This work has been funded in part with Federal funds from the National Institutes of Health, Office of Director, Innovator (No.: DP2OD06514) (PCS) and from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, Department of Health and Human Services, under Contracts (No:HHSN272200900018C, HHSN272200900049C and U19AI110818).

Ethics statement: Lassa fever patients were recruited for this study using protocols approved by human subjects committees at Tulane University, Harvard University, Broad Institute, Irrua Specialist Teaching Hospital (ISTH), Kenema Government Hospital (KGH), Oyo State Ministry of Health, Ibadan, Nigeria and Sierra Leone Ministry of Health. All patients were treated with a similar standard of care and were offered the drug Ribavirin, whether or not they decided to participate in the study. For Lassa fever (LF) patients, treatment with Ribavirin followed the currently recommended guidelines and was generally offered as soon as LF was strongly suspected.
Due to the severe outbreak for Ebola Virus Disease (EVD), patients could not be consented through our standard protocols. Instead use of clinical excess samples from EVD patients was evaluated and approved by Institutional Review Boards in Sierra Leone and at Harvard University. The Office of the Sierra Leone Ethics and Scientific Review Committee, the Sierra Leone Ministry of Health and Sanitation, and the Harvard Committee on the Use of Human Subjects have granted a waiver of consent to sequence and make publically available viral sequences obtained from patient and contact samples collected during the Ebola outbreak in Sierra Leone. These bodies also granted use of clinical and epidemiological data for de-identified samples collected from all suspected EVD patients receiving care during the outbreak response. The Sierra Leone Ministry of Health and Sanitation also approved shipments of non-infectious, non-biological samples from Sierra Leone to the Broad Institute and Harvard University for genomic studies of outbreak samples.
1. DNase-treatment of Sample RNA (Up to 55 &#181;l&#160;Extracted Total RNA, ~4 hr)
<ol>
	<li>Set up the DNase reaction in a 96-well PCR plate on ice in a biosafety cabinet as described in Table 1, Step 1.1 (total volume, 70 &#181;l/well). Note: A master mix can be prepared.</li>
	<li>Vortex gently and thoroughly, then centrifuge at 280 x g at RT for 1 min.</li>
	<li>Incubate at 37 &#176;C for 30 min.</li>
	<li>Cleanup using RNA Solid Phase Reversible Immobilization (SPRI) beads.
	<ol>
		<li>Warm RNA beads to RT for 30 min.</li>
		<li>Gently shake RNA beads bottle to resuspend any magnetic particles that may have settled. Add 1.8x volume (126 &#181;l) of RNA beads to DNase-treated RNA (70 &#181;l), mix by pipette 10 times and incubate for 5 min at RT&#160;(total volume in well, 196 &#181;l).</li>
		<li>Place mixture on the magnetic station. Wait for the solution to clear (5 - 10 min).</li>
		<li>Remove cleared solution while on the station by pipette and discard. While on station, wash beads by covering pellet with 70% ethanol and incubate for 1 min. Remove ethanol with pipette and discard. Repeat for a total of two washes. 
		Note: Using precisely 70% freshly prepared ethanol is critical, as a higher percentage will result in inefficient washing of smaller-sized molecules, whereas &#60;70% ethanol could cause loss of sample7.</li>
		<li>Keep plate on the station and leave open to air-dry. Note: Be sure to allow the beads to dry completely until beads begin to crack.</li>
		<li>Add 55 &#181;l&#160;of nuclease-free water to the plate to elute RNA. Remove plate from the station to mix the beads and water by pipetting thoroughly. Note: Alternatively, use less water (&#8804; 10 &#181;l) in order to concentrate the total RNA.</li>
		<li>Place plate back on the station. Wait until solution clears to transfer by pipette to new screw-cap tube for long-term storage (-80&#160;&#176;C). Place 5 &#181;l&#160;RNA in new 96-well PCR plate for depletion (step. 2.4).</li>
		<li>Optional: Save and dilute 1 &#181;l&#160;in 19 &#181;l&#160;water (1:20) for qRT-PCR of rRNA (e.g., 18S, 28S rRNA) (Table 2) and viral markers5.</li>
	</ol>
	</li>
</ol>
2. Selective Depletion of Ribosomal and Carrier RNA from Viral RNA Sample (~4 hr)
<ol>
	<li>Make 5x hybridization and 10x RNase H reaction buffers, and nuclease-free water with linear acrylamide carrier as described in Table 1.</li>
	<li>Set up hybridization reaction by combining RNA with rRNA depletion oligos (Table 3) and oligo(dT) on ice in a 96-well PCR plate as described in Table 1. 
	Note: A master mix can be prepared. 50 femtograms (fg) of a unique synthetic RNA (ERCCs8) can be added for tracking both the viral sequencing process and potential index read cross-contamination.
	<ol>
		<li>Vortex gently and thoroughly, then centrifuge at 280 x g at RT&#160;for 1 min. 
		Incubate at 95 &#176;C for 2 min, slow ramping to 45 &#176;C at -0.1 &#176;C per sec. Pause the thermocycler at 45 &#176;C.</li>
	</ol>
	</li>
	<li>Set up RNase H reaction mix on ice as described in Table 1, then preheat at 45 &#176;C for 2 min. Note: A master mix can be prepared.
	<ol>
		<li>Add the pre-heated RNase H mix to the hybridization reaction in plate while keeping the plate in the thermocycler at 45 &#176;C.</li>
		<li>Mix well by gentle pipetting 6 - 8 times. Incubate at 45 &#176;C for another 30 min. Place on ice.</li>
	</ol>
	</li>
	<li>Set up the DNase reaction mix on ice as described in Table 1. Note: A master mix can be prepared.
	<ol>
		<li>Add to the RNase H reaction in plate, vortex gently and thoroughly, then centrifuge at 280 x g at RT for 1 min. Incubate at 37 &#176;C for 30 min.</li>
		<li>Stop DNase reaction by adding 5 &#181;l&#160;0.5 M EDTA. Vortex gently and thoroughly, then centrifuge at 280 x g at RT&#160;for 1 min.</li>
	</ol>
	</li>
	<li>Cleanup using RNA beads (see step 1.3) using a 1.8x volume (144 &#181;l) beads. Elute in 11 &#181;l&#160;of nuclease-free water. Note: For safe cold storage, store depleted RNA samples at -80 &#176;C&#160;O/N.</li>
</ol>
3. cDNA Synthesis (~6 hr)
<ol>
	<li>Mix rRNA/carrier-depleted RNA with random primers on ice in a 96-well PCR plate as described in Table 1, vortex gently and thoroughly, then centrifuge at 280 x g at RT for 1 min.
	<ol>
		<li>Heat the mixture to 70 &#176;C for 10 min in a thermocycler. Immediately after heat denaturation, place the RNA on ice for 1 - 5 min. Do not allow the RNA to stand (even on ice) for longer than 5 min prior to the first-strand reaction.</li>
	</ol>
	</li>
	<li>Set up first-strand synthesis reaction mix on ice as described in Table 1. 
	Note: A master-mix may be prepared.
	<ol>
		<li>Add to RNA/random primer mix in plate, vortex gently and thoroughly, then centrifuge at 280 x g at RT&#160;for 1 min. Incubate at 22 - 25 &#176;C for 10 min.</li>
		<li>Incubate at 55 &#176;C in an air incubator for 60 min. Place the plate on ice to terminate the reaction. Note: The use of an air incubator is recommended to create gradual warming of the first-strand reaction during which the primers anneal and the first strand begins to elongate.</li>
	</ol>
	</li>
	<li>Set up second-strand synthesis reaction mix on ice as described in Table 1. 
	Note: A master-mix may be prepared.
	<ol>
		<li>Add to the first-strand synthesis reaction in the&#160;plate, vortex gently and thoroughly, then centrifuge at 280 x g at RT for 1 min. Incubate for 2 hr at 16 &#176;C (keep lid at 25 &#176;C). Do not allow the temperature to rise above 16 &#176;C.</li>
		<li>Place the plate on ice, then inactivate reaction by adding 5 &#181;l&#160;of 0.5 M EDTA, mix gently and thoroughly, then centrifuge at 280 x g at RT for 1 min.</li>
	</ol>
	</li>
	<li>Cleanup with DNA beads (see step 1.3 for protocol) using 1.8x volume (153 &#181;l) of beads. Elute in 9 &#181;l&#160;of elution buffer (EB). Save 1 &#181;l&#160;for quantification. Use 1 ng of cDNA for subsequent steps. If cDNA concentration is too low to detect, use 4 &#181;l&#160;of cDNA for tagmentation (see step 4.1).</li>
	<li>For safe cold storage, store double-stranded cDNA at 4 &#176;C O/N or -20 &#176;C for long-term storage.</li>
</ol>
4. Library Preparation &#8212; DNA Library Construction (~4 hr)
<ol>
	<li>Transfer 4 &#181;l&#160;of cDNA to a 96-well plate and save the remaining cDNA for a second attempt if needed.</li>
	<li>Set up the tagmentation reaction on ice as described in Table 1. 
	Note: A master-mix may be prepared. To reduce background and overall cost, the total volume of the tagmentation reaction is reduced from 20 to 10 &#181;l. As cDNA is the limiting factor, the amount of ATM (i.e.,&#160;transposome) used in the reaction is also reduced to decrease the number of integration sites.
	<ol>
		<li>Add tagmentation mix to cDNA in the plate, vortex gently and thoroughly and centrifuge at 280 x g (at RT) for 1 min. Incubate at 55 &#176;C for 5 min, hold at 10 &#176;C.</li>
		<li>Once at 10 &#176;C, immediately add 2.5 &#181;l&#160;of Neutralize Tagment Buffer (NT) to end the reaction. Mix by pipetting up and down, then centrifuge at 280 x g (at RT) for 1 min.</li>
		<li>Incubate at RT for 5 min.</li>
	</ol>
	</li>
	<li>Set up PCR amplification reaction on ice as described in Table 1.
	<ol>
		<li>Vortex gently and thoroughly, then centrifuge at 280 x g at RT&#160;for 1 min.</li>
		<li>Perform PCR on thermocycler using the conditions described in Table 1. 
		Note: 12 cycles of PCR are suggested for 1 ng of tagmented cDNA; however, viral clinical samples often have undetectable amounts of cDNA. For low amounts of cDNA (&#60;1 ng), use up to 18 cycles of PCR to create enough library for sequencing.</li>
	</ol>
	</li>
	<li>Library preparation &#8212; cleanup and pooling for sequencing
	<ol>
		<li>Bring sample up to 50 &#181;l&#160;with EB.</li>
		<li>Cleanup with DNA beads (see step 1.3 for protocol) using 0.6x volume (30 &#181;l) beads. Elute in 15 &#181;l&#160;EB.</li>
		<li>Determine concentration of library (Figure 3) by conducting region analysis (150 to 1,000 bp) using bioanalyzer software9, excluding primer dimers (~120 bp) from region analysis. Note: Alternatively, qPCR can be used to quantify libraries 10.</li>
		<li>Pool libraries at the lowest molar concentration of 1 nM or greater. If library is below 1 nM, add a small volume of library to pool (~1x volume of other libraries) to capture sequence information from these libraries.</li>
		<li>Cleanup pool with 0.7x DNA beads as outlined above (see step 2). Elute in 15 &#181;l&#160;EB. Note: Volume of beads will depend on the final volume of the pool.</li>
		<li>Analyze pool9. Determine molar concentration by conducting region analysis (150 to 1,000 bp)9. Note: Alternatively, qPCR can be used to quantify library pool 10.</li>
		<li>Load sequencer at 10 pM library concentration to generate 101 bp, paired-end reads with dual barcode reads11.</li>
	</ol>
	</li>
</ol>
<img alt="Figure 3" src="/files/ftp_upload/54117/54117fig3.jpg" /> 
Figure 3. Libraries Constructed from Ebola Virus Clinical Samples. Gel image of 4 representative Ebola virus (EBOV) libraries. Regions of library and primer dimers are shown. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

