متحيز الحمض النووي الريبي مجموع وما يليها. طريقة يستخدم لريبونوكلياز H نضوب انتقائية الخطوة 3 لإزالة المضيف الريباسي غير المرغوب فيها وRNA الناقل. نضوب انتقائية يثري المحتوى الفيروسي (الشكل 1) ويحسن الجودة الشاملة من تسلسل البيانات(الشكل 2) من العينات السريرية. وعلاوة على ذلك، يتم تطبيق tagmentation إلى البروتوكول كما أنه يقلل بشكل ملحوظ وقت البناء المكتبة. وقد استخدمت هذه الأساليب لتوليد بسرعة مجموعات كبيرة من البيانات من الايبولا وحمى لاسا جينوم فيروس 2،4،5، ويمكن استخدامها لدراسة مجموعة واسعة من فيروسات الحمض النووي الريبي. وأخيرا، فإن النهج لا يقتصر على عينات الإنسان؛ وقد تجلى فائدة نضوب انتقائية في عينات الأنسجة التي تم جمعها من القوارض المصابة لاسا ونماذج المرض الرئيسيات غير البشرية 5،6. <img alt="شكل 1" src="/files/ftp_upload/54117/54117fig1.jpg" /> يعكس الشكل 1. إجمالي RNA المحتوى إثراء لاسا الفيروسات المحتوى عن طريق الانتقائية استنفاد ابتداء المضمون العام (RNA المدخلات) وإثراء فريد فيروس حمى لاسا (LASV) يقرأ (محتوى مكتبة) عند نضوب الريباسي من تسعة العزلات السريرية المختلفة. تم تعديل هذا الرقم من 6 <em&gt;. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig1large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> <img alt="الشكل 2" src="/files/ftp_upload/54117/54117fig2.jpg" /> الشكل 2. العالي الجودة تسلسل بعد الناقل RNA نضوب. الصفات قاعدة الوسيطة في دورة تسلسل بولي (RA) -contaminated المكتبات اسا فيروس (الأحمر) والسيطرة (أي الناقل لوحظ في مكتبة، أسود) من تقرير QC 13. من القراءة (1) وقراءة 2 من نهاية يقترن يقرأ يتم دمج في ملف BAM مكتبة وتعرض عشرات الجودة في كل قاعدة. تم تعديل هذا الرقم من 6. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig2large.jpg" target="_blank">الرجاء انقر هنا لعرض نسخة أكبر من هذا الرقم.</a> والفيروسي RNA وما يليها تفاصيل بروتوكول إنشاء المكتبات مباشرة من استخراجRNA جمعها من العينات السريرية والبيولوجية. لضمان السلامة الشخصية، ينبغي المعطل جميع عينات مصل الدم والبلازما والأنسجة الفيروسية في مخازن مناسبة قبل استخراج الحمض النووي الريبي. في بعض التعطيل واستخراج مجموعات، يتم تضمين الناقل بولي (RA) RNA. سيتم إزالة هذا خلال ريبونوكلياز H خطوة نضوب انتقائية الأولية. واستنادا إلى الشفاء الكامل، وتركيز المتوقع من الحمض النووي الريبي الناقل هو 100 نانوغرام / ميكرولتر. في البروتوكول، ويستخدم 110 نانوغرام / ميكرولتر بنسبة ضئيلة DT RNA (تركيز الناقل 1.1x) للنضوب. إذا بولي (RA) الناقل غير موجود في العينة، لا ينبغي أن تضاف بعد ذلك بنسبة ضئيلة (DT) قبل نضوب. تم تصميم بروتوكول التالية لمدة 24 ردود الفعل في شكل لوحة PCR (ما يصل الى 250 حجم ميكرولتر). وذكرت إصدار سابق من هذا البروتوكول في Matranga، وآخرون. 6.

