وأيد أعمال البحث التي ذكرت في هذا المنشور بالمعهد الوطني للعلوم الطبية العامة "معاهد الصحة الوطنية في" إطار جائزة رقم R35GM124913 وبرنامج الحوافز PI4D جامعة بوردو، والتنافسية الداخلية PVM برنامج صناديق الأبحاث الأساسية. المحتوى هي المسؤولة الوحيدة عن المؤلفين ولا تمثل بالضرورة وجهات النظر الرسمية لعملاء التمويل. ونحن نشكر كويشي كاواكامي لبناء Tol2، مايكل لين لبناء ASAP1، وتشييد زون ليونارد للمروج يو بي أي عن طريق أدجيني.

<ol>
	<li>Levin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+bioelectricity:+how+endogenous+voltage+potentials+control+cell+behavior+and+instruct+pattern+regulation+in+vivo.">Molecular bioelectricity: how endogenous voltage potentials control cell behavior and instruct pattern regulation in vivo.</a> Molecular Biology of the Cell. 25 (24), 3835-3850 (2014).</li><li>Storace, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+Better+Genetically+Encoded+Sensors+of+Membrane+Potential.">Toward Better Genetically Encoded Sensors of Membrane Potential.</a> Trends in Neuroscience. 39 (5), 277-289 (2016).</li><li>Inagaki, S., Nagai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Current+progress+in+genetically+encoded+voltage+indicators+for+neural+activity+recording.">Current progress in genetically encoded voltage indicators for neural activity recording.</a> Current Opinion in Chemical Biology. 33, 95-100 (2016).</li><li>St-Pierre, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-fidelity+optical+reporting+of+neuronal+electrical+activity+with+an+ultrafast+fluorescent+voltage+sensor.">High-fidelity optical reporting of neuronal electrical activity with an ultrafast fluorescent voltage sensor.</a> Nature Neuroscience. 17 (6), 884-889 (2014).</li><li>Lieschke, G. J., Currie, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+human+disease:+zebrafish+swim+into+view.">Animal models of human disease: zebrafish swim into view.</a> Nature Reviews Genetics. 8 (5), 353-367 (2007).</li><li>Santoriello, C., Zon, L. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hooked!+Modeling+human+disease+in+zebrafish.">Hooked! Modeling human disease in zebrafish.</a> Journal of Clinical Investigation. 122 (7), 2337-2343 (2012).</li><li>Howe, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+zebrafish+reference+genome+sequence+and+its+relationship+to+the+human+genome.">The zebrafish reference genome sequence and its relationship to the human genome.</a> Nature. , (2013).</li><li>Kawakami, K., Shima, A., Kawakami, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+functional+transposase+of+the+Tol2+element,+an+Ac-like+element+from+the+Japanese+medaka+fish,+and+its+transposition+in+the+zebrafish+germ+lineage.">Identification of a functional transposase of the Tol2 element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage.</a> Proceedings of the National Academy of Science USA. 97 (21), 11403-11408 (2000).</li><li>Urasaki, A., Asakawa, K., Kawakami, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+transposition+of+the+Tol2+transposable+element+from+a+single-copy+donor+in+zebrafish.">Efficient transposition of the Tol2 transposable element from a single-copy donor in zebrafish.</a> Proceedings of the National Academy of Science USA. 105 (50), 19827-19832 (2008).</li><li>Kwan, K. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Tol2kit:+a+multisite+gateway-based+construction+kit+for+Tol2+transposon+transgenesis+constructs.">The Tol2kit: a multisite gateway-based construction kit for Tol2 transposon transgenesis constructs.</a> Developmental Dynamics. 236 (11), 3088-3099 (2007).</li><li>Mosimann, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitous+transgene+expression+and+Cre-based+recombination+driven+by+the+ubiquitin+promoter+in+zebrafish.">Ubiquitous transgene expression and Cre-based recombination driven by the ubiquitin promoter in zebrafish.</a> Development. 138 (1), 169-177 (2011).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Ordovas, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+of+small-size+DNA+fragments+using+agarose+gel+electrophoresis.">Separation of small-size DNA fragments using agarose gel electrophoresis.</a> Methods in Molecular Biology. 110, 35-42 (1998).</li><li>Downey, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extraction+of+DNA+from+agarose+gels.">Extraction of DNA from agarose gels.</a> Methods Mol Biol. 235, 137-139 (2003).