<ol>
	<li>Stremlau, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discovery+of+novel+rhabdoviruses+in+the+blood+of+healthy+individuals+from+West+Africa.">Discovery of novel rhabdoviruses in the blood of healthy individuals from West Africa.</a> PLoS Negl Trop Dis. 9, e0003631 (2015).</li><li>Gire, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+surveillance+elucidates+Ebola+virus+origin+and+transmission+during+the+2014+outbreak.">Genomic surveillance elucidates Ebola virus origin and transmission during the 2014 outbreak.</a> Science. 345, 1369-1372 (2014).</li><li>Morlan, J. D., Qu, K., Sinicropi, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+depletion+of+rRNA+enables+whole+transcriptome+profiling+of+archival+fixed+tissue.">Selective depletion of rRNA enables whole transcriptome profiling of archival fixed tissue.</a> PLoS One. 7, e42882 (2012).</li><li>Park, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ebola+Virus+Epidemiology,+Transmission,+and+Evolution+during+Seven+Months+in+Sierra+Leone.">Ebola Virus Epidemiology, Transmission, and Evolution during Seven Months in Sierra Leone.</a> Cell. 161, 1516-1526 (2015).</li><li>Andersen, K. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clinical+Sequencing+Uncovers+Origins+and+Evolution+of+Lassa+Virus.">Clinical Sequencing Uncovers Origins and Evolution of Lassa Virus.</a> Cell. 162, 738-750 (2015).</li><li>Matranga, C. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhanced+methods+for+unbiased+deep+sequencing+of+Lassa+and+Ebola+RNA+viruses+from+clinical+and+biological+samples.">Enhanced methods for unbiased deep sequencing of Lassa and Ebola RNA viruses from clinical and biological samples.</a> Genome Biol. 15, 519 (2014).</li><li>Tang, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA-Seq+analysis+to+capture+the+transcriptome+landscape+of+a+single+cell.">RNA-Seq analysis to capture the transcriptome landscape of a single cell.</a> Nat Protoc. 5, 516-535 (2010).</li><li>Jiang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+spike-in+standards+for+RNA-seq+experiments.">Synthetic spike-in standards for RNA-seq experiments.</a> Genome Res. 21, 1543-1551 (2011).</li><li>. Kapa Biosystems Available from: <a target="_blank" href="https://www.kapabiosystems.com/product-applications/products/next-generation-sequencing-2/library-quantification/">https://www.kapabiosystems.com/product-applications/products/next-generation-sequencing-2/library-quantification/</a> (2015)</li><li>. Illumina Technologies Available from: <a target="_blank" href="https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/preparing-libraries-for-sequencing-on-miseq-15039740-d.pdf">https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/preparing-libraries-for-sequencing-on-miseq-15039740-d.pdf</a> (2015)</li><li>Kircher, M., Sawyer, S., Meyer, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double+indexing+overcomes+inaccuracies+in+multiplex+sequencing+on+the+Illumina+platform.">Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform.</a> Nucleic Acids Res. 40, 3 (2012).</li><li>Trombley, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comprehensive+panel+of+real-time+TaqMan+polymerase+chain+reaction+assays+for+detection+and+absolute+quantification+of+filoviruses,+arenaviruses,+and+New+World+hantaviruses.">Comprehensive panel of real-time TaqMan polymerase chain reaction assays for detection and absolute quantification of filoviruses, arenaviruses, and New World hantaviruses.</a> Am J Trop Med Hyg. 82, 954-960 (2010).</li><li>Hu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serial+high-resolution+analysis+of+blood+virome+and+host+cytokines+expression+profile+of+a+patient+with+fatal+H7N9+infection+by+massively+parallel+RNA+sequencing.">Serial high-resolution analysis of blood virome and host cytokines expression profile of a patient with fatal H7N9 infection by massively parallel RNA sequencing.</a> Clin Microbiol Infect. 21, 713 (2015).</li><li>Simon-Loriere, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+lineages+of+Ebola+virus+in+Guinea+during+the+2014+West+African+epidemic.">Distinct lineages of Ebola virus in Guinea during the 2014 West African epidemic.</a> Nature. 524, 102-104 (2015).</li><li>Folarin, O. A., Happi, A. N., Happi, C. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Empowering+African+genomics+for+infectious+disease+control.">Empowering African genomics for infectious disease control.</a> Genome Biol. 15, 515 (2014).</li><li>Blainey, P. C., Quake, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Digital+MDA+for+enumeration+of+total+nucleic+acid+contamination.">Digital MDA for enumeration of total nucleic acid contamination.</a> Nucleic Acids Res. 39, 19 (2011).</li><li>Malboeuf, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complete+viral+RNA+genome+sequencing+of+ultra-low+copy+samples+by+sequence-independent+amplification.">Complete viral RNA genome sequencing of ultra-low copy samples by sequence-independent amplification.</a> Nucleic Acids Res. 41, 13 (2013).</li><li>Gonzalez, I. L., Sylvester, J. E., Smith, T. F., Stambolian, D., Schmickel, R. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosomal+RNA+gene+sequences+and+hominoid+phylogeny.">Ribosomal RNA gene sequences and hominoid phylogeny.</a> Mol Biol Evol. 7, 203-219 (1990).</li><li>Adiconis, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+analysis+of+RNA+sequencing+methods+for+degraded+or+low-input+samples.">Comparative analysis of RNA sequencing methods for degraded or low-input samples.</a> Nat Methods. 10, 623-629 (2013).</li></ol>