<table><tbody><tr><td>96-well PCR Plates</td><td>VWR</td><td>47743-953</td><td></td></tr><tr><td>Strips of Eight Caps</td><td>VWR</td><td>47745-512</td><td></td></tr><tr><td>Nuclease-free water</td><td>Ambion</td><td>AM9937</td><td>50 ml bottle</td></tr><tr><td>TURBO DNase</td><td>Ambion</td><td>AM2238</td><td>post RNA extraction step, 2 U/&amp;micro;l, buffer included</td></tr><tr><td>PCR cycler</td><td></td><td></td><td>any PCR cyclers&amp;nbsp;</td></tr><tr><td>Agencourt RNAClean XP SPRI beads&amp;nbsp;</td><td>Beckman Coulter Genomics</td><td>A63987</td><td>beads for RNA cleanup</td></tr><tr><td>Real Time qPCR system</td><td></td><td></td><td>any system</td></tr><tr><td>DynaMag-96 Side Skirted Magnet</td><td>Invitrogen</td><td>12027</td><td></td></tr><tr><td>70% Ethanol</td><td></td><td></td><td>prepare fresh</td></tr><tr><td>qRT-PCR primers</td><td>IDT DNA</td><td></td><td>see &lt;strong&gt;Table 2&lt;/strong&gt;</td></tr><tr><td>5 M NaCl&amp;nbsp;</td><td>Ambion</td><td>AM9760G</td><td></td></tr><tr><td>1 M Tris-HCl pH 7.4&amp;nbsp;</td><td>Sigma</td><td>T2663-1L</td><td></td></tr><tr><td>1 M Tris-HCl pH 7.5&amp;nbsp;</td><td>Invitrogen</td><td>15567-027</td><td></td></tr><tr><td>1 M MgCl&lt;sub&gt;2&lt;/sub&gt;&amp;nbsp;</td><td>Ambion</td><td>AM9530G</td><td></td></tr><tr><td>Linear acrylamide&amp;nbsp;</td><td>Ambion&amp;nbsp;</td><td>AM9520</td><td></td></tr><tr><td>DNA oligos covering entire rRNA region</td><td>IDT DNA</td><td></td><td>see &lt;strong&gt;Table 3&lt;/strong&gt;, order lab-ready at 100 &amp;micro;M</td></tr><tr><td>Oligo (dT)</td><td>IDT DNA</td><td></td><td>40 nt long, desalted</td></tr><tr><td>Hybridase Thermostable RNase H&amp;nbsp;</td><td>Epicentre</td><td>H39100</td><td></td></tr><tr><td>RNase-free DNase Kit&amp;nbsp;</td><td>Qiagen</td><td>79254</td><td>post selective depletion step</td></tr><tr><td>SUPERase-In RNase Inhibitor</td><td>Ambion</td><td>AM2694</td><td></td></tr><tr><td>Random Primers&amp;nbsp;</td><td>Invitrogen</td><td>48190-011</td><td>mostly hexamers</td></tr><tr><td>10 mM dNTP mix</td><td>New England Biolabs</td><td>N0447L</td><td></td></tr><tr><td>SuperScript III Reverse Transcriptase&amp;nbsp;</td><td>Invitrogen</td><td>18080-093</td><td>with first-strand buffer, DTT</td></tr><tr><td>Air Incubator</td><td></td><td></td><td>any air incubator cyclers&amp;nbsp;</td></tr><tr><td>NEBNext Second Strand Synthesis (dNTP-free) Reaction Buffer</td><td>New England Biolabs</td><td>B6117S</td><td>10x</td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; DNA Ligase</td><td>New England Biolabs</td><td>M0205L</td><td>10 U/&amp;mu;l</td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; DNA Polymerase I&amp;nbsp;</td><td>New England Biolabs</td><td>M0209L</td><td>10 U/&amp;mu;l</td></tr><tr><td>&lt;em&gt;E. coli&lt;/em&gt; RNase H</td><td>New England Biolabs</td><td>M0297L</td><td>2 U/&amp;mu;l</td></tr><tr><td>0.5 M EDTA</td><td>Ambion</td><td>AM9261</td><td></td></tr><tr><td>Agencourt AMPure XP SPRI beads</td><td>Beckman Coulter Genomics</td><td>A63881</td><td>beads for DNA cleanup</td></tr><tr><td>Elution Buffer&amp;nbsp;</td><td>Qiagen</td><td></td><td>10 mM Tris HCl, pH 8.5</td></tr><tr><td>Quant-iT dsDNA HS Assay Kit&amp;nbsp;</td><td>Invitrogen</td><td>Q32854</td><td></td></tr><tr><td>Qubit fluorometer&amp;nbsp;</td><td>Invitrogen</td><td>Q32857</td><td></td></tr><tr><td>Nextera XT DNA Sample Prep Kit&amp;nbsp;</td><td>Illumina</td><td>FC-131-1096</td><td></td></tr><tr><td>Nextera XT DNA Index Kit&amp;nbsp;</td><td>Illumina</td><td>FC-131-1001</td><td></td></tr><tr><td>Tapestation 2200</td><td>Agilent</td><td>G2965AA</td><td></td></tr><tr><td>High Sensitivity D1000 reagents</td><td>Agilent</td><td>5067-5585</td><td></td></tr><tr><td>High Sensitivity D1000 ScreenTape</td><td>Agilent</td><td>5067-5584</td><td></td></tr><tr><td>BioAnalyzer 2100&amp;nbsp;</td><td>Agilent</td><td>G2939AA</td><td></td></tr><tr><td>High Sensitivity DNA reagents</td><td>Agilent</td><td>5067-4626</td><td></td></tr><tr><td>Library Quantification Complete kit (Universal)</td><td>Kapa Biosystems</td><td>KK4824</td><td>alternative to tapestation, bioanalyzer for library quantification</td></tr></tbody></table>