</li><li>Desjardins, P., Conklin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NanoDrop+microvolume+quantitation+of+nucleic+acids.">NanoDrop microvolume quantitation of nucleic acids.</a> Journal of Visualized Experiments. 45 (45), (2010).</li><li>Green, M. R., Sambrook, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular cloning : a laboratory manual. , (2012).</li><li>Zhang, S., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purifying+plasmid+DNA+from+bacterial+colonies+using+the+QIAGEN+Miniprep+Kit.">Purifying plasmid DNA from bacterial colonies using the QIAGEN Miniprep Kit.</a> Journal of Visualized Experiments. (6), 247 (2007).</li><li>Meeker, N. D., Hutchinson, S. A., Ho, L., Trede, N. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+isolation+of+PCR-ready+genomic+DNA+from+zebrafish+tissues.">Method for isolation of PCR-ready genomic DNA from zebrafish tissues.</a> Biotechniques. 43 (5), (2007).</li><li>Kawakami, K., Koga, A., Hori, H., Shima, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Excision+of+the+tol2+transposable+element+of+the+medaka+fish,+Oryzias+latipes,+in+zebrafish,+Danio+rerio.">Excision of the tol2 transposable element of the medaka fish, Oryzias latipes, in zebrafish, Danio rerio.</a> Gene. 225 (1-2), 17-22 (1998).</li><li>Westerfield, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> The zebrafish book. A guide for the laboratory use of zebrafish (Danio rerio). , (2000).</li><li>Amsterdam, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+genes+are+cancer+genes+in+zebrafish.">Many ribosomal protein genes are cancer genes in zebrafish.</a> PLoS Biology. 2 (5), E139 (2004).</li><li>Lai, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+ribosomal+protein+mutations+are+associated+with+growth+impairment+and+tumor+predisposition+in+zebrafish.">Many ribosomal protein mutations are associated with growth impairment and tumor predisposition in zebrafish.</a> Developmental Dynamics. 238 (1), 76-85 (2009).</li><li>Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stages+of+embryonic+development+of+the+zebrafish.">Stages of embryonic development of the zebrafish.</a> Developmental Dynamics. 203 (3), 253-310 (1995).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+oncogenomic+analysis+of+copy+number+alterations+in+human+and+zebrafish+tumors+enables+cancer+driver+discovery.">Comparative oncogenomic analysis of copy number alterations in human and zebrafish tumors enables cancer driver discovery.</a> PLoS Genetics. 9 (8), e1003734 (2013).</li><li>Zhang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+aneuploid+zebrafish+malignant+peripheral+nerve+sheath+tumors+have+genetic+alterations+similar+to+human+cancers.">Highly aneuploid zebrafish malignant peripheral nerve sheath tumors have genetic alterations similar to human cancers.</a> Proceedings of the National Academy of Science USA. 107 (39), 16940-16945 (2010).</li><li>Urrego, D., Tomczak, A. P., Zahed, F., Stuhmer, W., Pardo, L. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potassium+channels+in+cell+cycle+and+cell+proliferation.">Potassium channels in cell cycle and cell proliferation.</a> Philosophical Transactions of the Royal Society of London Series B. 369 (1638), 20130094 (2014).</li><li>Yang, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Subcellular+Imaging+of+Voltage+and+Calcium+Signals+Reveals+Neural+Processing+In+Vivo.">Subcellular Imaging of Voltage and Calcium Signals Reveals Neural Processing In Vivo.</a> Cell. 166 (1), 245-257 (2016).</li><li>Chamberland, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+two-photon+imaging+of+subcellular+voltage+dynamics+in+neuronal+tissue+with+genetically+encoded+indicators.">Fast two-photon imaging of subcellular voltage dynamics in neuronal tissue with genetically encoded indicators.</a> Elife. 6, (2017).</li><li>Hochbaum, D. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=All-optical+electrophysiology+in+mammalian+neurons+using+engineered+microbial+rhodopsins.">All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins.</a> Nature Methods. 11 (8), 825-833 (2014).</li><li>Sugiyama, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Illuminating+cell-cycle+progression+in+the+developing+zebrafish+embryo.">Illuminating cell-cycle progression in the developing zebrafish embryo.</a> Proceedings of the National Academy of Science USA. 106 (49), 20812-20817 (2009).</li></ol>