The authors have no competing financial interests.

The outlined approach enables robust, universal, rapid sequencing and was used for sequencing Ebola virus during the 2014 outbreak2,4. By coupling selective depletion and cDNA synthesis with tagmentation library construction, the overall process time was reduced by ~2 days from previous adapter ligation methods. More recently, this protocol was employed by international collaborators and others with great success15,16 and will be deployed to labs in West Africa to support local genomics-based research studies and diagnostics17.
The protocol described here uses random primers to prepare cDNA for viral RNA-seq libraries. Unlike previous viral RNA-seq approaches, it requires no a priori knowledge of sequence data or elaborate and time-consuming primer design for a specific virus or clade. The method can be applied to any viral RNA sample. For example, it was used to generate viral content from both Ebola and Lassa samples6. The protocol may also be used for host transcriptomic, metagenomic and pathogen discovery sequencing projects 1.
A critical step of the protocol is targeted RNase H digestion, a high-throughput, low cost method for removing unwanted carrier and host RNA from viral samples. The selective depletion step of the protocol uses many components and requires skill and accuracy. Extra time and care should be taken during the initial setup.
As most clinical serum and plasma samples often have very little nucleic acid material, contamination and sample loss are common. To avoid these issues, special care should be taken when using this protocol. First, RNA is highly susceptible to degradation; therefore all areas should be clean and free of nucleases. Second, to identify samples suitable for use in this protocol, qRT-PCR assays for both host RNA and virus should be used for quantification5,6. When comparing input amounts with sequencing results from the protocol, sequencing success (i.e.,&#160;generation of sufficient data for full viral assembly) correlated with samples that contained at least 100 pg total RNA and 1,000 copies of virus. Third, exposure to environmental sources of nucleic acids should be avoided. The protocol outlined here is done in a biosafety cabinet for safety precautions and for limiting environmental contaminants. Moreover, our group and others have noticed that commercial enzymes may be another source of contaminating bacterial nucleic acids in low input samples6,18. Use of a clean workspace (e.g., PCR hood, biosafety cabinet) and negative controls (e.g., water or buffer) will help alleviate and track contamination, respectively. For samples with &#60;100 pg of total RNA, only poly(rA) carrier RNA, not rRNA, should be depleted to ensure high quality sequencing results while limiting loss of material. For very low input samples, cDNA-amplification methods may be more suitable19, although poly(rA) carrier should be removed prior to the cDNA synthesis.
The depletion of host rRNA enriches for viral content in sequencing libraries and is applicable to different sample collections including serum or plasma, and multiple types of tissues from rodents and non-human primates5,6. In non-human organisms, reads aligning to 28S rRNA remained after depletion, suggesting 28S rRNA is less conserved between humans and other species6,20. When using this method with non-human isolates, it may be necessary to supplement with DNA oligos complementary to the divergent rRNA sequences of the specific host 3,21.
Since the protocol is unbiased, viral reads may represent only a small fraction of total library content. Although rRNA is the most abundant species of host RNA and only a small percentage of rRNA reads (&#60;1%) are found after selective depletion, all other host RNA (e.g., mRNA) will remain after depletion and may account for many sequencing reads from the sample. Therefore &#34;oversampling&#34; (i.e., oversequencing) individual libraries is required in order to have enough coverage for viral assembly and variant calls. For our studies, we attempt to sequence ~20 million reads per sample to have enough depth for analysis of viral genomic and associated variants as well as metagenomic content2,5. For metagenomic and pathogen discovery studies, it is important to note that contaminating host DNA is removed by DNase digestion. Therefore viruses and other pathogens that contain DNA genomes may be lost during the process, however RNA intermediates may still be sequenced.