unbiased deep sequencing of rna viruses from clinical samples

نحن هنا الخطوط العريضة لجيل القادم من بروتوكول تسلسل الحمض النووي الريبي التي تمكن دي نوفو المجالس ومكالمات البديل داخل مجموعة من العوامل الوراثية الفيروسية التي تم جمعها من مصادر السريرية والبيولوجية. هذه الطريقة غير منحازة والعالمي. ويستخدم البادئات العشوائية لتخليق [كدنا ولا يتطلب أي معرفة مسبقة من المحتوى تسلسل الفيروسي. قبل بناء المكتبة، يتم استخدام انتقائي الهضم أساس H-ريبونوكلياز في استنزاف غير المرغوب فيها RNA - بما في ذلك بولي (RA) الناقل والحمض النووي الريبي الريباسي - من عينة الحمض النووي الريبي الفيروسية. نضوب انتقائية يحسن كلا من جودة البيانات وعدد فريدة من نوعها يقرأ في المكتبات RNA تسلسل الفيروسية. وعلاوة على ذلك، يتم استخدام الخطوة &quot;tagmentation&quot; القائم على ترانسبوزاز في البروتوكول كما أنه يقلل من العام وقت البناء المكتبة. وقد مكن بروتوكول تسلسل عميق السريع لأكثر من 600 لاسا وفيروس إيبولا العينات بما في ذلك مجموعات من كل الدم والأنسجة المعزولة وغير قابلة للتطبيق على نطاق واسع لدراسات الجينوم الميكروبية الأخرى.