الكتاب ليس لها علاقة بالكشف عن.

على الرغم من أن تم اكتشاف الخلايا والأنسجة ومستوى الأنشطة الكهربائية أثناء التطور الجنيني والأمراض البشرية منذ زمن طويل، في فيفو الكهربائية التغيرات الدينامية ودورها البيولوجي لا تزال غير معروفة إلى حد كبير. أحد التحديات الرئيسية هو تصور وتحديد التغييرات الكهربائية. التكنولوجيا ا?...

ويشير تستخرجها للإشارات الكهربائية الذاتية بوساطة قنوات أيون والمضخات الموجودة على غشاء الخلية1. تبادل أيونى عبر الغشاء الخلوي، وإلى جانب التغييرات الحالية والمحتملة الكهربائية، ضرورية لإشارات عمليات خلايا العصبية والعضلات منفعل. وباﻹضافة إلى ذلك، تستخرجها والتدرجات وأيون لها مجموعة متنوعة من الوظائف البيولوجية الهامة الأخرى بما في ذلك تخزين الطاقة والنقل المستقلب والحيوي،. إشارات bioelectrical اكتشفت أيضا كمنظم لتشكيل نمط الجنينية، مثل هيئة المحاور، ودورة الخلية، والخلية التمايز1. وبالتالي، من الأهمية بمكان لفهم العديد من الأمراض الخلقية البشرية التي تنجم عن سوء تنظيم هذا النوع من الإشارات. على الرغم من أن المشبك التصحيح قد استخدمت على نطاق واسع لتسجيل الخلايا المفردة، أنها لا تزال بعيدة عن المثالية للرصد المتزامن لخلايا متعددة أثناء التطور الجنيني في فيفو. وعلاوة على ذلك، الجهد جزيئات صغيرة حساسة أيضا ليست مثالية للتطبيقات في فيفو نظراً لخصائصها، والحساسيات، والسمية.
إنشاء مجموعة متنوعة من وراثيا ترميز الجهد الفلورسنت المؤشرات (جيفيس) يوفر إليه جديدة للتغلب على هذه المشكلة، ويسمح للتطبيقات سهلة لدراسة التطور الجنيني، على الرغم من أنها كانت مخصصة أصلاً لرصد العصبية الخلايا2،3. واحد جيفيس المتاحة حاليا هو تسارع جهاز استشعار لإمكانات العمل 1 (ASAP1)4. وهو يتألف من حلقة خارج الخلية في مجال الاستشعار عن بعد الجهد الجهد الفوسفاتيز الحساسة وبروتين فلوري أخضر دائري مبدل. ولذلك، يسمح ASAP1 التصور للتغيرات المحتملة الكهربائية الخلوية (الاستقطاب: أخضر ساطع؛ depolarization: أخضر داكن). ASAP1 2 مللي ثانية وإيقاف حركية، ويمكن تعقب التغيير المحتمل سوبثريشولد4. وبالتالي، تتيح هذه الأداة الوراثية لمستوى جديد من الكفاءة في رصد الاحتمالات في الوقت الحقيقي في الخلايا الحية. زيادة فهم أدوار تستخرجها في التطور الجنيني وكثير من الأمراض البشرية، مثل السرطان، سوف ضوءا جديداً على الآليات الكامنة، التي حاسمة بالنسبة للوقاية والعلاج من الأمراض.
ثبت الزرد نموذج حيوان قوية لدراسة علم الأحياء التنموي والأمراض البشرية بما في ذلك السرطان5،6. تتبادل الجينات أورثولوجوس 70% مع البشر، ولديهم بيولوجيا الفقاريات مماثلة7. الزرد توفير الرعاية سهلة نسبيا، وحجم مخلب كبير من البيض وتتبعها الوراثة، ترانسجينيسيس سهلة وشفافة من التنمية الجنينية الخارجية، مما يجعلها نظام متفوقة في فيفو التصوير5،6. مصدر كبير للأسماك متحولة خطوط موجودة بالفعل وجينوم الكامل متتابع، ستوفر الزرد نطاق محدود نسبيا من الاكتشافات العلمية.
للتحقيق في فيفو في الوقت الحقيقي النشاط الكهربائي للخلايا، علينا الاستفادة من النظام النموذجي الزرد و ASAP1. في هذه الورقة، تصف كيفية إدماج biosensor الجهد نيون ASAP1 في الجينوم الزرد استخدام Tol2 ينقول ترانسجينيسيس، وتصور النشاط الكهربائي الخلوية أثناء التطور الجنيني، حركة الأسماك اليرقات، وفي ورم لايف .