Next generation sequencing of viruses from clinical sources can inform transmission and the epidemiology of infections, as well as help support novel diagnostic, vaccine and therapeutic development. cDNA synthesis using random primers has allowed the detection and assembly of genomes from divergent, co-infecting or even novel viruses1,2. As with other unbiased methods, unwanted contaminants occupy many sequencing reads and negatively impact sequencing results. Host and poly(rA) carrier RNA are contaminants present in many existing viral sample collections.
The protocol describes an efficient and cost-effective way of deep sequencing RNA virus genomes based on unbiased total RNA-seq. The method utilizes an RNase H selective depletion step3 to remove unwanted host ribosomal and carrier RNA. Selective depletion enriches for viral content (Figure 1) and improves the overall quality of sequencing data (Figure 2) from clinical samples. Moreover, tagmentation is applied to the protocol as it significantly reduces library construction time. These methods have been used to rapidly generate large datasets of Ebola and Lassa virus genomes2,4,5 and can be used to study a wide range of RNA viruses. Lastly, the approach is not limited to human samples; the utility of selective depletion was demonstrated on tissue samples collected from Lassa-infected rodents and non-human primate disease models5,6.
<img alt="Figure 1" src="/files/ftp_upload/54117/54117fig1.jpg" /> 
Figure 1. Total RNA Content Reflects Enrichment of Lassa Virus Content Using Selective Depletion. Starting overall content (RNA input) and enrichment of unique Lassa virus (LASV) reads (Library content) upon rRNA depletion from nine different clinical isolates. This figure has been modified from6. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/54117/54117fig2.jpg" /> 
Figure 2. Higher Quality Sequencing After Carrier RNA Depletion. Median base qualities per sequencing cycle of poly(rA)-contaminated Lassa virus libraries (red) and control (no carrier observed in library, black) from QC report 13. Both read 1 and read 2 of paired end reads are merged in the library BAM file and the quality scores are shown at each base. This figure has been modified from6. <a href="https://www.jove.com/files/ftp_upload/54117/54117fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
The viral RNA-seq protocol details construction of libraries directly from extracted RNA collected from clinical and biological samples. To ensure personal safety, all viral serum, plasma and tissue samples should be inactivated in appropriate buffers prior to RNA extraction. In some inactivation and extraction kits, carrier poly(rA) RNA is included; this will be removed during the initial RNase H selective depletion step. Based on complete recovery, the expected concentration of carrier RNA is 100 ng/&#181;l. In the protocol, 110 ng/&#181;l&#160;oligo dT RNA (1.1x carrier concentration) is used for depletion. If poly(rA) carrier is not present in the sample, then oligo(dT) should not be added prior to depletion.
The following protocol is designed for 24 reactions in PCR plate format (up to 250 &#181;l&#160;volume). An earlier version of this protocol was reported in Matranga, et al.6.

<table border="0" cellpadding="0" cellspacing="0" width="965">
	<tbody>
		<tr height="30">
			<td height="30" style="height:31px;width:376px;">96-Well PCR Plates</td>
			<td style="width:183px;">VWR</td>
			<td style="width:119px;">47743-953</td>
			<td style="width:289px;"></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Strips of Eight Caps</td>
			<td>VWR</td>
			<td>47745-512</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Nuclease-free water</td>
			<td>Ambion</td>
			<td>AM9937</td>
			<td>50 ml bottle</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">TURBO DNase&#160;</td>
			<td>Ambion</td>
			<td>AM2238</td>
			<td>post RNA extraction step, 2 U/&#181;L, buffer included</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">PCR cycler</td>
			<td></td>
			<td></td>
			<td>any PCR cyclers&#160;</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Agencourt RNAClean XP SPRI beads&#160;</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63987</td>
			<td>beads for RNA cleanup</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Real Time qPCR system</td>
			<td></td>
			<td></td>
			<td>any system</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">DynaMag-96 Side Skirted Magnet</td>
			<td>Invitrogen</td>
			<td>12027</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">70% Ethanol</td>
			<td></td>
			<td></td>
			<td>prepare fresh</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">qRT-PCR primers</td>
			<td>IDT DNA</td>
			<td></td>
			<td>see Table 2</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">5M NaCl&#160;</td>
			<td>Ambion</td>
			<td>AM9760G</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">1M Tris-HCl pH 7.4&#160;</td>
			<td>Sigma</td>
			<td>T2663-1L</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">1M Tris-HCl pH 7.5&#160;</td>
			<td>Invitrogen</td>
			<td>15567-027</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">1M MgCl2&#160;</td>
			<td>Ambion</td>
			<td>AM9530G</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Linear acrylamide&#160;</td>
			<td>Ambion&#160;</td>
			<td>AM9520</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">DNA oligos covering entire rRNA region</td>
			<td>IDT DNA</td>
			<td></td>
			<td>see Table 3, order lab-ready at 100 &#181;M</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Oligo (dT)</td>
			<td>IDT DNA</td>
			<td></td>
			<td>40 nt long, desalted</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Hybridase Thermostable RNase H&#160;</td>
			<td>Epicentre</td>
			<td>H39100</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">RNase-free DNase Kit&#160;</td>
			<td>Qiagen</td>
			<td>79254</td>
			<td>post selective depletion step</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">SUPERase-In RNase Inhibitor</td>
			<td>Ambion</td>
			<td>AM2694</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Random Primers&#160;</td>
			<td>Invitrogen</td>
			<td>48190-011</td>
			<td>mostly hexamers</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">10 mM dNTP mix</td>
			<td>New England Biolabs</td>
			<td>N0447L</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">SuperScript III Reverse Transcriptase&#160;</td>
			<td>Invitrogen</td>
			<td>18080-093</td>
			<td>with first-strand buffer, DTT</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Air Incubator</td>
			<td></td>
			<td></td>
			<td>any air incubator cyclers&#160;</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">NEBNext Second Strand Synthesis (dNTP-free) Reaction Buffer</td>
			<td>New England Biolabs</td>
			<td>B6117S</td>
			<td>10x</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">E. coli DNA Ligase&#160;</td>
			<td>New England Biolabs</td>
			<td>M0205L</td>
			<td>10 U/&#956;l</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">E. coli DNA Polymerase I&#160;</td>
			<td>New England Biolabs</td>
			<td>M0209L</td>
			<td>10 U/&#956;l</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">E. coli RNase H&#160;</td>
			<td>New England Biolabs</td>
			<td>M0297L</td>
			<td>2 U/&#956;l</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">0.5M EDTA</td>
			<td>Ambion</td>
			<td>AM9261</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Agencourt AMPure XP SPRI beads</td>
			<td>Beckman Coulter Genomics</td>
			<td>A63881</td>
			<td>beads for DNA cleanup</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Elution Buffer&#160;</td>
			<td>Qiagen</td>
			<td></td>
			<td>10 mM Tris HCl, pH 8.5</td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Quant-iT dsDNA HS Assay Kit&#160;</td>
			<td>Invitrogen</td>
			<td>Q32854</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Qubit fluorometer&#160;</td>
			<td>Invitrogen</td>
			<td>Q32857</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Nextera XT DNA Sample Prep Kit&#160;</td>
			<td>Illumina</td>
			<td>FC-131-1096</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Nextera XT DNA Index Kit&#160;</td>
			<td>Illumina</td>
			<td>FC-131-1001</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Tapestation 2200</td>
			<td>Agilent</td>
			<td>G2965AA</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">High Sensitivity D1000 reagents</td>
			<td>Agilent</td>
			<td>5067-5585</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">High Sensitivity D1000 ScreenTape</td>
			<td>Agilent</td>
			<td>5067-5584</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">BioAnalyzer 2100&#160;</td>
			<td>Agilent</td>
			<td>G2939AA</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">High Sensitivity DNA reagents</td>
			<td>Agilent</td>
			<td>5067-4626</td>
			<td></td>
		</tr>
		<tr height="30">
			<td height="30" style="height:31px;">Library Quantification Complete kit (Universal)</td>
			<td>Kapa Biosystems</td>
			<td>KK4824</td>
			<td>alternative to tapestation, bioanalyzer for library quantification</td>
		</tr>
	</tbody>
</table>