يتيح بروتوكول صفها توليد تسلسل جودة عالية يقرأ من المدخلات المنخفضة عينات الحمض النووي الريبي الفيروسية في حين إثراء للمحتوى الفيروسية فريدة من نوعها. كما هو مبين في الشكل رقم 1، أثرى بروتوكول محتوى فريد فيروس حمى لاسا ما لا يقل عن خمسة أضعاف في جميع العينات (مقارنة مع الضوابط غير المنضب) مع مليون نسخة على الأقل من 18S الريباسي (~ 100 خريج مجموع RNA). وبالمثل، يرتبط نجاح التسلسل أيضا مع كمية الفيروس في عينة معينة. باستخدام QRT-PCR كبديل لكمية الفيروسية، والعينات التي تحتوي على ~ 1000 نسخة أو أكثر الجينوم الفيروسي في معظم الأحيان خلق تجمعات كاملة (لا تظهر البيانات). وعلاوة على ذلك، ونضوب بولي (RA) الناقل يقلل تسلسل المبلمر المتجانس من ألف وتي في المكتبات، مما أدى إلى استعدادات أكثر نظافة وضمان تسلسل جودة أفضل يقرأ (الشكل 2). المكتبات النهائية من انخفاض مساهمة العينات السريرية الفيروسية غالبا ما يكون طول القطعة واسعة من 150 إلى 1000 سنة مضت(الشكل 3). بعد التسلسل، للحد من العينة عدم التعرف والحديث المتبادل بين المكتبات ضمن تجمع 12، مؤشر فقط يقرأ بنتيجة جودة قاعدة 25 (Q25) وضمان يتم الاحتفاظ الصفر عدم التطابق أثناء عملية demultiplexing. يتم تجميع الجينوم الفيروسي باستخدام خط أنابيب المعلوماتية الحيوية معين للبحث عن الفيروسات المختلفة 2،4-6. تتوفر هذه الأدوات في https://github.com/broadinstitute/viral-ngs أو من خلال منصات السحابة التجارية 4. <table border="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> الخطوة 1.1: رد فعل الدناز </td><td></td></tr><tr><td> كاشف </td><td> حجم في رد الفعل (ميكرولتر) </td></tr><tr><td> عازلة 10X الدناز </td><td> 7 </td></tr><tr><td> nuclease خالية من المياه </td><td> 6 </td></tr><tr><td> RNA الفيروسي المستخرج </td><td> 55 </td></tr><tr><td> الدناز (يو 2 / &amp; #181؛ ل) </td><td> 2 </td></tr><tr><td> الحجم الكلي </td><td> 70 </td></tr><tr><td> الخطوة 2.1: عازلة 5X التهجين </td><td></td></tr><tr><td> كاشف </td><td> حجم ل1 مل (ميكرولتر) </td></tr><tr><td> 5 M كلوريد الصوديوم </td><td> 200 </td></tr><tr><td> 1 M تريس، حمض الهيدروكلوريك (7.4 درجة الحموضة) </td><td> 500 </td></tr><tr><td> nuclease خالية من المياه </td><td> 300 </td></tr><tr><td> الحجم الكلي </td><td> 1000 </td></tr><tr><td> الخطوة 2.1: 10X رد فعل العازلة ريبونوكلياز H </td><td></td></tr><tr><td> كاشف </td><td> حجم ل1 مل (ميكرولتر) </td></tr><tr><td> 5 M كلوريد الصوديوم </td><td> 200 </td></tr><tr><td> 1 M تريس، حمض الهيدروكلوريك (7.5 درجة الحموضة) </td><td> 500 </td></tr><tr><td> 1 م 2 MgCl </td><td> 200 </td></tr><tr><td> nuclease خالية من المياه </td><td> 500 </td></tr><tr><td> الحجم الكلي </td><td> 1000 </td></tr><tr><td> الخطوة 2.1: المياه ثمادة الأكريلاميد خطي إيث </td><td></td></tr><tr><td> كاشف </td><td> حجم ل1 مل العازلة (ميكرولتر) </td></tr><tr><td> nuclease خالية من المياه </td><td> 992 </td></tr><tr><td> مادة الأكريلاميد الخطي (5 ملغ / مل) </td><td> 8 </td></tr><tr><td> الحجم الكلي </td><td> 1000 </td></tr><tr><td colspan="2"> الخطوة 2.2: رد فعل التهجين لاستنزاف انتقائية </td></tr><tr><td> كاشف </td><td> حجم في رد الفعل (ميكرولتر) </td></tr><tr><td> 5X التهجين العازلة </td><td> 2 </td></tr><tr><td> مزيج بنسبة ضئيلة الريباسي استنفاد (100 ميكرومتر) </td><td> 1.22 </td></tr><tr><td> بنسبة ضئيلة (د) T (550 نانوغرام / ميكرولتر) </td><td> 1 </td></tr><tr><td> المعالجة الدناز الحمض النووي الريبي مجموع </td><td> ما يصل الى 5 </td></tr><tr><td> ارتفاع في الحمض النووي الريبي (وهذا هو اختياري) </td><td> 0.5 </td></tr><tr><td> الماء (مع الأكريلاميد خطية) </td><td> حتى تصل الى ما مجموعه 10 </td></tr><tr><td> إجمالي voluأنا </td><td> 10 </td></tr><tr><td colspan="2"> الخطوة 2.3: ريبونوكلياز H رد فعل لاستنزاف انتقائية </td></tr><tr><td> كاشف </td><td> حجم في رد الفعل (ميكرولتر) </td></tr><tr><td> رد فعل العازلة 10X ريبونوكلياز H </td><td> 2 </td></tr><tr><td> الماء (مع الأكريلاميد خطية) </td><td> 5 </td></tr><tr><td> بالحرارة ريبونوكلياز H (5 U / ميكرولتر) </td><td> 3 </td></tr><tr><td> الحجم الكلي </td><td> 10 </td></tr><tr><td colspan="2"> الخطوة 2.4: الدناز آخر رد فعل استنزاف انتقائية </td></tr><tr><td> كاشف </td><td> حجم في رد الفعل (ميكرولتر) </td></tr><tr><td> 10X الدناز العازلة </td><td> 7.5 </td></tr><tr><td> الماء (مع الأكريلاميد خطية) </td><td> 44.5 </td></tr><tr><td> المانع ريبونوكلياز (20 U / ميكرولتر) </td><td> 1 </td></tr><tr><td> ريبونوكلياز خالية الدناز الأول (2.72 U / ميكرولتر) </td><td> 2 </td></tr&gt; <tr><td> اجمالى حجم (مع رد فعل ريبونوكلياز H) </td><td> 75 </td></tr><tr><td colspan="2"> الخطوة 3.1: توليف [كدنا، التمهيدي عشوائي التهجين </td></tr><tr><td> كاشف </td><td> حجم في رد الفعل (ميكرولتر) </td></tr><tr><td> الريباسي / المنضب الناقل RNA </td><td> 10 </td></tr><tr><td> 3 ميكروغرام التمهيدي عشوائي </td><td> 1 </td></tr><tr><td> الحجم الكلي </td><td> 11 </td></tr><tr><td> الخطوة 3.2: حبلا الأول رد فعل التوليف [كدنا </td><td></td></tr><tr><td> كاشف </td><td> الحجم (ميكرولتر) </td></tr><tr><td> 5X الأولى الجديلة العازلة رد الفعل </td><td> 4 </td></tr><tr><td> 0.1 M DTT </td><td> 2 </td></tr><tr><td> مزيج 10 ملي dNTP </td><td> 1 </td></tr><tr><td> المانع ريبونوكلياز (20 U / ميكرولتر) </td><td> 1 </td></tr><tr><td> الناسخ العكسي (إضافة آخر) </td><td> 1 </td></tr><tr><td> الحجم الكلي (مع RNA أعلاه) &lt;/ td&gt; <td> 20 </td></tr><tr><td colspan="2"> الخطوة 3.3: الشق الثاني رد فعل التوليف [كدنا </td></tr><tr><td> كاشف </td><td> الحجم (ميكرولتر) </td></tr><tr><td> المياه خالية من ريبونوكلياز </td><td> 43 </td></tr><tr><td> 10X العازلة رد الفعل الثاني ستراند </td><td> 8 </td></tr><tr><td> مزيج 10 ملي dNTP </td><td> 3 </td></tr><tr><td> كولاي الحمض النووي يغاز (10 U / ميكرولتر) </td><td> 1 </td></tr><tr><td> كولاي البلمرة DNA الأول (10 U / ميكرولتر) </td><td> 4 </td></tr><tr><td> كولاي ريبونوكلياز H (يو 2 / ميكرولتر) </td><td> 1 </td></tr><tr><td> اجمالى حجم (مع 1 الحادي رد فعل حبلا) </td><td> 80 </td></tr><tr><td> الخطوة 4.2: رد فعل Tagmentation </td><td></td></tr><tr><td> كاشف </td><td> الحجم (ميكرولتر) </td></tr><tr><td> Amplicon Tagment ميكس (ATM) </td><td> 1 </td></tr><tr><td> Tagment الحمض النووي العازلة (TD) </t<html> د&gt; <td> 5 </td></tr><tr><td> اجمالى حجم (مع كدنا]) </td><td> 10 </td></tr><tr><td> الخطوة 4.3: رد فعل مكتبة PCR </td><td></td></tr><tr><td> كاشف </td><td> الحجم (ميكرولتر) </td></tr><tr><td> PCR ميكس ماجستير (الآلية) </td><td> 7.5 </td></tr><tr><td> مؤشر 1 التمهيدي (i7 و) </td><td> 2.5 </td></tr><tr><td> مؤشر 2 التمهيدي (i5 و) </td><td> 2.5 </td></tr><tr><td> اجمالى حجم (مع tagmented كدنا]) </td><td> 25 </td></tr><tr><td> خطوة 4.3.2: شروط الاسترداد مكتبة </td><td></td></tr><tr><td> 72 ° C، 3 دقيقة </td><td></td></tr><tr><td> 95 ° C، 30 ثانية </td><td></td></tr><tr><td colspan="2"> ما يصل الى 18 دورات من 10 ثانية في 95 درجة مئوية، و 30 ثانية في 55 درجة مئوية، و 30 ثانية في 72 درجة مئوية </td></tr><tr><td> 72 ° C، 5 دقيقة </td><td></td></tr><tr><td> 10 ° C، إلى الأبد </td><td></td></tr></tbody></table>FO: المحافظة على together.within الصفحات = &quot;1&quot;&gt; الجدول 1: رد الفعل انشاء ومخازن خطوة بخطوة الجداول مع محتويات جميع المخازن ويمزج رد فعل. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always" style=";text-align:right;direction:rtl"><tbody><tr><td> اسم بنسبة ضئيلة </td><td> تسلسل (5 &#39;إلى 3&#39;) </td></tr><tr><td> ايبولا KGH مهاجم </td><td> GTCGTTCCAACAATCGAGCG </td></tr><tr><td> ايبولا KGH RV </td><td> CGTCCCGTAGCTTTRGCCAT </td></tr><tr><td> ايبولا KULESH مهاجم </td><td> TCTGACATGGATTACCACAAGATC </td></tr><tr><td> ايبولا KULESH RV </td><td> GGATGACTCTTTGCCGAACAATC </td></tr><tr><td> لاسا SL مهاجم </td><td> GTA AGC التقييم القطري المشترك GCD GYA AAB CC </td></tr><tr><td> لاسا SL RV </td><td> مجموعة الاهلي التقييم القطري المشترك CAG AAA RCT GGS AGC و </td></tr><tr><td> 18S الريباسي مهاجم </td><td> TCCTTTAACGAGGATCCATTGG </td></tr><tr><td> 18S الريباسي RV </td><td> CGAGCTTTTTAACTGCAGCAACT </td></tr></tbody></tقادرة&gt; الجدول 2: QRT-PCR الاشعال تسلسل الاشعال المستخدمة لقياس المضيف (18S الريباسي) والفيروسية المحتوى (ايبولا واسا). &quot;KGH &#39;هو مستشفى كينيما الحكومة في سيراليون، حيث تم اختبار الاشعال الايبولا 2. &quot;Kulesh &#39;هو المحقق الذي صمم التمهيدي تعيين 14. الجدول 3: الحمض النووي الريبي الريباسي (الرنا الريباسي) استنفاد Oligos 195 50 النوكليوتيدات تسلسل طويلة مكملة لالريباسي البشري لاستنزاف انتقائية الخطوة 6. <a href="https://www.jove.com/files/ftp_upload/54117/Table_3.xlsx" target="_blank">يرجى النقر هنا لتحميل هذا الملف.</a>