<table>
	<tbody>
		<tr>
			<td>14mL cell culture tubes</td>
			<td>VWR</td>
			<td>60818-725</td>
			<td>E.Coli culture</td>
		</tr>
		<tr>
			<td>Agarose electrophoresis tank</td>
			<td>Thermo Scientific</td>
			<td>Owl B2</td>
			<td>DNA eletrophoresis</td>
		</tr>
		<tr>
			<td>Agarose RA</td>
			<td>Amresco</td>
			<td>N605-500G</td>
			<td>For making the injection gels</td>
		</tr>
		<tr>
			<td>Attb1-ASAP1-F primer</td>
			<td>IDT DNA</td>
			<td>GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACCATGGAGACGACTGTGAGGTATGAACA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Attb2-ASAP1-R primer</td>
			<td>IDT DNA</td>
			<td>GGGGACCACTTTGTACAAGAAAGCTGGGTCTTAGGTTACCACTTCAAGTTGTTTCTTCTGTGAAGCCA</td>
			<td>ASAP1 coding region amplification for subcloning</td>
		</tr>
		<tr>
			<td>Bright field dissection scope</td>
			<td>Nikon</td>
			<td>SMZ 745</td>
			<td>Dechorionation, microinjection, mounting</td>
		</tr>
		<tr>
			<td>Color camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRc</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Concave slide</td>
			<td>VWR</td>
			<td>48336-001</td>
			<td>For holding fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>Disposable transfer pipette 3.4 ml</td>
			<td>Thermo Scientific</td>
			<td>13-711-9AM</td>
			<td>Fish embryos and water transfer</td>
		</tr>
		<tr>
			<td>Endonuclease enzyme, Not I</td>
			<td>NEB</td>
			<td>R0189L</td>
			<td>For linearizing plasmid DNA</td>
		</tr>
		<tr>
			<td>Epifuorescent compound scope</td>
			<td>Zeiss</td>
			<td>Axio Imager.A2</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Epifuorescent stereo dissection scope</td>
			<td>Zeiss</td>
			<td>Stereo Discovery.V12</td>
			<td>Fish embryo imaging</td>
		</tr>
		<tr>
			<td>Fluorescent light source</td>
			<td>Lumen dynamics</td>
			<td>X-cite seris 120</td>
			<td>Light source for fluorescence microscopes</td>
		</tr>
		<tr>
			<td>Forceps #5</td>
			<td>WPI</td>
			<td>500342</td>
			<td>Dechorionation and needle breaking</td>
		</tr>
		<tr>
			<td>Gateway BP Clonase II Enzyme mix</td>
			<td>Thermo Scientific</td>
			<td>11789020</td>
			<td>Gateway BP recombination cloning</td>
		</tr>
		<tr>
			<td>Gateway LR Clonase II Plus enzyme</td>
			<td>Thermo Scientific</td>
			<td>12538120</td>
			<td>Gateway LR recombination cloning</td>
		</tr>
		<tr>
			<td>Gel DNA Recovery Kit</td>
			<td>Zymo Research</td>
			<td>D4002</td>
			<td>DNA gel purification</td>
		</tr>
		<tr>
			<td>Loading tip</td>
			<td>Eppendorf</td>
			<td>930001007</td>
			<td>For loading injection solution into capilary needles</td>
		</tr>
		<tr>
			<td>Methylcellulose (1600cPs)</td>
			<td>Alfa Aesar</td>
			<td>43146</td>
			<td>Fish embryo mounting</td>
		</tr>
		<tr>
			<td>Methylene blue</td>
			<td>Sigma-Aldrich</td>
			<td>M9140</td>
			<td>Suppresses fungal outbreaks in Petri dishes</td>
		</tr>
		<tr>
			<td>Microinjection mold</td>
			<td>Adaptive Science Tools</td>
			<td>TU-1</td>
			<td>To prepare agaorse mold tray for holding fish embryos during injection</td>
		</tr>
		<tr>
			<td>Microinjector</td>
			<td>WPI</td>
			<td>Pneumatic Picopump PV820</td>
			<td>Microinjection injector</td>
		</tr>
		<tr>
			<td>Micro-manipulator</td>
			<td>WPI</td>
			<td>Microinjector mm33 rechts</td>
			<td>Microinjection operation</td>
		</tr>
		<tr>
			<td>Micropipette puller</td>
			<td>Sutter instrument</td>
			<td>P-1000</td>
			<td>For preparing capillary needle</td>
		</tr>
		<tr>
			<td>Mineral oil</td>
			<td>Amresco</td>
			<td>J217-500ml</td>
			<td>For calibrating injection volume</td>
		</tr>
		<tr>
			<td>mMESSAGE mMACHINE SP6 Transcription Kit</td>
			<td>Thermo Scientific</td>
			<td>AM1340</td>
			<td>mRNA in vitro transcription</td>
		</tr>
		<tr>
			<td>Monocolor camera</td>
			<td>Zeiss</td>
			<td>AxioCam MRm</td>
			<td>Fish embryo image recording</td>
		</tr>
		<tr>
			<td>Plasmid Miniprep Kit</td>
			<td>Zymo Research</td>
			<td>D4020</td>
			<td>Prepare small amount of plasmid DNA</td>
		</tr>
		<tr>
			<td>Plastic Petri dishes</td>
			<td>VWR</td>
			<td>25384-088</td>
			<td>For holding fish or fish embryos during imaging process</td>
		</tr>
		<tr>
			<td>RNA Clean &#38; Concentrator-5</td>
			<td>Zymo Research</td>
			<td>R1015</td>
			<td>mRNA cleaning after in vitro transcription</td>
		</tr>
		<tr>
			<td>Spectrophotometer</td>
			<td>Thermo Scientific</td>
			<td>NanoDrop 2000</td>
			<td>For measuring DNA and RNA concentrations</td>
		</tr>
		<tr>
			<td>Stage Micrometer</td>
			<td>Am Scope</td>
			<td>MR100</td>
			<td>Microinjection volume calibration</td>
		</tr>
		<tr>
			<td>Thermocycler</td>
			<td>Bio-Rad</td>
			<td>T100</td>
			<td>DNA amplification for gene cloning</td>
		</tr>
		<tr>
			<td>Thin wall glass capillaries</td>
			<td>WPI</td>
			<td>TW100F-4</td>
			<td>Raw glass for making cappilary needle</td>
		</tr>
		<tr>
			<td>Tol2-exL1 primer</td>
			<td>IDT DNA</td>
			<td>GCACAACACCAGAAATGCCCTC</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>Tol2-exR primer</td>
			<td>IDT DNA</td>
			<td>ACCCTCACTAAAGGGAACAAAAG</td>
			<td>Tol2 excise assay</td>
		</tr>
		<tr>
			<td>TOP10 Chemically Competent E. coli</td>
			<td>Thermo Scientific</td>
			<td>C404006</td>
			<td>Used for transformation during gene cloning</td>
		</tr>
		<tr>
			<td>Tricaine mesylate</td>
			<td>Sigma-Aldrich</td>
			<td>A5040</td>
			<td>For anesthetizing fish or fish embryos</td>
		</tr>
		<tr>
			<td>UV trans-illuminator 302nm</td>
			<td>UVP</td>
			<td>M-20V</td>
			<td>DNA visualization</td>
		</tr>
		<tr>
			<td>Water bath</td>
			<td>Thermo Scientific</td>
			<td>2853</td>
			<td>For transformation process of gene cloning</td>
		</tr>
	</tbody>
</table>