unbiased deep sequencing of rna viruses from clinical samples

Here we outline a next-generation RNA sequencing protocol that enables de novo assemblies and intra-host variant calls of viral genomes collected from clinical and biological sources. The method is unbiased and universal; it uses random primers for cDNA synthesis and requires no prior knowledge of the viral sequence content. Before library construction, selective RNase H-based digestion is used to deplete unwanted RNA &#8212; including poly(rA) carrier and ribosomal RNA &#8212; from the viral RNA sample. Selective depletion improves both the data quality and the number of unique reads in viral RNA sequencing libraries. Moreover, a transposase-based &#39;tagmentation&#39; step is used in the protocol as it reduces overall library construction time. The protocol has enabled rapid deep sequencing of over 600 Lassa and Ebola virus samples-including collections from both blood and tissue isolates-and is broadly applicable to other microbial genomics studies.

The described protocol enables the generation of high quality sequencing reads from low-input viral RNA samples while enriching for unique viral content. As shown in Figure 1, the protocol enriched unique Lassa virus content at least five-fold in all samples (compared to non-depleted controls) with at least one million copies of 18S rRNA (~100 pg total RNA). Likewise, sequencing success also correlated with the amount of virus within a given sample. Using qRT-PCR as a surrogate for viral quantity, samples that contained ~1,000 or more viral genome copies most often created full assemblies (data not shown). Moreover, depletion of poly(rA) carrier reduces homopolymer sequences of A and T in libraries, resulting in cleaner preparations and ensuring better quality sequencing reads (Figure 2). Final libraries from low input viral clinical samples often have a broad fragment length from 150 to 1,000 bp (Figure 3).
After sequencing, to reduce sample misidentification and crosstalk between libraries within a pool12, only index reads with a base quality score of 25 (q25) and ensure zero mismatches are kept during the demultiplexing process. Viral genomes are assembled using a bioinformatics pipeline specific for divergent viruses2,4-6. These tools are available at https://github.com/broadinstitute/viral-ngs or through commercial cloud platforms4.
<table border="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step 1.1: DNase reaction</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Volume per reaction (&#181;l)</td>
		</tr>
		<tr>
			<td>10x DNase buffer</td>
			<td>7</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>6</td>
		</tr>
		<tr>
			<td>Extracted viral RNA</td>
			<td>55</td>
		</tr>
		<tr>
			<td>DNase (2 U/&#181;l)</td>
			<td>2</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>70</td>
		</tr>
		<tr>
			<td>Step 2.1: 5x Hybridization buffer</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Volume for 1 ml (&#181;l)</td>
		</tr>
		<tr>
			<td>5 M NaCl</td>
			<td>200</td>
		</tr>
		<tr>
			<td>1 M Tris-HCl (pH 7.4)</td>
			<td>500</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>300</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>1,000</td>
		</tr>
		<tr>
			<td>Step 2.1: 10x RNase H reaction buffer</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Volume for 1 ml (&#181;l)</td>
		</tr>
		<tr>
			<td>5 M NaCl</td>
			<td>200</td>
		</tr>
		<tr>
			<td>1 M Tris-HCl (pH 7.5)</td>
			<td>500</td>
		</tr>
		<tr>
			<td>1 M MgCl2</td>
			<td>200</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>500</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>1,000</td>
		</tr>
		<tr>
			<td>Step 2.1: Water with linear acrylamide</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Volume for 1 ml buffer (&#181;l)</td>
		</tr>
		<tr>
			<td>Nuclease-free water</td>
			<td>992</td>
		</tr>
		<tr>
			<td>Linear acrylamide (5 mg/ml)</td>
			<td>8</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>1,000</td>
		</tr>
		<tr>
			<td colspan="2">Step 2.2: Hybridization reaction for selective depletion</td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Volume per reaction (&#181;l)</td>
		</tr>
		<tr>
			<td>5x Hybridization Buffer</td>
			<td>2</td>
		</tr>
		<tr>
			<td>rRNA-depletion oligo mix (100 &#181;M)</td>
			<td>1.22</td>
		</tr>
		<tr>
			<td>Oligo(d)T (550 ng/&#181;l)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>DNase-treated total RNA&#160;</td>
			<td>up to 5</td>
		</tr>
		<tr>
			<td>Spike-in RNA (This is optional)</td>
			<td>0.5</td>
		</tr>
		<tr>
			<td>Water (with linear acrylamide)</td>
			<td>bring up to 10 total</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>10</td>
		</tr>
		<tr>
			<td colspan="2">Step 2.3: RNase H reaction for selective depletion</td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Volume per reaction (&#181;l)</td>
		</tr>
		<tr>
			<td>10x RNase H Reaction Buffer&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td>2</td>
		</tr>
		<tr>
			<td>Water (with linear acrylamide)</td>
			<td>5</td>
		</tr>
		<tr>
			<td>Thermostable RNase H (5 U/&#181;l)</td>
			<td>3</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>10</td>
		</tr>
		<tr>
			<td colspan="2">Step 2.4: DNase reaction post selective depletion</td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Volume per reaction (&#181;l)</td>
		</tr>
		<tr>
			<td>10x DNase Buffer</td>
			<td>7.5</td>
		</tr>
		<tr>
			<td>Water (with linear acrylamide)</td>
			<td>44.5</td>
		</tr>
		<tr>
			<td>RNase inhibitor (20 U/&#181;l)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>RNase-free DNase I (2.72 U/&#181;l)&#160;</td>
			<td>2</td>
		</tr>
		<tr>
			<td>Total volume (with RNase H reaction)</td>
			<td>75</td>
		</tr>
		<tr>
			<td colspan="2">Step 3.1:&#160; cDNA synthesis, random primer hybridization</td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Volume per reaction (&#181;l)</td>
		</tr>
		<tr>
			<td>rRNA/carrier-depleted RNA</td>
			<td>10</td>
		</tr>
		<tr>
			<td>3 &#181;g random primer</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>11</td>
		</tr>
		<tr>
			<td>Step 3.2: First strand cDNA synthesis reaction</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Volume (&#181;l)</td>