Watch this Scientific Journal Video about Unbiased Deep Sequencing of RNA Viruses from Clinical Samples at JoVE.com

Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

تسلسل عميق متحيز من الحمض النووي الريبي الفيروسات من العينات السريرية

Here we outline a next-generation RNA sequencing protocol that enables de novo assemblies and intra-host variant calls of viral genomes collected from ...

unbiased-deep-sequencing-of-rna-viruses-from-clinical-samples

Research

JoVE Journal

Medicine

16.8K Views.  Broad Institute of MIT and Harvard. This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

Video: Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

Using a Pan-Viral Microarray Assay (Virochip) to Screen Clinical Samples for Viral Pathogens

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence of novel viral pathogens, such as SARS coronavirus and 2009 pandemic H1N1 influenza virus, that are not detectable by traditional methods. To address these challenges, we have previously developed and validated a pan-viral microarray platform called the Virochip with the capacity to detect all known viruses as well as novel variants on the basis of conserved sequence homology1. Using the Virochip, we have identified the full spectrum of viruses associated with respiratory infections, including cases of unexplained critical illness in hospitalized patients, with a sensitivity equivalent to or superior to conventional clinical testing2-5. The Virochip has also been used to identify novel viruses, including the SARS coronavirus6,7, a novel rhinovirus clade5, XMRV (a retrovirus linked to prostate cancer)8, avian bornavirus (the cause of a wasting disease in parrots)9, and a novel cardiovirus in children with respiratory and diarrheal illness10. The current version of the Virochip has been ported to an Agilent microarray platform and consists of ~36,000 probes derived from over ~1,500 viruses in GenBank as of December of 2009. Here we demonstrate the steps involved in processing a Virochip assay from start to finish (~24 hour turnaround time), including sample nucleic acid extraction, PCR amplification using random primers, fluorescent dye incorporation, and microarray hybridization, scanning, and analysis.

Using a Pan-Viral Microarray Assay Virochip to Screen Clinical Samples for Viral Pathogens

The Virochip is a pan-viral microarray designed to simultaneously detect all known viruses as well as novel viruses on the basis of conserved sequence homology. Here we demonstrate how to run a Virochip assay to analyze clinical samples for the presence of both known and unknown viruses.

باستخدام الفحص ميكروأري عموم الفيروسي (Virochip) إلى الشاشة العينات السريرية لمسببات الأمراض الفيروسية

The diagnosis of viral causes of many infectious diseases is difficult due to the inherent sequence diversity of viruses as well as the ongoing emergence ...

Immunology and Infection

Amplifying and Quantifying HIV-1 RNA in HIV Infected Individuals with Viral Loads Below the Limit of Detection by Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below 50-75 copies/ml) is necessary to gain insight to viral dynamics and virus host interactions in patients who naturally control the infection and those who are on combination antiretroviral therapy (cART). 
Here we describe how to amplify viral genomes by single genome sequencing (the SGS protocol) 13, 19 and how to accurately quantify HIV-1 RNA in patients with low viral loads (the single-copy assay (SCA) protocol) 12, 20. 
The single-copy assay is a real-time PCR assay with sensitivity depending on the volume of plasma being assayed. If a single virus genome is detected in 7 ml of plasma, then the RNA copy number is reported to be 0.3 copies/ml. The assay has an internal control testing for the efficiency of RNA extraction, and controls for possible amplification from DNA or contamination. Patient samples are measured in triplicate.
The single-genome sequencing assay (SGS), now widely used and considered to be non-labor intensive 3, 7, 12, 14, 15,is a limiting dilution assay, in which endpoint diluted cDNA product is spread over a 96-well plate. According to a Poisson distribution, when less than 1/3 of the wells give product, there is an 80% chance of the PCR product being resultant of amplification from a single cDNA molecule. SGS has the advantage over cloning of not being subjected to resampling and not being biased by PCR-introduced recombination 19. However, the amplification success of SCA and SGS depend on primer design. Both assays were developed for HIV-1 subtype B, but can be adapted for other subtypes and other regions of the genome by changing primers, probes, and standards.

Quantifying levels of HIV-1 RNA in plasma and sequencing single HIV-1 genomes from individuals with viral loads below the limit of detection (50-75 copies/ml) is difficult. Here we describe how to extract and quantify plasma viral RNA using a real time PCR assay that reliably measures HIV-1 RNA down to 0.3 copies/ml and how to amplify viral genomes by single genome sequencing, from samples with very low viral loads.