visualization of cellular electrical activity in zebrafish early embryos and tumors

تنوعها والإشارات الكهربائية الذاتية بوساطة قنوات أيون والمضخات الموجودة على غشاء الخلية، تلعب أدواراً هامة في إشارات العمليات منفعل من الخلايا العصبية والعضلات والعديد من العمليات البيولوجية الأخرى، مثل الجنينية الزخرفة التنموية. ومع ذلك، هناك حاجة لرصد النشاط الكهربائي في فيفو في embryogenesis الفقاريات. التقدم المحرز مؤشرات الجهد الفلورسنت المشفرة جينياً (جيفيس) مكنت لتوفير حل لمواجهة هذا التحدي. هنا، نحن تصف كيفية إنشاء الزرد مؤشر جهد المحورة وراثيا استخدام مؤشر الجهد المعمول، ASAP1 (تسارع جهاز استشعار لإمكانات العمل 1)، على سبيل مثال. يو بي أي، اختيرت كيت Tol2 ومروج الزرد في كل مكان، في هذه الدراسة. ونحن أيضا شرح عمليات استنساخ بوابة الموقع، Tol2 الزرد المستندة إلى ينقول ترانسجينيسيس، وعملية التصوير للأورام الأجنة والأسماك الأسماك في مرحلة مبكرة باستخدام المجاهر العادية ابيفلوريسسينت. استخدام هذا الخط الأسماك، وجدنا أن هناك تغيرات الجهد الكهربائي الخلوية أثناء embryogenesis الزرد، وحركة الأسماك اليرقات. وعلاوة على ذلك، فقد لوحظ أن ورم الخلايا كانت عموما الاستقطاب في أورام غمد الأعصاب الطرفية الخبيثة الزرد قليلة، مقارنة بالانسجة الطبيعية المحيطة بها.

في حقن ناجحة، أكثر من أجنة الأسماك 50% حقن سيتم عرض بعض درجة الفلورية الخضراء في الخلايا الجسمية، ومعظمها سيكون إيجابيا بمقايسة المكوس ينقول Tol2 (الشكل 2). بعد خارج عبر الأجيال 2-4 مع الأسماك wildtype (حتى الأسماك الفلورية تصل إلى 50 في المائة ونسبة مندلية المتوقعة)...

Watch this Scientific Journal Video about Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors at JoVE.com

Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

التصور للنشاط الكهربائي الخلوية في الزرد الأجنة في وقت مبكر، والأورام

هنا، نحن إظهار عملية إنشاء خط جهد كهربائي خلوية الزرد مراسل لتصور التنمية الجنينية، والحركة، والأسماك ورم الخلايا في الجسم الحي.

Bioelectricity, endogenous electrical signaling mediated by ion channels and pumps located on the cell membrane, plays important roles in signaling ...

visualization-cellular-electrical-activity-zebrafish-early-embryos

Research

JoVE Journal

Developmental Biology

8.7K Views.  Purdue University. هنا، نحن إظهار عملية إنشاء خط جهد كهربائي خلوية الزرد مراسل لتصور التنمية الجنينية، والحركة، والأسماك ورم الخلايا في الجسم الحي.