		</tr>
		<tr>
			<td>5x First-Strand Reaction Buffer</td>
			<td>4</td>
		</tr>
		<tr>
			<td>0.1 M DTT</td>
			<td>2</td>
		</tr>
		<tr>
			<td>10 mM dNTP mix</td>
			<td>1</td>
		</tr>
		<tr>
			<td>RNase inhibitor (20 U/&#181;l)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Reverse transcriptase (add last)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Total volume (with RNA above)</td>
			<td>20</td>
		</tr>
		<tr>
			<td colspan="2">Step 3.3: Second strand cDNA synthesis reaction</td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Volume (&#181;l)</td>
		</tr>
		<tr>
			<td>RNase-free water</td>
			<td>43</td>
		</tr>
		<tr>
			<td>10x Second-Strand Reaction Buffer</td>
			<td>8</td>
		</tr>
		<tr>
			<td>10 mM dNTP mix</td>
			<td>3</td>
		</tr>
		<tr>
			<td>E. coli DNA Ligase (10 U/&#181;l)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>E. coli DNA Polymerase I (10 U/&#181;l)</td>
			<td>4</td>
		</tr>
		<tr>
			<td>E. coli RNase H (2 U/&#181;l)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Total volume (with 1st strand reaction)</td>
			<td>80</td>
		</tr>
		<tr>
			<td>Step 4.2:&#160; Tagmentation reaction</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Volume (&#181;l)</td>
		</tr>
		<tr>
			<td>Amplicon Tagment Mix (ATM)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Tagment DNA Buffer (TD)</td>
			<td>5</td>
		</tr>
		<tr>
			<td>Total volume (with cDNA)</td>
			<td>10</td>
		</tr>
		<tr>
			<td>Step 4.3: Library PCR reaction</td>
			<td></td>
		</tr>
		<tr>
			<td>Reagent</td>
			<td>Volume (&#181;l)</td>
		</tr>
		<tr>
			<td>PCR Master Mix (NPM)</td>
			<td>7.5</td>
		</tr>
		<tr>
			<td>Index 1 primer (i7)</td>
			<td>2.5</td>
		</tr>
		<tr>
			<td>Index 2 primer (i5)</td>
			<td>2.5</td>
		</tr>
		<tr>
			<td>Total volume (with tagmented cDNA)</td>
			<td>25</td>
		</tr>
		<tr>
			<td>Step 4.3.2: Library PCR conditions</td>
			<td></td>
		</tr>
		<tr>
			<td>72 &#176;C, 3 min</td>
			<td></td>
		</tr>
		<tr>
			<td>95 &#176;C, 30 sec</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="2">up to 18 cycles-10 sec at 95 &#176;C, 30 sec at 55 &#176;C, 30 sec at 72 &#176;C</td>
		</tr>
		<tr>
			<td>72 &#176;C, 5 min</td>
			<td></td>
		</tr>
		<tr>
			<td>10 &#176;C, forever</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 1: Reaction set-up and buffers. Step-by-step tables with contents of all buffers and reaction mixes.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Oligo Name</td>
			<td>Sequence (5&#39; to 3&#39;)</td>
		</tr>
		<tr>
			<td>Ebola KGH FW</td>
			<td>GTCGTTCCAACAATCGAGCG</td>
		</tr>
		<tr>
			<td>Ebola KGH RV</td>
			<td>CGTCCCGTAGCTTTRGCCAT</td>
		</tr>
		<tr>
			<td>Ebola KULESH FW</td>
			<td>TCTGACATGGATTACCACAAGATC</td>
		</tr>
		<tr>
			<td>Ebola KULESH RV</td>
			<td>GGATGACTCTTTGCCGAACAATC</td>
		</tr>
		<tr>
			<td>Lassa SL FW</td>
			<td>GTA AGC CCA GCD GYA AAB CC</td>
		</tr>
		<tr>
			<td>Lassa SL RV</td>
			<td>AAG CCA CAG AAA RCT GGS AGC A</td>
		</tr>
		<tr>
			<td>18S rRNA FW</td>
			<td>TCCTTTAACGAGGATCCATTGG</td>
		</tr>
		<tr>
			<td>18S rRNA RV</td>
			<td>CGAGCTTTTTAACTGCAGCAACT</td>
		</tr>
	</tbody>
</table>
Table 2: qRT-PCR Primers Sequences. Primers used for measuring host (18S rRNA) and viral (Ebola and Lassa) content. &#39;KGH&#39; is Kenema Government Hospital in Sierra Leone, where the Ebola primers were tested 2. &#39;Kulesh&#39; is the investigator who designed the primer set 14.
Table 3: Ribosomal RNA (rRNA) Depletion Oligos. 195 50-nucleotide&#160;long sequences complementary to human rRNA for selective depletion step6. <a href="https://www.jove.com/files/ftp_upload/54117/Table_3.xlsx" target="_blank">Please click here to download this file.</a>

Watch this Scientific Journal Video about Unbiased Deep Sequencing of RNA Viruses from Clinical Samples at JoVE.com

Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

Here we outline a next-generation RNA sequencing protocol that enables de novo assemblies and intra-host variant calls of viral genomes collected from ...

unbiased-deep-sequencing-of-rna-viruses-from-clinical-samples

Research

JoVE Journal

Medicine

16.8K Views.  Broad Institute of MIT and Harvard. This protocol describes a rapid and broadly applicable method for unbiased RNA-sequencing of viral samples from human clinical isolates.

Video: Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

Isolation and Functional Characterization of Human Ventricular Cardiomyocytes from Fresh Surgical Samples

Cardiomyocytes from diseased hearts are subjected to complex remodeling processes involving changes in cell structure, excitation contraction coupling and membrane ion currents. Those changes are likely&#160;to be responsible for the increased arrhythmogenic risk and the contractile alterations leading to systolic and diastolic dysfunction in cardiac patients. However, most information on the alterations of myocyte function in cardiac diseases has come from animal models.
Here we describe and validate a protocol to isolate viable myocytes from small surgical samples of ventricular myocardium from patients undergoing cardiac surgery operations. The protocol is described in detail. Electrophysiological and intracellular calcium measurements are reported to demonstrate the feasibility of a number of single cell measurements in human ventricular cardiomyocytes obtained with this method.
The protocol reported here can be useful for future investigations of the cellular and molecular basis of functional alterations of the human heart in the presence of different cardiac diseases. Further, this method can be used to identify novel therapeutic targets at cellular level and to test the effectiveness of new compounds on human cardiomyocytes, with direct translational value.

Current knowledge on the cellular basis of cardiac diseases mostly relies on studies on animal models. Here we describe and validate a novel method to obtain single viable cardiomyocytes from small surgical samples of human ventricular myocardium. Human ventricular myocytes can be used for electrophysiological studies and drug testing.

Cardiomyocytes from diseased hearts are subjected to complex remodeling processes involving changes in cell structure, excitation contraction coupling and ...