تضخيم وقياس HIV - 1 الحمض النووي الريبي في الأفراد المصابين بالايدز مع الأحمال الفيروسية أقل من الحد كشفها بواسطة فحوصات السريرية القياسية

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below ...

High-throughput, Automated Extraction of DNA and RNA from Clinical Samples using TruTip Technology on Common Liquid Handling Robots

TruTip is a simple nucleic acid extraction technology whereby a porous, monolithic binding matrix is inserted into a pipette tip. The geometry of the monolith can be adapted for specific pipette tips ranging in volume from 1.0 to 5.0 ml. The large porosity of the monolith enables viscous or complex samples to readily pass through it with minimal fluidic backpressure. Bi-directional flow maximizes residence time between the monolith and sample, and enables large sample volumes to be processed within a single TruTip. The fundamental steps, irrespective of sample volume or TruTip geometry, include cell lysis, nucleic acid binding to the inner pores of the TruTip monolith, washing away unbound sample components and lysis buffers, and eluting purified and concentrated nucleic acids into an appropriate buffer. The attributes and adaptability of TruTip are demonstrated in three automated clinical sample processing protocols using an Eppendorf epMotion 5070, Hamilton STAR and STARplus liquid handling robots, including RNA isolation from nasopharyngeal aspirate, genomic DNA isolation from whole blood, and fetal DNA extraction and enrichment from large volumes of maternal plasma (respectively).

TruTip is a simple nucleic acid extraction technology whereby a porous, monolithic binding matrix is inserted into a pipette tip. Consequently, the sample preparation format is compatible with most liquid handling instruments, and can be used for many medium to high-throughput clinical applications and sample types.

عالية الإنتاجية، استخراج الآلي من DNA و RNA من العينات السريرية باستخدام تكنولوجيا TruTip على الروبوتات مناولة السائل المشترك

TruTip is a simple nucleic acid extraction  technology whereby a porous, monolithic binding matrix is inserted into a  pipette tip. The geometry of the ...

Bioengineering

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, and was deployed to West Africa during the recent Ebola virus epidemic, highlighting this possibility. In addition to its practical advantages (low cost, ease of equipment transport and use), this technology also provides fundamental advantages over second-generation sequencing approaches, particularly the very long read length, ability to directly sequence RNA, and real-time availability of data. Raw read accuracy is lower than with other sequencing platforms, which represents the main limitation of this technology; however, this can be partially mitigated by the high read depth generated. Here, we present a field-compatible protocol for sequencing of the mRNAs encoding for Niemann-Pick C1, which is the cellular receptor for ebolaviruses. This protocol encompasses extraction of RNA from animal blood samples, followed by RT-PCR for target enrichment, barcoding, library preparation, and the sequencing run itself, and can be easily adapted for use with other DNA or RNA targets.

Nanopore sequencing is a novel technology that allows cost-effective sequencing in remote locations and resource-poor settings. Here, we present a protocol for sequencing of mRNAs from whole blood that is compatible with such conditions.

تسلسل mRNA من الدم الكامل باستخدام التسلسل نانو

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...

Genetics

Validating Whole Genome Nanopore Sequencing, using Usutu Virus as an Example

Whole genome sequencing can be used to characterize and to trace viral outbreaks. Nanopore-based whole genome sequencing protocols have been described for several different viruses. These approaches utilize an overlapping amplicon-based approach which can be used to target a specific virus or group of genetically related viruses. In addition to confirmation of the virus presence, sequencing can be used for genomic epidemiology studies, to track viruses and unravel origins, reservoirs and modes of transmission. For such applications, it is crucial to understand possible effects of the error rate associated with the platform used. Routine application in clinical and public health settings require that this is documented with every important change in the protocol. Previously, a protocol for whole genome Usutu virus sequencing on the nanopore sequencing platform was validated (R9.4 flowcell) by direct comparison to Illumina sequencing. Here, we describe the method used to determine the required read coverage, using the comparison between the R10 flow cell and Illumina sequencing as an example.

We previously validated a protocol for amplicon-based whole genome Usutu virus (USUV) sequencing on a nanopore sequencing platform. Here, we describe the methods used in more detail and determine the error rate of the nanopore R10 flow cell.

التحقق من صحة تسلسل الجينوم كله نانوبور، وذلك باستخدام فيروس Usutu كمثال

Whole genome sequencing can be used to characterize and to trace viral outbreaks. Nanopore-based whole genome sequencing protocols have been described for ...