Video: Visualization of Cellular Electrical Activity in Zebrafish Early Embryos and Tumors

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological systems. In FDAP experiments, the clearance of proteins within living organisms can be measured. A protein of interest is tagged with a photoconvertible fluorescent protein, expressed in vivo and photoconverted, and the decrease in the photoconverted signal over time is monitored. The data is then fitted with an appropriate clearance model to determine the protein half-life. Importantly, the clearance kinetics of protein populations in different compartments of the organism can be examined separately by applying compartmental masks. This approach has been used to determine the intra- and extracellular half-lives of secreted signaling proteins during zebrafish development. Here, we describe a protocol for FDAP experiments in zebrafish embryos. It should be possible to use FDAP to determine the clearance kinetics of any taggable protein in any optically accessible organism.

Measuring Protein Stability in Living Zebrafish Embryos Using Fluorescence Decay After Photoconversion FDAP

Protein levels in cells and tissues are often tightly regulated by the balance of protein production and clearance. Using Fluorescence Decay After Photoconversion (FDAP), the clearance kinetics of proteins can be experimentally measured in vivo.

قياس الاستقرار البروتين المتواجد في الحي اسماك الزرد الأجنة عن طريق الإسفار تسوس بعد Photoconversion (FDAP)

Protein stability influences many aspects of biology, and measuring the clearance kinetics of proteins can provide important insights into biological ...

Mechanical Vessel Injury in Zebrafish Embryos

Zebrafish (Danio rerio) embryos have proven to be a powerful model for studying a variety of developmental and disease processes. External development and optical transparency make these embryos especially amenable to microscopy, and numerous transgenic lines that label specific cell types with fluorescent proteins are available, making the zebrafish embryo an ideal system for visualizing the interaction of vascular, hematopoietic, and other cell types during injury and repair in vivo. Forward and reverse genetics in zebrafish are well developed, and pharmacological manipulation is possible. We describe a mechanical vascular injury model using micromanipulation techniques that exploits several of these features to study responses to vascular injury including hemostasis and blood vessel repair. Using a combination of video and timelapse microscopy, we demonstrate that this method of vascular injury results in measurable and reproducible responses during hemostasis and wound repair. This method provides a system for studying vascular injury and repair in detail in a whole animal model.

This article describes a method for creating a mechanical vessel injury in zebrafish embryos. This injury model provides a platform for studying hemostasis, injury-related inflammation, and wound healing in an organism ideally suited for real-time microscopy.

إصابة سفينة الميكانيكية في الزرد الأجنة

Zebrafish (Danio rerio) embryos have proven to be a powerful model for studying a variety of developmental and disease processes.  External development ...

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo development due to their similar developmental process. Although genetic factors are known to affect early embryonic development, the discovery of such factors has been a serious challenge. Microarray technology allows quantitative measurement and gene expression profiling of transcript levels on a genome-wide basis. One of the main decisions that have to be made when planning a microarray experiment is whether to use a one- or two-color approach. Two-color design increases technical replication, minimizes variability, improves sensitivity and accuracy as well as allows having loop designs, defining the common reference samples. Although microarray is a powerful biological tool, there are potential pitfalls that can attenuate its power. Hence, in this technical paper we demonstrate an optimized protocol for RNA extraction, amplification, labeling, hybridization of the labeled amplified RNA to the array, array scanning and data analysis using the two-color analysis strategy.

Transcriptome Profiling of In-Vivo Produced Bovine Pre-implantation Embryos Using Two-color Microarray Platform

Microarray technology allows quantitative measurement and gene expression profiling of transcripts on a genome-wide basis. Therefore, this protocol provides an optimized technical procedure in a two-color custom made bovine array using Day 7 bovine embryos to demonstrate the feasibility of using low amount of total RNA.

Transcriptome على من التنميط<em&gt; في الجسم الحي</em&gt; إنتاج الأبقار الأجنة قبل الزرع عن طريق اللونين ميكروأري منصة

Early embryonic loss is a large contributor to infertility in cattle. Moreover, bovine becomes an interesting model to study human preimplantation embryo ...

Isolation and Characterization of Single Cells from Zebrafish Embryos

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been described at the morphological level, little is known about the molecular basis of cellular changes that occur as the organism develops. With recent advancements in microfluidics and multiplexing technologies, it is now possible to characterize gene expression in single cells. This allows for investigation of heterogeneity between individual cells of specific cell populations to identify and classify cell subtypes, characterize intermediate states that occur during cell differentiation, and explore differential cellular responses to stimuli. This study describes a protocol to isolate viable, single cells from zebrafish embryos for high throughput multiplexing assays. This method may be rapidly applied to any zebrafish embryonic cell type with fluorescent markers. An extension of this method may also be used in combination with high throughput sequencing technologies to fully characterize the transcriptome of single cells. As proof of principle, the relative abundance of cardiac differentiation markers was assessed in isolated, single cells derived from nkx2.5 positive cardiac progenitors. By evaluation of gene expression at the single cell level and at a single time point, the data support a model in which cardiac progenitors coexist with differentiating progeny. The method and work flow described here is broadly applicable to the zebrafish research community, requiring only a labeled transgenic fish line and access to microfluidics technologies.