Isolation of Cancer Stem Cells From Human Prostate Cancer Samples

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly isolated from human tissues and serially propagated in immunodeficient mice, typically through antibody labeling of subpopulations of cells and fractionation by flow cytometry. However, the unique clinical features of prostate cancer have considerably limited the study of prostate CSCs from fresh human tumor samples. We recently reported the isolation of prostate CSCs directly from human tissues by virtue of their HLA class I (HLAI)-negative phenotype. Prostate cancer cells are harvested from surgical specimens and mechanically dissociated. A cell suspension is generated and labeled with fluorescently conjugated HLAI and stromal antibodies. Subpopulations of HLAI-negative cells are finally isolated using a flow cytometer. The principal limitation of this protocol is the frequently microscopic and multifocal nature of primary cancer in prostatectomy specimens. Nonetheless, isolated live prostate CSCs are suitable for molecular characterization and functional validation by transplantation in immunodeficient mice.

The isolation of cancer stem cells (CSCs) directly from human tissues is requisite for their biological characterization. This manuscript describes a methodology for the isolation of prostate CSCs from human tissues, while also providing tips on troubleshooting difficult steps.

The cancer stem cell (CSC) model has been considerably revisited over the last two decades. During this time CSCs have been identified and directly ...

Controlling Parkinson's Disease With Adaptive Deep Brain Stimulation

Adaptive deep brain stimulation (aDBS) has the potential to improve the treatment of Parkinson&#39;s disease by optimizing stimulation in real time according to fluctuating disease and medication state. In the present realization of adaptive DBS we record and stimulate from the DBS electrodes implanted in the subthalamic nucleus of patients with Parkinson&#39;s disease in the early post-operative period. Local field potentials are analogue filtered between 3 and 47 Hz before being passed to a data acquisition unit where they are digitally filtered again around the patient specific beta peak, rectified and smoothed to give an online reading of the beta amplitude. A threshold for beta amplitude is set heuristically, which, if crossed, passes a trigger signal to the stimulator. The stimulator then ramps up stimulation to a pre-determined clinically effective voltage over 250 msec and continues to stimulate until the beta amplitude again falls down below threshold. Stimulation continues in this manner with brief episodes of ramped DBS during periods of heightened beta power.
Clinical efficacy is assessed after a minimum period of stabilization (5 min) through the unblinded and blinded video assessment of motor function using a selection of scores from the Unified Parkinson&#39;s Rating Scale (UPDRS). Recent work has demonstrated a reduction in power consumption with aDBS as well as an improvement in clinical scores compared to conventional DBS. Chronic aDBS could now be trialed in Parkinsonism.

Adaptive deep brain stimulation (aDBS) is effective for Parkinson&#8217;s disease, improving symptoms and reducing power consumption compared to conventional deep brain stimulation (cDBS). In aDBS we track a local field potential biomarker (beta oscillatory amplitude) in real time and use this to control the timing of stimulation.

Adaptive deep brain stimulation (aDBS) has the potential to improve the treatment of Parkinson&#39;s disease by optimizing stimulation in real time ...

Handling of the Cotton Rat in Studies for the Pre-clinical Evaluation of Oncolytic Viruses

Oncolytic viruses are a novel anticancer therapy with the ability to target tumor cells, while leaving healthy cells intact. For this strategy to be successful, recent studies have shown that involvement of the host immune system is essential. Therefore, oncolytic virotherapy should be evaluated within the context of an immunocompetent model. Furthermore, the study of antitumor therapies in tolerized animal models may better recapitulate results seen in clinical trials. Cotton rats, commonly used to study respiratory viruses, are an attractive model to study oncolytic virotherapy as syngeneic models of mammary carcinoma and osteosarcoma are well established. However, there is a lack of published information on the proper handling procedure for these highly excitable rodents. The handling and capture approach outlined minimizes animal stress to facilitate experimentation. This technique hinges upon the ability of the researcher to keep calm during handling and perform procedures in a timely fashion. Finally, we describe how to prepare cotton rat mammary tumor cells for consistent subcutaneous tumor formation, and how to perform intratumoral and intraperitoneal injections. These methods can be applied to a wide range of studies furthering the development of the cotton rat as a relevant pre-clinical model to study antitumor therapy.

Cotton rats are extremely excitable and have a strong flight-or-fight response. A handling method optimized to reduce the stress of the animals is described which will make cotton rats more accessible as a preclinical model.

Oncolytic viruses are a novel anticancer therapy with the ability to target tumor cells, while leaving healthy cells intact.  For this strategy to be ...

VDJ-Seq: Deep Sequencing Analysis of Rearranged Immunoglobulin Heavy Chain Gene to Reveal Clonal Evolution Patterns of B Cell Lymphoma

Understanding tumor clonality is critical to understanding the mechanisms involved in tumorigenesis and disease progression. In addition, understanding the clonal composition changes that occur within a tumor in response to certain micro-environment or treatments may lead to the design of more sophisticated and effective approaches to eradicate tumor cells. However, tracking tumor clonal sub-populations has been challenging due to the lack of distinguishable markers. To address this problem, a VDJ-seq protocol was created to trace the clonal evolution patterns of diffuse large B cell lymphoma (DLBCL) relapse by exploiting VDJ recombination and somatic hypermutation (SHM), two unique features of B cell lymphomas.
In this protocol, Next-Generation sequencing (NGS) libraries with indexing potential were constructed from amplified rearranged immunoglobulin heavy chain (IgH) VDJ region from pairs of primary diagnosis and relapse DLBCL samples. On average more than half million VDJ sequences per sample were obtained after sequencing, which contain both VDJ rearrangement and SHM information. In addition, customized bioinformatics pipelines were developed to fully utilize sequence information for the characterization of IgH-VDJ repertoire within these samples. Furthermore, the pipeline allows the reconstruction and comparison of the clonal architecture of individual tumors, which enables the examination of the clonal heterogeneity within the diagnosis tumors and deduction of clonal evolution patterns between diagnosis and relapse tumor pairs. When applying this analysis to several diagnosis-relapse pairs, we uncovered key evidence that multiple distinctive tumor evolutionary patterns could lead to DLBCL relapse. Additionally, this approach can be expanded into other clinical aspects, such as identification of minimal residual disease, monitoring relapse progress and treatment response, and investigation of immune repertoires in non-lymphoma contexts.

This protocol describes an approach to interrogate the recombined immunoglobulin heavy chain VDJ regions of lymphomas by deep-sequencing and retrieve VDJ rearrangement and somatic hypermutation status to delineate clonal architecture of individual tumor. Comparing clonal architecture between paired diagnosis and relapse samples reveals lymphoma relapse clonal evolution modes.

Understanding tumor clonality is critical to understanding the mechanisms involved in tumorigenesis and disease progression. In addition, understanding ...