Quantification and Whole Genome Characterization of SARS-CoV-2 RNA in Wastewater and Air Samples

Wastewater-based epidemiology has emerged as a promising and efficacious surveillance system for SARS-CoV-2 and other infectious diseases in many nations. The process typically involves wastewater concentration, nucleic acid extraction, amplification of selected genomic segments, and detection and quantification of the amplified genomic segment. This methodology can similarly be leveraged to detect and quantify infectious agents, such as SARS-CoV-2, in air samples. Initially, SARS-CoV-2 was presumed to spread primarily through close personal contact with droplets generated by an infected individual while speaking, sneezing, coughing, singing, or breathing. However, a growing number of studies have reported the presence of SARS-CoV-2 RNA in the air of healthcare facilities, establishing airborne transmission as a viable route for the virus. This study presents a composite of established protocols to facilitate environmental detection, quantification, and sequencing of viruses from both wastewater and air samples.

This protocol aims to quantify SARS-CoV-2 RNA in wastewater and air samples to be used for wastewater-based epidemiology studies and to assess the exposure risk to SARS-CoV-2 in indoor and outdoor aerosols. This protocol also describes a tiled amplicon long-template sequencing approach for SARS-CoV-2 whole genome characterization.

القياس الكمي وتوصيف الجينوم الكامل للحمض النووي الريبي SARS-CoV-2 في عينات مياه الصرف الصحي والهواء

Wastewater-based epidemiology has emerged as a promising and efficacious surveillance system for SARS-CoV-2 and other infectious diseases in many nations. ...

Environment

تحليل ديناميكيات الحمض النووي الريبوزي الناقل (tRNA) باستخدام AQRNA-seq

AQRNA-seq for Quantifying Small RNAs

AQRNA-seq provides a direct linear relationship between sequencing read counts and small RNA copy numbers in a biological sample, thus enabling accurate quantification of the pool of small RNAs. The AQRNA-seq library preparation procedure described here involves the use of custom-designed sequencing linkers and a step for reducing methylation RNA modifications that block reverse transcription processivity, which results in an increased yield of full-length cDNAs. In addition, a detailed implementation of the accompanying bioinformatics pipeline is presented. This demonstration of AQRNA-seq was conducted through a quantitative analysis of the 45 tRNAs in Mycobacterium bovis BCG harvested on 5 selected days across a 20-day time course of nutrient deprivation and 6 days of resuscitation. Ongoing efforts to improve the efficiency and rigor of AQRNA-seq will also be discussed here. This includes exploring methods to obviate gel purification for mitigating primer dimer issues after PCR amplification and to increase the proportion of full-length reads to enable more accurate read mapping. Future enhancements to AQRNA-seq will be focused on facilitating automation and high-throughput implementation of this technology for quantifying all small RNA species in cell and tissue samples from diverse organisms.

تسليط الضوء على المؤلف: دور AQRNA-seq في رسم خرائط الحمض النووي الريبي الصغير وكشف آليات ترجمة البروتين

Absolute quantification RNA sequencing (AQRNA-seq) is a technology developed to quantify the landscape of all small RNAs in biological mixtures. Here, both the library preparation and data processing steps of AQRNA-seq are demonstrated, quantifying changes in the transfer RNA (tRNA) pool in Mycobacterium bovis BCG during starvation-induced dormancy.

AQRNA-seq لقياس كمية الحمض النووي الريبي الصغير

AQRNA-seq provides a direct linear relationship between sequencing read counts and small RNA copy numbers in a biological sample, thus enabling accurate ...

High-throughput Detection of Respiratory Pathogens in Animal Specimens by Nanoscale PCR

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of combining reactions together. We designed and evaluated a panel based on this principle to rapidly identify the presence of common disease agents in dogs and horses with acute respiratory illness. This manuscript describes a nanoscale diagnostic PCR workflow for sample preparation, amplification, and analysis of target pathogen sequences, focusing on procedures that are different from microliter scale reactions. In the respiratory panel presented, 18 assays were each set up in triplicate, accommodating up to 48 samples per plate. A universal extraction and pre-amplification workflow was optimized for high-throughput sample preparation to accommodate multiple matrices and DNA and RNA based pathogens. Representative data are presented for one RNA target (influenza A matrix) and one DNA target (equine herpesvirus 1). The ability to quickly and accurately test for a comprehensive, syndrome-based group of pathogens is a valuable tool for improving efficiency and ergonomics of diagnostic testing and for acute respiratory disease diagnosis and management.

High-throughput testing of DNA and RNA based pathogens by nanoscale PCR is described using a syndromic canine and equine respiratory PCR panel.

كشف الإنتاجية العالية للجهاز التنفسي مسببات الأمراض في العينات الحيوانية التي كتبها النانو PCR

Nanoliter scale real-time PCR uses spatial multiplexing to allow multiple assays to be run in parallel on a single plate without the typical drawbacks of ...

تسلسل عميق متحيز من الحمض النووي الريبي الفيروسات من العينات السريرية

Summary

Explore More Videos

PLAYLIST