This protocol describes a method for isolating single cells from zebrafish embryos, enriching for cells of interest, capturing zebrafish cells in microfluidic based single cell multiplex systems, and assessing gene expression from single cells.

عزل وتوصيف الخلايا واحدة من اسماك الزرد الأجنة

The zebrafish (Danio rerio) is a powerful model organism to study vertebrate development. Though many aspects of zebrafish embryonic development have been ...

Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the cells are located. Specifically, they have been developed to analyze the electrical activity of excitable cells, such as spinal neurons. In such a scenario, it is crucial to preserve the integrity of the spinal cell, but it is also important to preserve the anatomy and physiological shape of the systems involved. Indeed, the comprehension of the manner in which the nervous system-and other complex systems-works must be based on a systemic approach. For this reason, the live zebrafish embryo was chosen as a model system, and the spinal neuron membrane voltage changes were evaluated without interfering with the physiological conditions of the embryos. 
Here, an approach combining the employment of zebrafish embryos with a FRET-based biosensor is described. Zebrafish embryos are characterized by a very simplified nervous system and are particularly suited for imaging applications thanks to their transparency, allowing for the employment of fluorescence-based voltage indicators at the plasma membrane during zebrafish development. The synergy between these two components makes it possible to analyze the electrical activity of the cells in intact living organisms, without perturbing the physiological state. Finally, this non-invasive approach can co-exist with other analyses (e.g., spontaneous movement recordings, as shown here).

Protocols described here allow for the study of the electrical properties of excitable cells in the most non-invasive physiological conditions by employing zebrafish embryos in an in vivo system together with a fluorescence resonance energy transfer (FRET)-based genetically encoded voltage indicator (GEVI) selectively expressed in the cell type of interest.

بيوسنسينغ موتور الخلايا العصبية الغشاء المحتملة في الأجنة الزرد الحية

The protocols described here are designed to allow researchers to study cell communication without altering the integrity of the environment in which the ...

Induction of Hypoxia in Living Frog and Zebrafish Embryos

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and zebrafish embryos. Our system comprises a chamber featuring a simple setup that is nevertheless robust to induce and maintain a specific oxygen concentration and temperature in any experimental solution of choice. The presented system is very cost-effective but highly functional, it allows induction and sustainment of hypoxia for direct experiments in vivo and for various time periods up to 48 h.
To monitor and study the effects of hypoxia, we have employed two methods - measurement of levels of hypoxia-inducible factor 1alpha (HIF-1&#945;) in whole embryos or specific tissues and determination of retinal stem cell proliferation by 5-ethynyl-2&#8242;-deoxyuridine (EdU) incorporation into the DNA. HIF-1&#945; levels can serve as a general hypoxia marker in the whole embryo or tissue of choice, here embryonic retina. EdU incorporation into the proliferating cells of embryonic retina is a specific output of hypoxia induction. Thus, we have shown that hypoxic embryonic retinal progenitors decrease proliferation within 1 h of incubation under 5% oxygen of both frog and zebrafish embryos.
Once mastered, our setup can be employed for use with small aquatic model organisms, for direct in vivo experiments, any given time period and under normal, hypoxic or hyperoxic oxygen concentration or under any other given gas mixture.

We introduce a novel hypoxic chamber system for use with aquatic organisms such as frog and zebrafish embryos. Our system is simple, robust, cost-effective and allows the induction and sustainment of hypoxia in vivo and for up to 48 h. We present 2 reproducible methods to monitor the effectiveness of hypoxia.

تحريض نقص الأكسجة في الضفدع الحي والأجنة الزرد

Here, we introduce a novel system for hypoxia induction, which we developed to study the effects of hypoxia in aquatic organisms such as frog and ...

Multi-Photon Time Lapse Imaging to Visualize Development in Real-time: Visualization of Migrating Neural Crest Cells in Zebrafish Embryos

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to numerous cell types throughout the body. Understanding the biology of the neural crest has been limited, reflecting a lack of genetically tractable models that can be studied in vivo and in real-time. Zebrafish is a particularly important developmental model for studying migratory cell populations, such as the neural crest. To examine neural crest migration into the developing eye, a combination of the advanced optical techniques of laser scanning microscopy with long wavelength multi-photon fluorescence excitation was implemented to capture high-resolution, three-dimensional, real-time videos of the developing eye in transgenic zebrafish embryos, namely Tg(sox10:EGFP) and Tg(foxd3:GFP), as sox10 and foxd3 have been shown in numerous animal models to regulate early neural crest differentiation and likely represent markers for neural crest cells. Multi-photon time-lapse imaging was used to discern the behavior and migratory patterns of two neural crest cell populations contributing to early eye development. This protocol provides information for generating time-lapse videos during zebrafish neural crest migration, as an example, and can be further applied to visualize the early development of many structures in the zebrafish and other model organisms.