Using Saccadometry with Deep Brain Stimulation to Study Normal and Pathological Brain Function

The oculomotor system involves a large number of brain areas including parts of the basal ganglia, and various neurodegenerative diseases including Parkinson's and Huntington's can disrupt it. People with Parkinson's disease, for example, tend to have increased saccadic latencies. Consequently, the quantitative measurement of saccadic eye movements has received considerable attention as a potential biomarker for neurodegenerative conditions. A lot more can be learned about the brain in both health and disease by observing what happens to eye movements when the function of specific brain areas is perturbed. Deep brain stimulation is a surgical intervention used for the management of a range of neurological conditions including Parkinson's disease, in which stimulating electrodes are placed in specific brain areas including several sites in the basal ganglia. Eye movement measurements can then be made with the stimulator systems both off and on and the results compared. With suitable experimental design, this approach can be used to study the pathophysiology of the disease being treated, the mechanism by which DBS exerts it beneficial effects, and even aspects of normal neurophysiology.

This paper describes the use of quantitative measurement of eye movements in conjunction with stimulation of focal areas of the deep brain in order to study physiology, pathophysiology, and the mechanisms of deep brain stimulation.

The oculomotor system involves a large number of brain areas including parts of the basal ganglia, and various neurodegenerative diseases including ...

Transarterial Administration of Oncolytic Viruses for Locoregional Therapy of Orthotopic HCC in Rats

Hepatocellular carcinoma (HCC) is a disease with limited treatment options and poor prognosis. In recent years, oncolytic virotherapies have proven themselves to be potentially powerful tools to fight malignancy. Due to the unique dual blood supply in the liver, it is possible to apply therapies locally to orthotopic liver tumors, which are predominantly fed by arterial blood flow. We have previously demonstrated that hepatic arterial delivery of oncolytic viruses results in safe and efficient transduction efficiency of multifocal HCC lesions, resulting in significant prolongation of survival in immune competent rats. This procedure closely mimics the application of transarterial embolization in patients, which is the standard palliative care provided to many HCC patients. The ability to administer tumor therapies through the hepatic artery in rats allows for a highly sophisticated preclinical model for evaluating novel viral vectors under development. Here we describe the detailed protocol for microdissection of the hepatic artery for infusion of oncolytic virus vectors to treat orthotopic HCC.

Oncolytic virotherapies are under development as novel therapeutics for the treatment of hepatocellular carcinoma (HCC). Here we describe a method for locoregional therapy of HCC via hepatic arterial administration of oncolytic virus.

Hepatocellular carcinoma (HCC) is a disease with limited treatment options and poor prognosis.  In recent years, oncolytic virotherapies have proven ...

Sampling Strategies and Processing of Biobank Tissue Samples from Porcine Biomedical Models

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of genetically modified pig models, and the often-limited number of available animals of these models, establishment of (biobank) collections of adequately processed tissue samples suited for a broad spectrum of subsequent analyses methods, including analyses not specified at the time point of sampling, represent meaningful approaches to take full advantage of the translational value of the model. With respect to the peculiarities of porcine anatomy, comprehensive guidelines have recently been established for standardized generation of representative, high-quality samples from different porcine organs and tissues. These guidelines are essential prerequisites for the reproducibility of results and their comparability between different studies and investigators. The recording of basic data, such as organ weights and volumes, the determination of the sampling locations and of the numbers of tissue samples to be generated, as well as their orientation, size, processing and trimming directions, are relevant factors determining the generalizability and usability of the specimen for molecular, qualitative, and quantitative morphological analyses. Here, an illustrative, practical, step-by-step demonstration of the most important techniques for generation of representative, multi-purpose biobank specimen from porcine tissues is presented. The methods described here include determination of organ/tissue volumes and densities, the application of a volume-weighted systematic random sampling procedure for parenchymal organs by point-counting, determination of the extent of tissue shrinkage related to histological embedding of samples, and generation of randomly oriented samples for quantitative stereological analyses, such as isotropic uniform random (IUR) sections generated by the &#34;Orientator&#34; and &#34;Isector&#34; methods, and vertical uniform random (VUR) sections.

The practical application and performance of methods for generation of representative tissue samples of porcine animal models for a broad spectrum of downstream analyses in biobank projects are demonstrated, including volumetry, systematic random sampling, and differential processing of tissue samples for qualitative and quantitative morphologic and molecular analyses types.

In translational medical research, porcine models have steadily become more popular. Considering the high value of individual animals, particularly of ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations often cause a distorted reading frame and premature stop codons, resulting in an almost total lack of dystrophin protein. The reading frame can be corrected using antisense oligonucleotides (AONs) that induce exon skipping. The morpholino AON viltolarsen (code name: NS-065/NCNP-01) has been shown to induce exon 53 skipping, restoring the reading frame for patients with exon 52 deletions. We recently administered NS-065/NCNP-01 intravenously to DMD patients in an exploratory investigator-initiated, first-in-human trial of NS-065/NCNP-01. In this methods article, we present the molecular characterization of dystrophin expression using Sanger sequencing, RT-PCR, and western blotting in the clinical trial. The characterization of dystrophin expression was fundamental in the study for showing the efficacy since no functional outcome tests were performed.

Here, we present the molecular characterization of dystrophin 38 expression using Sanger sequencing, RT-PCR, and western blotting in the clinical trial.

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...

Isolation of Viable Adipocytes and Stromal Vascular Fraction from Human Visceral Adipose Tissue Suitable for RNA Analysis and Macrophage Phenotyping

Visceral adipose tissue (VAT) is an active metabolic organ composed mainly of mature adipocytes and stromal vascular fraction (SVF) cells, which release different bioactive molecules that control metabolic, hormonal, and immune processes; currently, it is unclear how these processes are regulated within the adipose tissue. Therefore, the development of methods evaluating the contribution of each cell population to the pathophysiology of adipose tissue is crucial. This protocol describes the isolation steps and provides the necessary troubleshooting guidelines for efficient isolation of viable mature adipocytes and SVF from human VAT biopsies in a single process, using a collagenase enzymatic digestion technique. Moreover, the protocol is also optimized to identify macrophage subsets and perform mature adipocyte RNA isolation for gene expression studies, which allows performing studies dissecting the interaction between these cell populations. Briefly, VAT biopsies are washed, minced mechanically, and digested to generate a single-cell suspension. After centrifugation, mature adipocytes are isolated by flotation from the SVF pellet. The RNA extraction protocol ensures a high yield of total RNA (including miRNAs) from adipocytes for downstream expression assays. Simultaneously, SVF cells are used to characterize macrophage subsets (pro- and anti-inflammatory phenotype) through flow cytometry analysis.

This protocol provides an efficient collagenase digestion method for isolation of viable adipocytes and stromal vascular fraction-SVF cells from human visceral fat in a single process, including methodology to obtain high-quality RNA from adipocytes and phenotypification of SVF-macrophages through staining of multiple membrane-bound markers for analysis by flow cytometry.

Visceral adipose tissue (VAT) is an active metabolic organ composed mainly of mature adipocytes and stromal vascular fraction (SVF) cells, which release ...

Unbiased Deep Sequencing of RNA Viruses from Clinical Samples

Podsumowanie

Przeglądaj więcej filmów

PLAYLIST