A combination of the advanced optical techniques of laser scanning microscopy with long wavelength multi-photon fluorescence excitation was implemented to capture high-resolution, three-dimensional, real-time imaging of neural crest migration in Tg(sox10:EGFP) and Tg(foxd3:GFP) zebrafish embryos.

تصوير مرور الوقت فوتون متعددة لتصور التنمية في الوقت الحقيقي: التصور لترحيل الخلايا العصبية كريست في الأجنة الزرد

Congenital eye and craniofacial anomalies reflect disruptions in the neural crest, a transient population of migratory stem cells that give rise to ...

Visualizing the Node and Notochordal Plate In Gastrulating Mouse Embryos Using Scanning Electron Microscopy and Whole Mount Immunofluorescence

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is the formation of the transient organizers, the node and notochordal plate, from cells that have passed through the primitive streak. The proper formation of these signaling centers is essential for the development of the body plan and techniques to visualize them are of high interest to mouse developmental biologists. The node and notochordal plate lie on the ventral surface of gastrulating mouse embryos around embryonic day (E) 7.5 of development. The node is a cup-shaped structure whose cells possess a single slender cilium each. The proper subcellular localization and rotation of the cilia in the node pit determines left-right asymmetry. The notochordal plate cells also possess single cilia albeit shorter than those of the node cells. The notochordal plate forms the notochord which acts as an important signaling organizer for somitogenesis and neural patterning. Because the cells of the node and notochordal plate are transiently present on the surface and possess cilia, they can be visualized using scanning electron microscopy (SEM). Among other techniques used to visualize these structures at the cellular level is whole mount immunofluorescence (WMIF) using the antibodies against the proteins that are highly expressed in the node and notochordal plate. In this report, we describe our optimized protocols to perform SEM and WMIF of the node and notochordal plate in developing mouse embryos to help in the assessment of tissue shape and cellular organization in wild-type and gastrulation mutant embryos.

The node and notochordal plate are transient signaling organizers in developing mouse embryos that can be visualized using several techniques. Here, we describe in detail how to perform two of the techniques to study their structure and morphogenesis: 1) scanning electron microscopy (SEM); and 2) whole mount immunofluorescence (WMIF).

تصور بالعقدة ولوحة نوتوتشوردال في جاسترولاتينج الأجنة الماوس باستخدام الميكروسكوب الإلكتروني المسح وكله جبل الفلورة

The post-implantation mouse embryo undergoes major shape changes after the initiation of gastrulation and morphogenesis. A hallmark of morphogenesis is ...

Whole Mount Immunohistochemistry in Zebrafish Embryos and Larvae

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. Although many immunohistochemistry protocols have been optimized for mammalian tissue and tissue sections, these protocols often require modification and optimization for non-mammalian model organisms. Zebrafish are increasingly used as a model system in basic, biomedical, and translational research to investigate the molecular, genetic, and cell biological mechanisms of developmental processes. Zebrafish offer many advantages as a model system but also require modified techniques for optimal protein detection. Here, we provide our protocol for whole-mount fluorescence immunohistochemistry in zebrafish embryos and larvae. This protocol additionally describes several different mounting strategies that can be employed and an overview of the advantages and disadvantages each strategy provides. We also describe modifications to this protocol to allow detection of chromogenic substrates in whole mount tissue and fluorescence detection in sectioned larval tissue. This protocol is broadly applicable to the study of many developmental stages and embryonic structures.

Here, we present a protocol for fluorescent antibody-mediated detection of proteins in whole preparations of zebrafish embryos and larvae.

كامل جبل المناعة الكيمياء في الأجنة حمار وحشي واليرقات

Immunohistochemistry is a widely used technique to explore protein expression and localization during both normal developmental and disease states. ...

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs during early development are technically challenging due to the limiting cell number. Moreover, many approaches require a miRNA of interest to be defined in assays such as northern blotting, microarray, and qPCR. Therefore, the expression of many miRNAs and their isoforms have not been studied during early development. Here, we demonstrate a protocol for small RNA sequencing of sorted cells from early mouse embryos to enable relatively unbiased profiling of miRNAs in early populations of neural crest cells. We overcome the challenges of low cell input and size selection during library preparation using amplification and gel-based purification. We identify embryonic age as a variable accounting for variation between replicates and stage-matched mouse embryos must be used to accurately profile miRNAs in biological replicates. Our results suggest that this method can be broadly applied to profile the expression of miRNAs from other lineages of cells. In summary, this protocol can be used to study how miRNAs regulate developmental programs in different cell lineages of the early mouse embryo.

We describe a technique for profiling microRNAs in early mouse embryos. This protocol overcomes the challenge of low cell input and small RNA enrichment. This assay can be used to analyze changes in miRNA expression over time in different cell lineages of the early mouse embryo.

إعداد مكتبات RNA الصغيرة لتسلسل من أجنة الماوس المبكر

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs ...